ID: 1167373855

View in Genome Browser
Species Human (GRCh38)
Location 19:49100992-49101014
Sequence CCCGGGCCTGCCCACCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167373841_1167373855 30 Left 1167373841 19:49100939-49100961 CCCAGCTCCTCAGCGACCACACT 0: 1
1: 0
2: 1
3: 21
4: 144
Right 1167373855 19:49100992-49101014 CCCGGGCCTGCCCACCTTTGTGG 0: 1
1: 0
2: 2
3: 15
4: 175
1167373842_1167373855 29 Left 1167373842 19:49100940-49100962 CCAGCTCCTCAGCGACCACACTT No data
Right 1167373855 19:49100992-49101014 CCCGGGCCTGCCCACCTTTGTGG 0: 1
1: 0
2: 2
3: 15
4: 175
1167373844_1167373855 23 Left 1167373844 19:49100946-49100968 CCTCAGCGACCACACTTCTCGGC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1167373855 19:49100992-49101014 CCCGGGCCTGCCCACCTTTGTGG 0: 1
1: 0
2: 2
3: 15
4: 175
1167373850_1167373855 1 Left 1167373850 19:49100968-49100990 CCTGGCATTGGGGCGCTTGATGA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1167373855 19:49100992-49101014 CCCGGGCCTGCCCACCTTTGTGG 0: 1
1: 0
2: 2
3: 15
4: 175
1167373846_1167373855 14 Left 1167373846 19:49100955-49100977 CCACACTTCTCGGCCTGGCATTG 0: 1
1: 0
2: 0
3: 13
4: 197
Right 1167373855 19:49100992-49101014 CCCGGGCCTGCCCACCTTTGTGG 0: 1
1: 0
2: 2
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167373855 Original CRISPR CCCGGGCCTGCCCACCTTTG TGG Intronic
900192999 1:1359237-1359259 CCTGGGGCTGCCCGCCTTTAGGG + Intronic
900404783 1:2487746-2487768 CCCTACCCTGCCCACCTCTGGGG - Intronic
900418555 1:2545999-2546021 CCCGGGCCTGGCCTCCTCAGGGG - Intergenic
907385383 1:54122313-54122335 CCCGGGCGTTCCCTCCTATGTGG - Intergenic
910909150 1:92215405-92215427 CCAGAGCCTGACCACCTTTCTGG - Intergenic
912231148 1:107794213-107794235 CCTGGGCCAGCCCAGATTTGTGG - Intronic
912650243 1:111432094-111432116 CCGGGGTGTGCCCACCTTTTTGG - Intergenic
915586228 1:156845357-156845379 CCTAGTCCTGCTCACCTTTGGGG + Exonic
915902051 1:159854561-159854583 CCCGCCCCTTCCCACTTTTGGGG + Exonic
915928985 1:160046751-160046773 CAGGGGCCTGGCCAGCTTTGGGG - Intronic
919924496 1:202185417-202185439 CCCCTCCCTGCCCACCTTTCTGG - Intergenic
921355656 1:214281794-214281816 CCCGTGGCTGCCCAAATTTGGGG - Intronic
1062882290 10:988520-988542 CCCGGGGCCGCCTACCTTGGCGG - Exonic
1063322159 10:5060776-5060798 CCTGAGCCTCCCCACCTCTGTGG - Intronic
1067079106 10:43203597-43203619 CCCGGCCCTGCCTACCTAGGAGG + Intronic
1067564270 10:47325648-47325670 GCAGGCCTTGCCCACCTTTGTGG - Exonic
1067833571 10:49624100-49624122 ACCTGGCCTGCCCACCTCTCTGG + Intronic
1069997124 10:72349283-72349305 CCCTGGCCAGCCCACTTCTGTGG - Intronic
1070612080 10:77940274-77940296 CACTTCCCTGCCCACCTTTGAGG + Intergenic
1070761383 10:79026524-79026546 CCAGGCCCTGCCCACCTCTTTGG - Intergenic
1070955045 10:80458165-80458187 CCTGGTCCTCCCCACTTTTGTGG + Intronic
1074435574 10:113431479-113431501 CCTTGTGCTGCCCACCTTTGGGG - Intergenic
1075021466 10:118955744-118955766 CCTGGACCTGCCCACCATGGGGG - Intergenic
1076462535 10:130656474-130656496 CCAGGGCAAGCCCACCCTTGTGG - Intergenic
1077076291 11:703680-703702 ACCGGGCCTGCCTGCCTGTGAGG - Intronic
1078877318 11:15411570-15411592 CCTGGTCCTTCCCATCTTTGTGG - Intergenic
1079159424 11:17978348-17978370 CCTGGGCCTGCCCATCTGTGGGG + Intronic
1084572284 11:69966834-69966856 TCAGGCCCTGCCCACCTTGGGGG - Intergenic
1084933486 11:72574893-72574915 CCCAGCCCAGCCCTCCTTTGAGG - Intergenic
1085522674 11:77147550-77147572 CCCTGCCCTGCCCACCTCTTAGG + Intronic
1087404904 11:97718064-97718086 CCCGCGCCGGCCCACCATCGCGG + Intergenic
1089764416 11:120752428-120752450 CAGGGGCCTGCCCACCTTGGCGG - Intronic
1091097190 11:132835084-132835106 CCTCAGCCTGGCCACCTTTGTGG - Intronic
1091168260 11:133499445-133499467 CCCTGGCCTCCCCTCCTGTGGGG + Intronic
1094820183 12:34218766-34218788 ACCGAGCCTGCCCACCTTTGCGG + Intergenic
1095517292 12:43020822-43020844 CCCGTGCCTGGCTGCCTTTGTGG - Intergenic
1101587995 12:106101757-106101779 CCCTGGCCTGCCCACCTCACAGG + Intronic
1103521234 12:121537870-121537892 CCCGGGCGCCCCCTCCTTTGTGG - Intronic
1103619460 12:122177789-122177811 ACTGCGCCTGGCCACCTTTGTGG + Intronic
1103676465 12:122659953-122659975 CCCGAGCCTGGCCAGCTCTGCGG - Intergenic
1104479748 12:129097098-129097120 CCCTGCCCTGTCCACATTTGGGG + Intronic
1113789662 13:113021659-113021681 CCTGGCACTGCCCACCTTGGTGG + Intronic
1119821767 14:77622457-77622479 CCAGGACCTGCCCAGTTTTGTGG - Intergenic
1122378636 14:101286154-101286176 GACGGGCCTGGCCAGCTTTGAGG + Intergenic
1122856337 14:104561959-104561981 CCAGGGCCTGCCCAGCGATGGGG + Intronic
1122886419 14:104712411-104712433 CCCGGCCCTCCTCACCTTTCAGG + Exonic
1123431296 15:20219291-20219313 CCCGGGCCTCCCCAGCTCTGTGG - Intergenic
1124215926 15:27807089-27807111 CCCCGGCCCGCCCACCTCTGGGG + Intronic
1130337306 15:82967584-82967606 CCCGTGCCTGGCCTGCTTTGTGG - Intronic
1130903451 15:88224020-88224042 CCCGGGCCTTCCTAGCTATGTGG - Intronic
1132499729 16:280135-280157 CGGGGGCCTGCCCAGCCTTGGGG - Intronic
1132558391 16:582652-582674 CTCGGGGCTGCCCAACTCTGAGG - Intronic
1132974738 16:2705662-2705684 CCCGGGCCTGCCTGCCTGTGGGG + Intronic
1136569414 16:31087862-31087884 TCCAGGCCTGCCTAGCTTTGGGG + Intronic
1136853348 16:33631933-33631955 CCCGGGCCTCCCCAGCTCTGTGG + Intergenic
1139332743 16:66206319-66206341 CCCTGGACTGCACAGCTTTGAGG + Intergenic
1140464130 16:75165666-75165688 CCTGAGCCTGGCCACCTCTGGGG + Intronic
1203114943 16_KI270728v1_random:1480378-1480400 CCTGGGCCTCCCCAGCTCTGTGG + Intergenic
1142476794 17:193647-193669 CCCTGGCATGGCCACCCTTGTGG + Intergenic
1142973715 17:3630503-3630525 CCTGGGCCTGCCCTCCACTGGGG + Intronic
1145976480 17:28986953-28986975 CCCGTGACTGCCCACCTCAGAGG - Intronic
1147647585 17:42043079-42043101 CCAGGGCCAGCCCCCTTTTGAGG - Intronic
1147656326 17:42093114-42093136 TCCTGGCCTCCCCACCTCTGTGG - Intergenic
1148063104 17:44850066-44850088 CCCTGGCCTGCCTACCTTGCAGG + Exonic
1150248085 17:63690924-63690946 CCAAGGCCTGCCCAGCATTGTGG + Intronic
1152457625 17:80425335-80425357 CCAGGGCCTGCCCACCCTCAGGG - Intronic
1152529290 17:80907628-80907650 CCCGTGCCTGCCCCCCCTTCTGG + Intronic
1152721093 17:81924139-81924161 CCCGGGCCTGCCCAACGTGAAGG + Intronic
1152746042 17:82039810-82039832 CTCCGGCCTGTCCACCTCTGTGG - Intergenic
1152787993 17:82261712-82261734 CCCTGCCCTGCCCACCTGAGAGG - Intronic
1152892936 17:82892692-82892714 CCCAAGCCTGCCCACCTCCGAGG - Intronic
1153622306 18:6990489-6990511 CCAGGACCTGCCCACCCTGGAGG - Intronic
1155508259 18:26551048-26551070 CCCAGGTCTCCCCACCTCTGCGG + Intronic
1156088783 18:33440686-33440708 CCCGCGCCTGCCCACCCCTCCGG + Exonic
1160009119 18:75090211-75090233 CCCGGGCGTGCCCAGCTTGGAGG + Intergenic
1160223266 18:76992547-76992569 CCCTGCCCTGCCCACCCTTCAGG + Intronic
1160234816 18:77077627-77077649 CCCGGGCCGGCCCAGCATCGAGG - Intronic
1161237130 19:3203837-3203859 CCCGGGGCCGCTCACCTGTGTGG - Exonic
1161273831 19:3404604-3404626 CCCGGCCCTGCCCTCCTGGGTGG - Intronic
1161296494 19:3523067-3523089 CCCCGCCCTGCCCACCACTGTGG + Intronic
1161611252 19:5244192-5244214 CCGGGGCCTGCTCGCCTGTGCGG + Exonic
1164478472 19:28593227-28593249 CCCTAACCTGCCCACCTTTGTGG + Intergenic
1164631400 19:29764150-29764172 CCCTGGCCTGCACACCTCAGAGG - Intergenic
1164646448 19:29861965-29861987 ACCGCGCCTAGCCACCTTTGTGG - Intergenic
1165046410 19:33108328-33108350 CCCGCCCCTGCCCGCCTTTCAGG + Intronic
1166781922 19:45347537-45347559 CCCTGGCCTGCCATCCTCTGTGG - Intronic
1167373855 19:49100992-49101014 CCCGGGCCTGCCCACCTTTGTGG + Intronic
1167467258 19:49656863-49656885 ACCGTGCCTGGCCACCTTTGTGG - Intronic
1167741721 19:51327910-51327932 CCCGGCCCCGCCCACCTTCCCGG - Intronic
1168444961 19:56404042-56404064 CCCCGGCCTGGCAGCCTTTGGGG + Intronic
925016199 2:525962-525984 CACTGGCCTGCCCACGTTTTTGG - Intergenic
925293934 2:2765669-2765691 CCCAGGCCTGGCCACCTGCGGGG - Intergenic
925990363 2:9249769-9249791 CACGGCCCTGCCCTCCTCTGGGG - Intronic
926144160 2:10386659-10386681 CCCCAGCCTGCAGACCTTTGTGG - Intronic
927467720 2:23349773-23349795 CCCGGGACTCCCCAGCATTGGGG + Intergenic
932737415 2:74264064-74264086 CCCGGGTGAGCCCACCTTAGGGG - Intronic
933349025 2:81128600-81128622 CTCGGGCCTCCCCAGCTTTCTGG + Intergenic
935046908 2:99490427-99490449 CCCGCGCCTGCCCCGCCTTGGGG + Intergenic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
935947715 2:108301300-108301322 ACCGCGCCTGGCCTCCTTTGGGG - Intronic
940639032 2:156329198-156329220 CCCGGGACTGCCCAGCTCTCCGG - Intronic
942004882 2:171687960-171687982 CCCCGCCCGGCCCAGCTTTGGGG + Intronic
946577894 2:221096140-221096162 TCCTGGGCTGCCCACCTTTCAGG + Intergenic
947539328 2:230964327-230964349 CCCGAGCCTCCCCACCTCCGTGG - Intergenic
1171499906 20:25585440-25585462 CCCGGGCCGGCTCACCTGGGAGG + Exonic
1172614402 20:36274112-36274134 CCAGTGCCTGCCTCCCTTTGTGG + Intergenic
1172870755 20:38134233-38134255 CCCCGACCTGCCCACCTCTTTGG + Intronic
1174142500 20:48425740-48425762 CCCCGGTCTGCTCACCTTAGTGG + Intergenic
1174677584 20:52373266-52373288 CCCAGACCTGCCTACCTATGGGG + Intergenic
1175547585 20:59788532-59788554 CTTGGGCCTGCTCACCTTTAGGG - Intronic
1179231942 21:39511934-39511956 CCCTGGTCTGCACACCTTTCTGG + Intronic
1179464389 21:41562141-41562163 GCCGGGCCAGGCCACATTTGTGG - Intergenic
1179881061 21:44293515-44293537 GGCGGGCCTGGCCTCCTTTGGGG - Intronic
1181018193 22:20083421-20083443 CCCAGGACTGCCCACCACTGAGG + Intronic
1181620642 22:24088983-24089005 CCCCAGCCTGCCCAACTCTGGGG - Intronic
1182112234 22:27732043-27732065 CCCTGGCTTGCTCACCTTTCTGG + Intergenic
1183026765 22:35071129-35071151 CCCGGCCCTGTCTACCTTCGAGG + Intronic
1183593196 22:38793800-38793822 CCAAGGCCTGCCCAGCTTCGTGG - Intronic
1183870333 22:40736970-40736992 CCCGGGCCTGGGCAGCCTTGGGG + Intergenic
1184342454 22:43893450-43893472 CCCGGTACCGCCCACCTCTGTGG - Intergenic
1184520463 22:44991028-44991050 CCCCGCCCTGCCCACCTTCCAGG + Intronic
1184712944 22:46263540-46263562 CCTGGGCCTGCACACACTTGGGG - Intergenic
1184889302 22:47369719-47369741 CCCGTGCCTGCCCAGCTGGGAGG + Intergenic
1185219991 22:49624394-49624416 CTCGGGGCTGCTGACCTTTGTGG + Exonic
1185370157 22:50457153-50457175 CCTGGGCGTGCCCAGCTTGGGGG + Intronic
951190530 3:19764547-19764569 CCCAACCCTGCACACCTTTGGGG + Intergenic
952929144 3:38346459-38346481 CCTGGGCCTGCCGTCCTCTGTGG - Intergenic
953412676 3:42699017-42699039 CCAGGTCCAGCTCACCTTTGGGG + Exonic
954223980 3:49171234-49171256 CCGGCGCCTGCCCACCTCCGCGG - Intergenic
954419711 3:50412317-50412339 TGCTGGCCTGCCCACCATTGGGG - Intronic
956905189 3:73758483-73758505 CCCCAGCCTGCACACCTCTGAGG - Intergenic
958896764 3:99838250-99838272 CCCGTGCCTGCCCATTTGTGTGG + Intronic
959132549 3:102374985-102375007 CCTGTGCCTGCCCAGCTCTGTGG + Intronic
961439503 3:126944559-126944581 CCCTGGCCTGCTCACCTGAGAGG - Intronic
961538570 3:127585342-127585364 CCTGGCCCTGCCAACCTTTCTGG - Intronic
962212607 3:133491608-133491630 CCTGGACCTGCCCACCTGAGAGG + Intergenic
964569438 3:158095501-158095523 CCCTGGCCTGCCCGCCTTTGCGG + Intergenic
967669042 3:192210442-192210464 ACCAGGTCTGTCCACCTTTGTGG - Intronic
967896033 3:194396919-194396941 CCAGGGCCTGCGCACCGTGGGGG + Exonic
971331703 4:25686755-25686777 CCCAGGCCTGGCCACCAATGGGG + Intergenic
973785635 4:54330221-54330243 CCTGAGCCTGATCACCTTTGAGG - Intergenic
974329284 4:60455783-60455805 CCCTGGCCTGCCTCCCTCTGAGG + Intergenic
976257073 4:83110079-83110101 GCCAGCCCTGCCCAGCTTTGCGG - Intronic
976339579 4:83932169-83932191 CCCAGGCCTGGAAACCTTTGTGG - Intergenic
981741409 4:148006177-148006199 CCTGGGCCTGCCAAGCATTGAGG + Intronic
985571086 5:645561-645583 CCCTGGCGTGCACAGCTTTGGGG - Intronic
989570730 5:42943947-42943969 CCCGGGCCTGCCAAACTCCGAGG - Intergenic
989577284 5:43000277-43000299 CCCGGGCCTGCCAAACTCGGAGG - Intergenic
989581072 5:43033922-43033944 CCCGGGCCTGCCAAACTCCGAGG - Intergenic
992024644 5:72658294-72658316 CACAGGCCTCCCCACCTTGGAGG - Intergenic
992614364 5:78534827-78534849 CCCGGACCTGCCAACATGTGTGG + Intronic
993201172 5:84817144-84817166 CCTGGCCCTTCCCACTTTTGCGG - Intergenic
996727652 5:126686808-126686830 CCCTGGCCTGACCATCTTTCAGG + Intergenic
997382362 5:133446809-133446831 CCCGGTCCTCCCCAGCTCTGTGG + Intronic
997568217 5:134905366-134905388 CCCGGGACTGACCACCTGTCCGG + Intronic
997778355 5:136631288-136631310 CCCTGGTCTGCCCACCTTACTGG - Intergenic
1000309527 5:160028766-160028788 CCCTGGCCTGCCCAGTTTTGTGG + Intronic
1002103333 5:176868125-176868147 CCCAGGGCTGCCCACCATGGAGG + Exonic
1002835474 6:861629-861651 CCAGGGCCAGGCCACCTTAGTGG - Intergenic
1005026406 6:21466742-21466764 CACTGTCATGCCCACCTTTGAGG + Intergenic
1006117435 6:31782615-31782637 CCAGGGCCTGCCCAGGTTTGAGG - Exonic
1006404219 6:33834788-33834810 CCTGGGCCTGCTCACCTGTGGGG - Intergenic
1007637081 6:43306052-43306074 GATGGGGCTGCCCACCTTTGGGG + Exonic
1008920997 6:56843878-56843900 CCCAGGCCCGCCCACCCTGGTGG + Intronic
1015177832 6:130330182-130330204 TCTGGGCCTGCCGACCTTTCAGG - Intronic
1015927273 6:138322962-138322984 CCCATGCCTGTCCACCTTGGAGG - Intronic
1016892123 6:149016964-149016986 CCCTGCCCTGCTCACATTTGAGG - Intronic
1017750545 6:157487167-157487189 CCCGGCCCTGGCCACCTTGCCGG + Intronic
1018792200 6:167157369-167157391 CCCGGGCTTGCTCATCTCTGAGG - Exonic
1018866254 6:167748792-167748814 CCCGTGCCTGCTCATCTATGTGG - Intergenic
1019559296 7:1647995-1648017 CCAGGGCCTGCCCGCCTTGGGGG + Intergenic
1020148336 7:5662438-5662460 CCTGATCCTGGCCACCTTTGAGG - Intronic
1020268228 7:6576169-6576191 GCCAGGCCTGTCCTCCTTTGAGG - Intergenic
1029704670 7:102269987-102270009 CCCGGGCCTGGCCCCCTGTGGGG - Intronic
1032214761 7:129949311-129949333 CCAGAGCCTGGCAACCTTTGAGG - Intronic
1036768450 8:11563528-11563550 CCGGAGCCTGCCCACCTGTGGGG - Intronic
1045002213 8:97888261-97888283 CCCCCACCTGCCCACTTTTGGGG - Intronic
1047796058 8:128257306-128257328 CCTGGGCCTGCCTGCCTTGGTGG - Intergenic
1048256200 8:132906886-132906908 CCCGGGCCTGCCAACGTGAGTGG + Exonic
1049791649 8:144475141-144475163 CCCTGGCCTGCCCCACCTTGCGG + Exonic
1056660025 9:88536298-88536320 CCAGGTGCTGGCCACCTTTGCGG + Intronic
1057075137 9:92134639-92134661 CCCCTCCCTGCCCACCTTTCTGG - Intergenic
1057797773 9:98170839-98170861 CCCTGCCCTGCCCACCTGTTAGG + Intronic
1060268491 9:122125952-122125974 CCCGGGCCTGACCAGCCTGGGGG - Intergenic
1060484166 9:124036662-124036684 TCCAGACCTGCCCACCTTGGAGG - Intergenic
1060741368 9:126099684-126099706 CCCCTGCGTGCTCACCTTTGAGG + Intergenic
1062361900 9:136192367-136192389 CCCGCTCCTGTCCACCCTTGGGG + Intergenic
1062446934 9:136599053-136599075 CCCGGGCCTGCCCTCATGTTGGG + Intergenic
1195881816 X:109600775-109600797 CTCGGGCCTGCCCATCCTTAAGG - Intergenic
1198249442 X:134866047-134866069 CCCTCTCCTGCCCACATTTGGGG - Intergenic
1198641460 X:138760505-138760527 CCCTCCCCTGCCCACCTTGGTGG - Intronic
1199170791 X:144732638-144732660 CCCAGGCCTCCCCAGCTATGTGG - Intergenic
1199986872 X:152959139-152959161 CCTGGCCCTTCCCCCCTTTGTGG + Intronic