ID: 1167371010

View in Genome Browser
Species Human (GRCh38)
Location 19:49081997-49082019
Sequence AGCTTGGGCCACCACTCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167371001_1167371010 21 Left 1167371001 19:49081953-49081975 CCTGCTGTTCGATCACCAGCCAT No data
Right 1167371010 19:49081997-49082019 AGCTTGGGCCACCACTCCAGAGG No data
1167371005_1167371010 2 Left 1167371005 19:49081972-49081994 CCATGACACACAGGGTCCCAAGT No data
Right 1167371010 19:49081997-49082019 AGCTTGGGCCACCACTCCAGAGG No data
1167371004_1167371010 6 Left 1167371004 19:49081968-49081990 CCAGCCATGACACACAGGGTCCC No data
Right 1167371010 19:49081997-49082019 AGCTTGGGCCACCACTCCAGAGG No data
1167370999_1167371010 29 Left 1167370999 19:49081945-49081967 CCTGCATCCCTGCTGTTCGATCA No data
Right 1167371010 19:49081997-49082019 AGCTTGGGCCACCACTCCAGAGG No data
1167370998_1167371010 30 Left 1167370998 19:49081944-49081966 CCCTGCATCCCTGCTGTTCGATC No data
Right 1167371010 19:49081997-49082019 AGCTTGGGCCACCACTCCAGAGG No data
1167371000_1167371010 22 Left 1167371000 19:49081952-49081974 CCCTGCTGTTCGATCACCAGCCA No data
Right 1167371010 19:49081997-49082019 AGCTTGGGCCACCACTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167371010 Original CRISPR AGCTTGGGCCACCACTCCAG AGG Intergenic
No off target data available for this crispr