ID: 1167371009

View in Genome Browser
Species Human (GRCh38)
Location 19:49081989-49082011
Sequence GTGGTGGCCCAAGCTGTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167371009_1167371018 20 Left 1167371009 19:49081989-49082011 CCAAGTACAGCTTGGGCCACCAC No data
Right 1167371018 19:49082032-49082054 AACTTTGGCAGCTTTCATGTGGG No data
1167371009_1167371017 19 Left 1167371009 19:49081989-49082011 CCAAGTACAGCTTGGGCCACCAC No data
Right 1167371017 19:49082031-49082053 AAACTTTGGCAGCTTTCATGTGG No data
1167371009_1167371015 5 Left 1167371009 19:49081989-49082011 CCAAGTACAGCTTGGGCCACCAC No data
Right 1167371015 19:49082017-49082039 AGGGTGCAAGCCATAAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167371009 Original CRISPR GTGGTGGCCCAAGCTGTACT TGG (reversed) Intergenic
No off target data available for this crispr