ID: 1167371008

View in Genome Browser
Species Human (GRCh38)
Location 19:49081988-49082010
Sequence TGGTGGCCCAAGCTGTACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167371008_1167371015 6 Left 1167371008 19:49081988-49082010 CCCAAGTACAGCTTGGGCCACCA No data
Right 1167371015 19:49082017-49082039 AGGGTGCAAGCCATAAACTTTGG No data
1167371008_1167371017 20 Left 1167371008 19:49081988-49082010 CCCAAGTACAGCTTGGGCCACCA No data
Right 1167371017 19:49082031-49082053 AAACTTTGGCAGCTTTCATGTGG No data
1167371008_1167371018 21 Left 1167371008 19:49081988-49082010 CCCAAGTACAGCTTGGGCCACCA No data
Right 1167371018 19:49082032-49082054 AACTTTGGCAGCTTTCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167371008 Original CRISPR TGGTGGCCCAAGCTGTACTT GGG (reversed) Intergenic
No off target data available for this crispr