ID: 1167371015

View in Genome Browser
Species Human (GRCh38)
Location 19:49082017-49082039
Sequence AGGGTGCAAGCCATAAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167371008_1167371015 6 Left 1167371008 19:49081988-49082010 CCCAAGTACAGCTTGGGCCACCA No data
Right 1167371015 19:49082017-49082039 AGGGTGCAAGCCATAAACTTTGG No data
1167371004_1167371015 26 Left 1167371004 19:49081968-49081990 CCAGCCATGACACACAGGGTCCC No data
Right 1167371015 19:49082017-49082039 AGGGTGCAAGCCATAAACTTTGG No data
1167371009_1167371015 5 Left 1167371009 19:49081989-49082011 CCAAGTACAGCTTGGGCCACCAC No data
Right 1167371015 19:49082017-49082039 AGGGTGCAAGCCATAAACTTTGG No data
1167371005_1167371015 22 Left 1167371005 19:49081972-49081994 CCATGACACACAGGGTCCCAAGT No data
Right 1167371015 19:49082017-49082039 AGGGTGCAAGCCATAAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167371015 Original CRISPR AGGGTGCAAGCCATAAACTT TGG Intergenic
No off target data available for this crispr