ID: 1167373913

View in Genome Browser
Species Human (GRCh38)
Location 19:49101301-49101323
Sequence CAGCCTGCACACCAGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 1, 2: 2, 3: 50, 4: 414}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167373913_1167373920 -8 Left 1167373913 19:49101301-49101323 CCCAGGGCCTGGTGTGCAGGCTG 0: 1
1: 1
2: 2
3: 50
4: 414
Right 1167373920 19:49101316-49101338 GCAGGCTGTTGTGGGGTTGGTGG 0: 1
1: 2
2: 27
3: 918
4: 10402
1167373913_1167373923 -3 Left 1167373913 19:49101301-49101323 CCCAGGGCCTGGTGTGCAGGCTG 0: 1
1: 1
2: 2
3: 50
4: 414
Right 1167373923 19:49101321-49101343 CTGTTGTGGGGTTGGTGGGGCGG 0: 1
1: 19
2: 745
3: 10231
4: 10181
1167373913_1167373922 -6 Left 1167373913 19:49101301-49101323 CCCAGGGCCTGGTGTGCAGGCTG 0: 1
1: 1
2: 2
3: 50
4: 414
Right 1167373922 19:49101318-49101340 AGGCTGTTGTGGGGTTGGTGGGG 0: 1
1: 0
2: 7
3: 112
4: 942
1167373913_1167373921 -7 Left 1167373913 19:49101301-49101323 CCCAGGGCCTGGTGTGCAGGCTG 0: 1
1: 1
2: 2
3: 50
4: 414
Right 1167373921 19:49101317-49101339 CAGGCTGTTGTGGGGTTGGTGGG 0: 1
1: 0
2: 4
3: 40
4: 399
1167373913_1167373925 14 Left 1167373913 19:49101301-49101323 CCCAGGGCCTGGTGTGCAGGCTG 0: 1
1: 1
2: 2
3: 50
4: 414
Right 1167373925 19:49101338-49101360 GGGCGGAGCCGCCCTGTGGCAGG 0: 1
1: 0
2: 2
3: 17
4: 287
1167373913_1167373924 10 Left 1167373913 19:49101301-49101323 CCCAGGGCCTGGTGTGCAGGCTG 0: 1
1: 1
2: 2
3: 50
4: 414
Right 1167373924 19:49101334-49101356 GGTGGGGCGGAGCCGCCCTGTGG 0: 1
1: 0
2: 3
3: 28
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167373913 Original CRISPR CAGCCTGCACACCAGGCCCT GGG (reversed) Intronic
900134079 1:1106872-1106894 CTGCCGGCACCCCCGGCCCTGGG + Intronic
900178182 1:1299790-1299812 CTCCCTGCACACCAGGCGCCTGG - Intronic
900403148 1:2480908-2480930 GAGCCAGCAAACCAGGCCCTGGG + Intronic
900472492 1:2861686-2861708 GAGCCTGTTCACCTGGCCCTGGG + Intergenic
900625543 1:3606965-3606987 CAGGCTGCACAGCAGGCCCCAGG - Intronic
900974957 1:6011233-6011255 CCTCCTGCACACTTGGCCCTGGG - Intronic
900974989 1:6011351-6011373 CCTCCCGCACACCTGGCCCTGGG - Intronic
900975000 1:6011391-6011413 CCTCCCGCACACCTGGCCCTGGG - Intronic
900975020 1:6011470-6011492 CCTCCTGCACACCTGGCCCTGGG - Intronic
901146686 1:7069654-7069676 GAGCCTGGACAGCAGGCTCTGGG + Intronic
901259558 1:7861607-7861629 CAGCCTCCGCAGCAGGCCCCAGG + Intergenic
902422327 1:16290754-16290776 CAGTCTGCAAACCAGGAGCTGGG + Intronic
902440195 1:16424498-16424520 CAGCCTGGACCCCAGGCTCAGGG + Intronic
902706392 1:18208184-18208206 CAGCATGCCCACCAGGCCTCTGG - Intronic
902835370 1:19043712-19043734 GAGCCATCACACCTGGCCCTTGG - Intergenic
902850029 1:19148010-19148032 CAGCCTGCACACCAGCCGCTCGG - Exonic
903664858 1:25000015-25000037 TATTCTCCACACCAGGCCCTGGG - Intergenic
903735545 1:25528105-25528127 CTGCCTGCCCGCCAGGGCCTGGG - Intergenic
903891502 1:26573219-26573241 CATCTTGGACACCAGGTCCTGGG - Exonic
903918128 1:26779513-26779535 CACCCTGCCCACCAGCCCCTCGG + Exonic
904520596 1:31092400-31092422 GAGCCACCACACCAAGCCCTTGG + Intergenic
905455169 1:38083654-38083676 CAGCCTGCACAGCAGGGCGGGGG - Intergenic
906211746 1:44016103-44016125 CGGGCTCCACTCCAGGCCCTGGG + Intronic
906252371 1:44320469-44320491 CTGTTTGCACACCAGGACCTTGG - Intronic
906428139 1:45731649-45731671 GAGCCACCACACCTGGCCCTGGG - Intronic
906478280 1:46184442-46184464 CGCCCTTGACACCAGGCCCTGGG + Intronic
907097119 1:51791985-51792007 CAGCCTGCAAAGTAAGCCCTAGG + Intronic
907445762 1:54506804-54506826 CTTGCTGCACACTAGGCCCTGGG + Intergenic
907491537 1:54811879-54811901 CATCCTGCACATGAGGCCCTCGG - Exonic
909438187 1:75668604-75668626 GAGCCACCACACCCGGCCCTGGG + Intergenic
909787446 1:79633039-79633061 CAGGCTGGAAACCAGGACCTTGG - Intergenic
910602952 1:89050863-89050885 CAGCATGATCCCCAGGCCCTGGG - Intergenic
910637768 1:89428387-89428409 CAGCATGATCCCCAGGCCCTGGG + Intergenic
910948613 1:92620058-92620080 GAGCCAGCACGCCCGGCCCTTGG - Intronic
911863031 1:102979078-102979100 TAGCTGGCAAACCAGGCCCTCGG - Exonic
913129722 1:115828687-115828709 CAGCCTACACGCCAGGCCCAGGG - Intergenic
913248040 1:116887599-116887621 CAGCCTGTACAGAAAGCCCTGGG - Intergenic
914490783 1:148149006-148149028 CAGGCTCCACACCAGTCCCGAGG - Intronic
915083405 1:153367511-153367533 CAGCCTGTGCATCAGGCTCTTGG - Intergenic
917451388 1:175150592-175150614 CAGGCTGCAAGCCAGGCACTAGG + Intergenic
918466064 1:184822773-184822795 CAGGCGTGACACCAGGCCCTGGG + Intronic
918495551 1:185131854-185131876 GAGCCACCACACCTGGCCCTTGG - Intronic
919144054 1:193611109-193611131 CTGCCTGAACACCAATCCCTGGG + Intergenic
919466135 1:197922864-197922886 CAGGCACCATACCAGGCCCTGGG - Intronic
920055383 1:203187066-203187088 CAGCATTCACTCCAGGCCCCTGG + Intergenic
920500939 1:206485133-206485155 CAGCCTGCCCACCAGTGCCCAGG + Intronic
921389753 1:214606212-214606234 CAGGCTCCACACCAGTCCCGAGG + Intronic
922051553 1:221995438-221995460 CAGCCTCCACTCCTGTCCCTGGG - Intergenic
922119452 1:222649480-222649502 GAGCCACCACACCAGGCCTTGGG - Intronic
922161874 1:223084183-223084205 CATCGTGCACAGCAGGCGCTTGG + Intergenic
923200618 1:231707356-231707378 CTGCCTGCACACCAGGACTTTGG + Intronic
923680321 1:236113488-236113510 GACCTTACACACCAGGCCCTGGG + Intergenic
924730160 1:246703808-246703830 CTCCCTGCACTCCCGGCCCTGGG + Intergenic
1064418640 10:15171319-15171341 CAGCCTAGCCACCAGGCCCTGGG + Intergenic
1065917722 10:30366677-30366699 CAGCAGGGACACCAGTCCCTGGG - Intronic
1066363824 10:34756821-34756843 CAGCCTGTTCACCAGGAACTCGG - Intronic
1067277781 10:44850202-44850224 CAGACTTCAGACAAGGCCCTTGG - Intergenic
1067378861 10:45753964-45753986 CAGCCCGCACAGCAGGCACAAGG - Intronic
1067886564 10:50094626-50094648 CAGCCCGCACAGCAGGCACAAGG - Intronic
1068820978 10:61377133-61377155 CAGCCAGCACTGCCGGCCCTGGG - Intergenic
1069258754 10:66367037-66367059 CAGCCCACACACCCGGGCCTGGG + Intronic
1070904042 10:80056000-80056022 CTGGCTGCTCTCCAGGCCCTGGG + Intergenic
1071258141 10:83892981-83893003 AAGCCTGCTCCCCAGCCCCTAGG - Intergenic
1072793855 10:98339238-98339260 CAGGGTGCACACCAGACTCTTGG + Intergenic
1073185355 10:101612419-101612441 CATCCAGCACCCCAGCCCCTGGG + Exonic
1073318160 10:102597341-102597363 GAGACTGGAAACCAGGCCCTGGG - Intronic
1074051969 10:109888300-109888322 CATCCTGCACACCCAGCTCTGGG - Intronic
1074437173 10:113444051-113444073 AGGCCAGCAAACCAGGCCCTTGG - Intergenic
1074745959 10:116532841-116532863 CAGACTGAAAACAAGGCCCTGGG + Intergenic
1075256545 10:120930180-120930202 CAGCCTGGACATCAGCCCTTTGG + Intergenic
1076379565 10:130015778-130015800 CAGCCTGCCCGCCTGGCCCCAGG - Intergenic
1076694897 10:132242675-132242697 CAGCCTGCACATCAGCCCTTGGG + Intronic
1076744921 10:132508059-132508081 TGGCCTGCACAGCAGGCCTTGGG - Intergenic
1076866166 10:133167448-133167470 CAGGCTGCACTCCAGGCACACGG - Exonic
1077014417 11:393442-393464 GCTCCTGCACCCCAGGCCCTGGG - Intronic
1077119849 11:901870-901892 CAGCCGGCAGAGCAGGCCCATGG - Intronic
1077135413 11:995681-995703 CAGCCTGGATACCAGCCCCATGG - Intronic
1077216560 11:1397567-1397589 CAGCCTGCAGCCCAGGCCCCTGG - Intronic
1077216668 11:1397949-1397971 CAGCCTGCCCTCCAGGGCCCTGG - Intronic
1077315387 11:1917380-1917402 CAGCCTGCTCCCCACTCCCTGGG + Intergenic
1077327333 11:1969426-1969448 CAGCCTGCCCTCCCGGCCCTGGG + Intronic
1077432904 11:2524884-2524906 CTGCCTGCTCCCCAGGCCCACGG - Intronic
1078510313 11:11979906-11979928 CAGCCTGCCTTCCAGGCCCTGGG + Intronic
1080223506 11:29934261-29934283 CAGCCAGCACCGCCGGCCCTGGG + Intergenic
1080588038 11:33699083-33699105 CAGCCACCACACCCGGCCCCTGG + Intronic
1081277264 11:41165240-41165262 CAGACTCAACACCAGGTCCTGGG - Intronic
1081645967 11:44791058-44791080 CAGACTGGACACCAGGCCATGGG - Intronic
1081677589 11:44979961-44979983 CAGCCTGAGCACAGGGCCCTGGG + Intergenic
1083855425 11:65390780-65390802 CAGGCTGCCCAGCAGGCTCTGGG - Intronic
1083894230 11:65612125-65612147 CAGCCTGCACTCTGGGCTCTAGG + Intronic
1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG + Exonic
1084357599 11:68650357-68650379 CCTGCTGCACACCAGGCCCTGGG + Intergenic
1084407044 11:68980110-68980132 CAGGCTGCCCACCAGGTCCCTGG - Exonic
1085269881 11:75264046-75264068 CAGCCTGCCCAGCAAGCTCTAGG + Intergenic
1085273022 11:75281472-75281494 CTGTGTGCACACCCGGCCCTGGG + Intronic
1085328048 11:75623633-75623655 CAGCCTCCAAACCAGGCACCAGG - Intronic
1085525355 11:77160626-77160648 CACCCACCACACCAGGCCCTGGG + Intronic
1087221206 11:95548180-95548202 CAACCTGCAGACAAGGCCATGGG - Intergenic
1089216756 11:116838749-116838771 CAGCCTGCATCACAGGCTCTAGG - Intergenic
1089350777 11:117820486-117820508 CACACTCCACGCCAGGCCCTTGG + Intronic
1089460492 11:118650313-118650335 AGGCCAGCACACCAGGTCCTGGG - Intronic
1089731286 11:120520651-120520673 CAGCCAGCCAGCCAGGCCCTTGG - Intronic
1090626974 11:128616261-128616283 CAGCAGGCAGACCAGACCCTGGG - Intergenic
1091225453 11:133954330-133954352 CATCCTGCACACGTGTCCCTGGG + Intronic
1202810315 11_KI270721v1_random:24606-24628 CAGCCTGCCCTCCCGGCCCTGGG + Intergenic
1091795496 12:3295438-3295460 CCTCCTGCCCACCAGGGCCTGGG - Intergenic
1091829052 12:3536293-3536315 CAGGCTGCAGACCAGGGTCTGGG + Intronic
1093075025 12:14749102-14749124 CAGCCTCCATACCAGGACCAGGG + Intergenic
1094061638 12:26320403-26320425 CAGACTGCCTGCCAGGCCCTTGG - Intergenic
1094189425 12:27682426-27682448 CAGCTAGCACTCCAAGCCCTGGG + Exonic
1095951403 12:47783804-47783826 CTGCCCGCCCACCATGCCCTTGG - Exonic
1096984758 12:55748973-55748995 CCCCCTGCTCACCAGCCCCTCGG - Exonic
1097054786 12:56242929-56242951 CAGGGAGCACCCCAGGCCCTTGG - Exonic
1097155658 12:57010435-57010457 CAGCCTGCCCTCCAGGCTTTGGG + Intronic
1101353651 12:103956729-103956751 CAGCCTGCCGACCATGCCCGCGG - Exonic
1101775218 12:107787366-107787388 GAGCCACCACACCTGGCCCTTGG + Intergenic
1102511988 12:113422126-113422148 CAGCCTTTACCCCTGGCCCTGGG - Intronic
1102642547 12:114379705-114379727 CAGCCTGGACCCCAGCTCCTGGG + Intronic
1103175685 12:118861366-118861388 CAGCCTGCACAGATAGCCCTTGG + Intergenic
1103175874 12:118862621-118862643 CAGCCTCCATCCCACGCCCTTGG - Intergenic
1103716273 12:122947203-122947225 CGGCCTTCCCACCAGCCCCTGGG - Intronic
1103781077 12:123399175-123399197 CTGCTTGCACATCTGGCCCTGGG - Intronic
1104013804 12:124949488-124949510 CATCCTGCCCTCCTGGCCCTGGG - Intronic
1104898588 12:132176025-132176047 GAGCCTGCTCACCTCGCCCTTGG + Intergenic
1105240985 13:18609605-18609627 CAGCCTGCGCAGCGGGCACTCGG - Intergenic
1107526238 13:41234461-41234483 GAGCCACCACACCTGGCCCTGGG + Intronic
1107869291 13:44732393-44732415 CAGCCTGCACCCCTGGACCAGGG + Intergenic
1108858972 13:54829762-54829784 CAGCCTGCCCTGCTGGCCCTGGG - Intergenic
1111974579 13:94952108-94952130 CAGACTCTAAACCAGGCCCTGGG - Intergenic
1112627998 13:101127640-101127662 GAGCCTCCACACCTGGCCTTTGG + Intronic
1113096036 13:106664490-106664512 CAGCTTGATGACCAGGCCCTGGG + Intergenic
1113567807 13:111329210-111329232 CAGCCTGCACAGCACGCCCTCGG + Intronic
1113682930 13:112256912-112256934 CCGCACCCACACCAGGCCCTGGG + Intergenic
1114542634 14:23473281-23473303 GAGCCACCACACCAGGCCTTGGG + Intronic
1115407927 14:33039800-33039822 CAGACTGCACACAGGGGCCTGGG + Intronic
1115545443 14:34462003-34462025 CAGCCTCCACCCCAGGCCCGGGG + Intronic
1119330171 14:73787404-73787426 TAGCCTGCACCCCCCGCCCTGGG + Intronic
1119706004 14:76782979-76783001 CAGCCTACACAGCAGGAGCTGGG - Exonic
1121436663 14:93925124-93925146 AAGCCTCCCCACCAGGCCCGTGG - Exonic
1121679023 14:95777193-95777215 TGCCCTGCACACCAGGGCCTGGG - Intergenic
1122004243 14:98688812-98688834 GAGTCTGAACACCAGGGCCTTGG + Intergenic
1122246672 14:100408002-100408024 ATGCCTGCACACCAGGCACTGGG + Intronic
1122254838 14:100469080-100469102 CAGACTTCACACCAGTCCCTGGG + Intronic
1122364000 14:101183578-101183600 CAGCCTTCACACTAGGACCGCGG + Intergenic
1122798482 14:104218171-104218193 CAGCCTGAACTCCCAGCCCTGGG + Intergenic
1122904379 14:104795263-104795285 CAGCCTGCACCCCCGGCGCCCGG + Intronic
1123044652 14:105505382-105505404 CCGCCTGCCCACCTGGCCCCCGG - Intergenic
1123490372 15:20775540-20775562 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1123546873 15:21344627-21344649 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1124055853 15:26240488-26240510 CAGGCCCCACACCAGGCCCACGG - Intergenic
1124070743 15:26390960-26390982 CAGCCAGCAGTCCAGGGCCTGGG + Intergenic
1124375563 15:29126888-29126910 CTGGCTGCACTCCAGGCCCGGGG - Intronic
1125684824 15:41558228-41558250 CAACTTTCACACCAGGTCCTGGG + Intronic
1126112867 15:45185941-45185963 CAGGCTGCCCACCAAGCCATGGG - Intronic
1128801438 15:70499592-70499614 CCTCCTGCATGCCAGGCCCTGGG + Intergenic
1129518371 15:76170683-76170705 CATCCTGTATCCCAGGCCCTGGG - Intronic
1129890211 15:79066831-79066853 CATCCTGCAGACCAGGCACGGGG + Intronic
1130433171 15:83869547-83869569 CAGACTGCATAACAGGCCTTAGG - Intronic
1131148998 15:90035204-90035226 CAGCCCCCACACCATGCCCCAGG - Intronic
1131343122 15:91621464-91621486 CTGCCTGCCCACCAGGCTCAGGG - Intergenic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1131553764 15:93379481-93379503 CACCCTGCACCCCTGGCTCTAGG - Intergenic
1131786092 15:95912607-95912629 CAGCCTCCTCACCAGGCGCCTGG - Intergenic
1202955204 15_KI270727v1_random:71843-71865 CAGCCTGCGCAGCAGGCACTCGG + Intergenic
1132516445 16:368273-368295 GACCCTGAACACCAGGCTCTGGG + Intronic
1132745056 16:1433054-1433076 CGGCCTGCACACCTGCCCTTGGG - Intergenic
1132810548 16:1794702-1794724 GGGCCTGCCCACCAGTCCCTCGG + Intronic
1132835343 16:1950221-1950243 CCTCCTGCATACCAGGCTCTTGG + Intronic
1132939704 16:2500648-2500670 CAGCCTGGACAGCTGGTCCTGGG + Intronic
1133556804 16:6913536-6913558 CACCCTGAACACCAGGCACTGGG - Intronic
1134397919 16:13882304-13882326 GAGCCTCAACACCAGGCCCCAGG + Intergenic
1136240289 16:28939076-28939098 CCCCCTGCCCACCAGGCCCTAGG - Intronic
1136532080 16:30876514-30876536 CAGGCACCACACTAGGCCCTAGG + Intronic
1137411655 16:48233404-48233426 CAGCCAGGGCACCAGGCCATAGG + Intronic
1137711447 16:50569665-50569687 CCTACTGCACACCAGGCTCTGGG - Intronic
1138109442 16:54311972-54311994 CAGCCTGCACTCCTGGTCCCTGG - Intergenic
1138360871 16:56425815-56425837 CACCCTGGCCACCAGGCCGTCGG + Intergenic
1139311285 16:66030299-66030321 CAGCCTTCAGGCCAGGGCCTTGG + Intergenic
1139923375 16:70473081-70473103 CAGCATCCACAGCAGGTCCTGGG - Exonic
1139940802 16:70604167-70604189 AAGCCTGTAAGCCAGGCCCTGGG + Intronic
1140152899 16:72390050-72390072 CAGCCTGCTCTACATGCCCTAGG + Intergenic
1141512940 16:84524449-84524471 AAGCCTGCTCACCAGGGCCATGG - Intronic
1141604946 16:85147328-85147350 CAGCCTGCTCACCTGCCCCATGG + Intergenic
1141621524 16:85238894-85238916 CCACCTGCACACCCGGGCCTGGG + Intergenic
1141993897 16:87625137-87625159 GAGCCAGCACACCTGGCCCATGG + Intronic
1142284013 16:89164333-89164355 CAGCCTGGAATCCTGGCCCTGGG + Intergenic
1142584191 17:960552-960574 CAGGCTGGACACAAGTCCCTGGG + Intronic
1142601687 17:1056159-1056181 CAGCCTCCACCCCAGGCCGGCGG + Intronic
1142968436 17:3595422-3595444 CAGACTCCACAGCAGGGCCTGGG + Intronic
1143509419 17:7387258-7387280 CAGCCTCCACCCTGGGCCCTGGG + Intronic
1144661942 17:17076581-17076603 GAGGCTGCACATAAGGCCCTTGG + Intronic
1144732365 17:17536149-17536171 CCTGCTGCACACCAGGCGCTGGG + Intronic
1145191364 17:20843602-20843624 CAGGCTCCACACCAGTCCCGAGG - Intronic
1145254159 17:21313717-21313739 CTTCCTGCATGCCAGGCCCTGGG + Intronic
1145322441 17:21774245-21774267 CTTCCTGCATGCCAGGCCCTGGG - Intergenic
1145411590 17:22670548-22670570 CTGCCTGCACACCAGGTTGTGGG + Intergenic
1146652201 17:34613766-34613788 AAGCCTACACTCCAGGCCCTGGG + Intronic
1147248058 17:39135112-39135134 CAGCCTGCCCATGAGGCCTTCGG + Intronic
1147582298 17:41634264-41634286 CAGCCTGAGCCCCAGGCCCTGGG - Intergenic
1148547694 17:48530068-48530090 CCCCATGCACACCAGGTCCTGGG + Intronic
1149430880 17:56594783-56594805 CGGCTTGCACACCATGCCCTCGG - Exonic
1150333591 17:64313959-64313981 TAGGCTGGACCCCAGGCCCTGGG - Intergenic
1150545527 17:66153876-66153898 GAGCCACCACACCCGGCCCTTGG - Intronic
1151183681 17:72348528-72348550 CAGCCTGCAGAACCGGCCCACGG + Intergenic
1151248571 17:72815635-72815657 GAGCCACCACACCTGGCCCTAGG - Intronic
1151320625 17:73350229-73350251 CGGCCTGTACACCAGGTACTGGG - Exonic
1151576072 17:74953207-74953229 CAGCCTTTGCCCCAGGCCCTAGG + Intronic
1151818446 17:76483567-76483589 CAGCCACCACACCCGGCCCTAGG + Intronic
1152362005 17:79837177-79837199 CAGCGCCCACCCCAGGCCCTTGG + Intronic
1152459322 17:80432949-80432971 CATCCTGGACACCAGGCTCTGGG - Intronic
1152471688 17:80493091-80493113 CTGCCTGCAGACCCGTCCCTGGG + Intergenic
1152532077 17:80924601-80924623 CAGCCTCCTGGCCAGGCCCTGGG + Intronic
1152599049 17:81252350-81252372 CAGCCTGCAAAGGAGGACCTGGG - Exonic
1152747322 17:82047293-82047315 CAGCCAACAGCCCAGGCCCTTGG - Intergenic
1152814843 17:82401424-82401446 GAGCCACCACACCCGGCCCTGGG + Intronic
1152835224 17:82525500-82525522 TAGCCTCCAGACCAGGCCCTTGG - Intronic
1153925555 18:9832207-9832229 CAGCCAGCACCCCAGGCCGGTGG + Intronic
1153956425 18:10100212-10100234 CACCCTGCACAGCAGTCCTTCGG + Intergenic
1154447979 18:14450297-14450319 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1155983937 18:32209837-32209859 CAGCCAGGAAACCAGGGCCTTGG - Intronic
1155988897 18:32259020-32259042 CATCCTGCACGCTATGCCCTTGG - Intronic
1157293862 18:46427876-46427898 CACCCTGCCCACCAGCCCCAGGG - Intronic
1157523516 18:48361698-48361720 CAGGCTGCACACCAGCCCATGGG + Intronic
1160231719 18:77054051-77054073 CACCCTGCAGACCAGGCCGAGGG - Intronic
1160761501 19:787723-787745 CAGCCTCCACTCCAGCCCCAGGG + Intergenic
1160994836 19:1877820-1877842 CAGGCTCCACACCAGTCCCGAGG + Intronic
1161383087 19:3976845-3976867 CACCCTGCAGACCAGACACTCGG + Intronic
1162064541 19:8117126-8117148 CACCCTCCACACCAGGCAGTGGG + Intronic
1162104490 19:8362136-8362158 CAGCCTGCACGTCAGCCCTTGGG + Intronic
1162164529 19:8743334-8743356 CTGCCTGAGCTCCAGGCCCTAGG - Intergenic
1162165601 19:8750802-8750824 CTGCCTGAGCTCCAGGCCCTAGG - Intergenic
1162166666 19:8758258-8758280 CTGCCTGAGCTCCAGGCCCTAGG - Intergenic
1162167732 19:8765714-8765736 CTGCCTGAGCTCCAGGCCCTAGG - Intergenic
1162168671 19:8772012-8772034 CTGCCTGAGCTCCAGGCCCTAGG - Intergenic
1162170417 19:8784776-8784798 CTGCCTGAGCTCCAGGCCCTAGG - Intergenic
1162252665 19:9459498-9459520 CAGACTGAACACTAGGCCATGGG + Intergenic
1162524101 19:11197547-11197569 CAGCCTGGGCGCCCGGCCCTCGG + Exonic
1163385827 19:16999870-16999892 CAGCCTGACCACCATGGCCTGGG - Intronic
1165357682 19:35313743-35313765 CTGCCCCCACACCTGGCCCTGGG + Exonic
1165748545 19:38245757-38245779 GAGCCAGCACACCTGGCCCAGGG + Intronic
1167212040 19:48139495-48139517 CACCGAGCACTCCAGGCCCTTGG + Intronic
1167373913 19:49101301-49101323 CAGCCTGCACACCAGGCCCTGGG - Intronic
1168295748 19:55376758-55376780 CCGCCTGCCCGCCAGGCCCCAGG - Intergenic
1168426040 19:56239877-56239899 GAGCCACCACACCTGGCCCTAGG - Intronic
1168519545 19:57037498-57037520 CCACCTCCACACCAGGCCCTGGG + Intergenic
925007269 2:453442-453464 CAGCCTGCACCGAAGGCCCATGG - Intergenic
925153585 2:1634235-1634257 CAGACTGGACAGCAGGCCCCTGG + Exonic
925456734 2:4022537-4022559 CAGCCTGCAAACCTGGCAATGGG - Intergenic
926703972 2:15823268-15823290 CCTCCTGCACGCCAGGCCCTGGG - Intergenic
927490044 2:23515250-23515272 GACCCTGAACACCAGGTCCTAGG - Intronic
927613574 2:24566504-24566526 CAGCATGCACTTCAGCCCCTGGG - Intronic
928023545 2:27722052-27722074 ACTCCTGCACACCAGGGCCTTGG + Intergenic
928092488 2:28383738-28383760 CAGCCAGCACCAGAGGCCCTTGG + Intergenic
928936323 2:36682662-36682684 CAGGCTCTACACCAAGCCCTGGG + Intergenic
930593380 2:53356533-53356555 CAGCCAGCACCGCCGGCCCTGGG + Intergenic
931835678 2:66096301-66096323 AAGCCTACACACCAGGTCTTTGG + Intergenic
932761259 2:74440497-74440519 CCGCCTCCACGCCAGGCCCACGG + Intronic
933691277 2:85181332-85181354 CAGCCTTCAAAACAGCCCCTGGG + Intronic
933749102 2:85591706-85591728 CTGCCTGGACACCAAGCCCGAGG - Exonic
933773712 2:85759243-85759265 CAGCCTGTACACCATCCTCTCGG + Intronic
933897323 2:86823853-86823875 CAGCCTGTCCAGGAGGCCCTGGG - Intronic
935137574 2:100321494-100321516 CAGCCTGCGCAGCCGGCACTCGG + Exonic
935195202 2:100809617-100809639 CAGGCTTCTCTCCAGGCCCTTGG + Intergenic
935918658 2:107986342-107986364 CAGCCTGCCCCCCAGCTCCTTGG + Intergenic
936385569 2:112025405-112025427 CAGCCAACACACCAGGTCCTGGG - Intronic
937986271 2:127639542-127639564 TAGCCAGCAGGCCAGGCCCTAGG + Intronic
938032724 2:128009185-128009207 CAGCCACCACACCTGGCCCTGGG - Intronic
938292401 2:130157149-130157171 CACCCTGCCCTCCATGCCCTGGG + Intronic
938464153 2:131515827-131515849 CACCCTGCCCTCCATGCCCTGGG - Intergenic
941422340 2:165298210-165298232 AAGCCTTAATACCAGGCCCTGGG - Intronic
943942709 2:194020260-194020282 CAGCCTGCCCCGCTGGCCCTGGG + Intergenic
944315387 2:198279804-198279826 CAGCTTCCATACCAAGCCCTAGG - Intronic
944846386 2:203672461-203672483 CAGCCTAGCCACCAGGCCCTGGG + Intergenic
946398141 2:219453723-219453745 ATGCCTGCCCCCCAGGCCCTGGG - Intronic
947472055 2:230409712-230409734 CAGCCTGGAATCCAGGCTCTGGG + Intergenic
947715146 2:232335564-232335586 CAGCCCCCACCCCTGGCCCTTGG + Intronic
947734221 2:232446515-232446537 CAGCCCCCACCCCTGGCCCTTGG + Intergenic
948025557 2:234773280-234773302 CAGACTGCCCTCCAGGACCTTGG + Intergenic
948429856 2:237912361-237912383 GAGCCTGCACCCAAGGCCCCAGG - Intergenic
948747656 2:240107926-240107948 CCTCCTGCCCACCAGGCCCAGGG - Intergenic
1168762052 20:356038-356060 CAGCCACCCCTCCAGGCCCTAGG - Intronic
1169201074 20:3710502-3710524 CAGCCTCCACACCAGGTTCTTGG + Intergenic
1170530684 20:17288037-17288059 CAGCCTGCAGAGCCAGCCCTTGG - Intronic
1171412119 20:24954218-24954240 CACCCTGCACTCCAAGCTCTTGG + Intronic
1171420594 20:25014815-25014837 CCTGCTGCACACCAGGCCTTGGG + Intronic
1172221949 20:33280219-33280241 CAGGGTCCACACCCGGCCCTGGG + Intronic
1173686710 20:44928986-44929008 GAGCCACCACACCTGGCCCTGGG - Intronic
1173972155 20:47161350-47161372 CAGCCAGCGCACCAGGCTCAAGG - Intronic
1174384866 20:50181462-50181484 CAGCCAGAACCCCCGGCCCTGGG + Intergenic
1174483375 20:50846081-50846103 CAGCCTGTGCCCCAGGCCCTTGG + Intronic
1175399857 20:58693835-58693857 GAGCCGGCACAACAGCCCCTCGG + Exonic
1175607639 20:60323931-60323953 AAGCCACCACACCTGGCCCTGGG + Intergenic
1175777817 20:61664037-61664059 CAGCCCCCACACAATGCCCTTGG - Intronic
1175809259 20:61848932-61848954 CCTCCTGCACACCAGGTTCTAGG + Intronic
1175966795 20:62663996-62664018 GTCCCTGCACACGAGGCCCTGGG - Intronic
1176082564 20:63281371-63281393 CACCGTCCCCACCAGGCCCTCGG + Intronic
1176206171 20:63889420-63889442 CAGCCTCCCCACCAGGACATTGG + Intronic
1177275982 21:18913529-18913551 CAGTGTGCACCACAGGCCCTTGG - Intergenic
1178239576 21:30883202-30883224 CAACATGCAAGCCAGGCCCTAGG - Intergenic
1179255689 21:39713352-39713374 CAGCCAGCCCACCATGACCTGGG - Intergenic
1179435316 21:41358602-41358624 CAGCCTGCAAGCCCTGCCCTGGG + Intergenic
1179584582 21:42366442-42366464 CAGCATGGACACCAGGACCAGGG + Exonic
1179898767 21:44378070-44378092 CAGCCTCCCCAGCAGGTCCTGGG - Intronic
1179925596 21:44532424-44532446 CAGCCTGCACAGCACGTCCCTGG + Intronic
1180061442 21:45387182-45387204 CAGCCTGCAGAGACGGCCCTGGG + Intergenic
1180843309 22:18969277-18969299 CAGCCTCCACACCAGGCAGAGGG + Intergenic
1180979998 22:19873910-19873932 CTGGCTGCAGACCAGGCCCAGGG - Intergenic
1180985741 22:19903124-19903146 CAGCCCACACACTGGGCCCTGGG - Intronic
1181058162 22:20269458-20269480 CAGCCTCCACACCAGGCAGAGGG - Intronic
1181120894 22:20668353-20668375 CAGGCTCCACACCAGTCCCGAGG + Intergenic
1181333856 22:22115378-22115400 CAGGCTCCACACCAGTCCCGAGG + Intergenic
1181514703 22:23403912-23403934 CAGCCTCCACACCAGGCAGAGGG - Intergenic
1181610214 22:24006940-24006962 CAGCCTGCATGACAGGGCCTAGG + Intergenic
1181756948 22:25030860-25030882 CAGACTGCCCTCCCGGCCCTGGG + Intronic
1182960698 22:34471934-34471956 CTGCTTGCACACCTGCCCCTGGG - Intergenic
1183744696 22:39685811-39685833 CAGCCTGCAGACCACGCTCGAGG + Exonic
1184309750 22:43633652-43633674 CAGGCTACACACCAGGGACTTGG + Intronic
1184551084 22:45204443-45204465 CAGTCTGTGCACCAGGTCCTGGG - Intronic
1184554516 22:45225891-45225913 CTGACTGCAGACCAGGCGCTCGG - Intronic
1184792394 22:46708075-46708097 CAGCCTGCACACCTGGCCCTTGG + Intronic
1184986645 22:48140490-48140512 GTGCCTGCACACCAGACCCCGGG + Intergenic
1185041590 22:48507119-48507141 CCTACTGCACACCTGGCCCTTGG - Intronic
1185041608 22:48507198-48507220 CCAACTGCACACCTGGCCCTTGG - Intronic
1185099903 22:48833873-48833895 GAGCCTGCACTCCCTGCCCTGGG - Intronic
1185248235 22:49784862-49784884 CAGCATTAAGACCAGGCCCTCGG - Intronic
1185319931 22:50195996-50196018 CAGCCTCCCCACCAGAGCCTGGG + Intronic
950204866 3:11071484-11071506 CAGCCGGCACCACCGGCCCTAGG - Intergenic
950217304 3:11168734-11168756 CAGCCCGCACCCCCAGCCCTGGG - Intronic
950490503 3:13301806-13301828 CAGCCACCACCCCAGGCCTTCGG + Intergenic
950524981 3:13518276-13518298 CAGACTGCAGACCAAGCCTTTGG - Intergenic
952886503 3:38015742-38015764 TGGCCTACACACCAGGCCCAGGG + Intronic
952945216 3:38474393-38474415 CAGCCTGCAGCCCAAGCCCTAGG - Intronic
953019370 3:39104049-39104071 CAGCTTGCACCCCAGCCTCTGGG + Intronic
953930926 3:47005328-47005350 TAGTCTGCCCACCAGCCCCTGGG - Intronic
954411532 3:50373371-50373393 CTGCCTGCCCACCACGCCCGAGG - Intronic
954443189 3:50532932-50532954 CAGACCGCACACCTGGCCCCTGG - Intergenic
954797031 3:53166814-53166836 CACCCTGCCCACCTGGCCCCAGG + Intronic
954881848 3:53841748-53841770 CAACCTGCACCCATGGCCCTAGG + Intronic
960973596 3:123156022-123156044 AACCCTGCCCACCCGGCCCTGGG - Intronic
961547512 3:127645558-127645580 CACCCTGCCAACCAGGCCATGGG + Intronic
961809518 3:129513900-129513922 GAAACTGCCCACCAGGCCCTCGG + Intronic
962556399 3:136556791-136556813 CAGGCTGGACACCAATCCCTGGG + Intronic
962695766 3:137945690-137945712 GAGCCACCACACCAGGCCTTGGG + Intergenic
965367773 3:167820809-167820831 CAGCCTGGACCCCAGGCCTCAGG - Intronic
965380285 3:167980052-167980074 GAGCCAGCACACCCGGCCCATGG - Intergenic
965604628 3:170485941-170485963 TTCCCTGCACACCAGCCCCTGGG + Intronic
967098098 3:186193865-186193887 CAGCCTGCTAGCCAGGTCCTGGG - Intronic
968565608 4:1311028-1311050 CCGCCTGCTCCCCCGGCCCTGGG - Intronic
968881038 4:3300346-3300368 CAGGCTGGACTCCAGGCCCCTGG - Intronic
969246868 4:5940395-5940417 CAGGCTGCAGATCAGGGCCTGGG - Intronic
969300594 4:6294813-6294835 CAGCCTCCACTCCTGGCCCCCGG - Intronic
969401619 4:6959456-6959478 CAGCCTTCACACCAGCCCGGGGG - Intronic
969867562 4:10085593-10085615 GAGCCTGCACACAAGTCTCTTGG - Intronic
971135416 4:23863237-23863259 CAGCTTCCTCACCAGGCCCCTGG + Intronic
972425529 4:38929108-38929130 CAGCCTGCCCGCCAGCCGCTGGG - Intronic
972547203 4:40091722-40091744 CACCCTGCCCACCAGTACCTGGG + Intronic
976069737 4:81227703-81227725 CAGGCTACACACCAGCTCCTAGG + Intergenic
977816240 4:101416864-101416886 CAGCCTGGACCCCAGGCCTCAGG + Intronic
979482036 4:121230590-121230612 CAGCCTACACACGAGGCACGCGG - Intergenic
982262363 4:153505877-153505899 CAGCCTCCTCACCACACCCTGGG - Intronic
982315189 4:154024523-154024545 CAGGCTGAACTCCAAGCCCTGGG + Intergenic
982398260 4:154937055-154937077 CAGCCTTCAGACCAGCCCCTGGG - Intergenic
983929232 4:173434943-173434965 CAGCCTGAACCCCTGGGCCTGGG - Intergenic
984354974 4:178646628-178646650 CAGACTGAACACCAGGTCGTGGG + Intergenic
985644145 5:1077206-1077228 CTTCCTGGACACCATGCCCTAGG + Intronic
987316364 5:16728359-16728381 CAGCTTGCACACCAACTCCTTGG + Intronic
987750990 5:22038443-22038465 CATCCTGCACATCAGGGCCCAGG + Intronic
990266529 5:54082627-54082649 AAGCCCTCACACCAGCCCCTTGG + Intronic
990629526 5:57652559-57652581 CAGCTTTCACATCAGGCCCATGG - Intergenic
992048852 5:72925591-72925613 CAGCCAGCACTGCTGGCCCTGGG + Intergenic
993618031 5:90136897-90136919 CAGCCTGGACTCCAGGCCTCAGG + Intergenic
997323827 5:133003058-133003080 CAGCCTAGCCACCAGGCCCTGGG - Intronic
997352928 5:133243961-133243983 CAGCCTGCACAGCGGCCACTCGG - Intronic
997362110 5:133301717-133301739 CAGCCTGCAAGCTATGCCCTTGG - Intronic
1000204782 5:159048438-159048460 CAGCCTGCACACCAGCACCCTGG + Intronic
1001380632 5:171304311-171304333 CAGCCTCCCCGCCAGGTCCTGGG + Intergenic
1001752608 5:174142997-174143019 CTGCCTGCACTCCAGGGACTTGG - Intronic
1002390706 5:178909559-178909581 CAGACTCAACACCAGGCCGTGGG - Intronic
1002441324 5:179265873-179265895 GAGCCTGCAGCCCAGGCCCCGGG - Intronic
1002448008 5:179301949-179301971 CAGCCTGCACACCTCGCCCCTGG + Intronic
1002634916 5:180602536-180602558 CAGCCCGCACACCTGCGCCTGGG - Exonic
1003351970 6:5326473-5326495 GAGCAGGCACACCAAGCCCTGGG - Intronic
1006935274 6:37712907-37712929 CAGGCAGCACTCCTGGCCCTGGG - Intergenic
1007495551 6:42258148-42258170 CAGTCTGCTCTCCAGGCCCTGGG + Exonic
1007653301 6:43436527-43436549 CAGCATTCAGAACAGGCCCTGGG + Intronic
1007728172 6:43929419-43929441 CAGACTTCACCCCAAGCCCTAGG - Intergenic
1008078589 6:47171199-47171221 CACCCTGCACAGGAGGTCCTTGG - Intergenic
1010465995 6:76166934-76166956 CAGGCTGCACACCACAGCCTTGG - Intergenic
1010707139 6:79128131-79128153 CAGCCTGCAGTCCAGGAGCTGGG + Intergenic
1014521768 6:122452703-122452725 ATGCCTGCATTCCAGGCCCTGGG + Intronic
1015257611 6:131197764-131197786 CAGACTCAACACCAGGCCGTGGG + Intronic
1017100668 6:150847187-150847209 GAGCCACCACACCCGGCCCTCGG + Intergenic
1017338544 6:153291185-153291207 CGCCCTGCTCAGCAGGCCCTGGG + Intergenic
1018160890 6:161041326-161041348 TAGCCTGCACTCCAGCCCCCAGG - Intronic
1018685736 6:166302929-166302951 CAGCCTTTACAGCAGGCACTAGG + Intergenic
1018810571 6:167295193-167295215 TGGCCTGCACCCCAGGCCCCGGG + Intronic
1019200987 6:170315029-170315051 CTGACTGCAAGCCAGGCCCTAGG - Intronic
1019497528 7:1347460-1347482 GAGCCACCACACCCGGCCCTTGG + Intergenic
1019574967 7:1733249-1733271 CAGCCGGGACACCAGTCCCCGGG + Intronic
1020004803 7:4776766-4776788 CAGCCAGCACTACAGCCCCTTGG + Intronic
1020005984 7:4783999-4784021 CACCCTGCTCCGCAGGCCCTGGG - Intronic
1020097528 7:5377115-5377137 CAGCCAGCACCCCTGTCCCTTGG - Intronic
1023340494 7:39214253-39214275 CAGCCTGTGCAAAAGGCCCTGGG - Intronic
1026018976 7:66693670-66693692 CAGGCTGCACTCCCAGCCCTGGG - Intronic
1026439694 7:70433261-70433283 CTCCCTGCACACCAGATCCTTGG + Intronic
1026881418 7:73909006-73909028 CAGGCTGCACTCCCAGCCCTGGG + Intergenic
1027051848 7:75025631-75025653 CTGCCTGCCCACCCGCCCCTTGG + Intergenic
1029321326 7:99763129-99763151 CAGCCTGCACAGCACACCCAGGG + Intronic
1031081834 7:117265439-117265461 GAGCCACCACACCTGGCCCTGGG + Intergenic
1032128744 7:129212450-129212472 GAGCCTGCAGAGCAGGACCTGGG + Exonic
1034273015 7:149812355-149812377 CAGCCCCCACCCCAGGGCCTGGG + Intergenic
1034345779 7:150384359-150384381 CAGCCTGCTCACCTGGCTCCTGG + Intronic
1034669309 7:152846108-152846130 CAGACTGCAGCCCAGGCGCTGGG - Intronic
1034959945 7:155358868-155358890 CAGCCTGCACGCCCGCCCCACGG + Intronic
1035047018 7:155974294-155974316 CAGCCTGCAGACCCAGCCCTGGG - Intergenic
1035316095 7:157998179-157998201 CAGGCTGCAGCCCGGGCCCTGGG - Intronic
1035617297 8:1011811-1011833 CAGTCTGCACAGTGGGCCCTGGG + Intergenic
1035971537 8:4254799-4254821 CAGGCTGCACCCCAGAGCCTAGG + Intronic
1035999992 8:4591868-4591890 CAGCCTCCCCACCGGTCCCTTGG - Intronic
1037494261 8:19423879-19423901 CAGGCTGCACAGAAAGCCCTGGG + Intronic
1038417402 8:27407262-27407284 GAGCCTGCTATCCAGGCCCTGGG + Intronic
1038460389 8:27711204-27711226 GAGCCACCACACCAGGCCCTGGG + Intergenic
1039553082 8:38457314-38457336 CAGCCTGGACTCCTGGGCCTTGG - Intronic
1040397592 8:47014261-47014283 GAGCCGCCACACCTGGCCCTTGG - Intergenic
1040596820 8:48846741-48846763 CAGCCTCTGCTCCAGGCCCTGGG - Intergenic
1040794164 8:51271339-51271361 CAGCCTGCGCCGCCGGCCCTGGG + Intergenic
1041081880 8:54222045-54222067 CACTCTGCCCACCAGGCCATGGG + Intergenic
1042455617 8:68999152-68999174 GAGCCACCACACCTGGCCCTGGG - Intergenic
1044452338 8:92352184-92352206 CAGCCTAGCCACCAGGCCCTGGG + Intergenic
1048645482 8:136414741-136414763 CAGCCCGCATCCCAGGCACTGGG - Intergenic
1049206968 8:141368095-141368117 CAGCCTGCACACCTGGCATCTGG + Intergenic
1049254263 8:141605417-141605439 CAGCCTGCTCCCCAGCCCCGAGG - Intergenic
1049455257 8:142683333-142683355 CAGGCTGCACCCCTAGCCCTAGG - Intergenic
1050462195 9:5886344-5886366 CAGCCCCCACACCAGCCCCAGGG - Intronic
1052970423 9:34373911-34373933 CTCCCTCCAAACCAGGCCCTGGG - Intronic
1053167159 9:35853078-35853100 CAGACAGCACTCCAGGGCCTGGG - Intronic
1056523732 9:87423574-87423596 CAGCCTGGCCATCAGGCCCCTGG - Intergenic
1056623743 9:88236977-88236999 CTGCCAGCCCACTAGGCCCTCGG + Intergenic
1057167538 9:92940703-92940725 CAGCATGCACGCCAGACTCTTGG + Intergenic
1058154665 9:101501923-101501945 CAGCGTCGCCACCAGGCCCTGGG + Intronic
1058382287 9:104390459-104390481 CAGCCTGCATTCCAGCCCCAGGG + Intergenic
1059262753 9:112994113-112994135 GAGCCCACACACCAGGGCCTTGG - Intergenic
1060641366 9:125241665-125241687 CCGCCTTCACTCCCGGCCCTAGG + Intergenic
1060916246 9:127392767-127392789 CAGCCTGATCCTCAGGCCCTGGG + Intronic
1061044017 9:128154587-128154609 CACCCAGCACGCCTGGCCCTTGG + Intergenic
1061086583 9:128402871-128402893 GAGCCACCACACCCGGCCCTAGG + Intergenic
1061816967 9:133203315-133203337 CAGCCTGGACACTTGGCCCCTGG + Intergenic
1062211027 9:135364182-135364204 CAGACTGCACACCCAGCCCTGGG + Intergenic
1062581058 9:137229447-137229469 CAGCCTGCAGCCCAGGCCCCCGG - Exonic
1186668664 X:11746135-11746157 CAGTCTGCAGCCCAGGGCCTGGG + Intergenic
1187427524 X:19191800-19191822 GAGCCACCACACCTGGCCCTGGG + Intergenic
1187701426 X:21967718-21967740 GAGTCTGCACACCACTCCCTGGG - Intronic
1187993167 X:24897432-24897454 CGAACTGCACACCTGGCCCTTGG - Intronic
1189373071 X:40445408-40445430 CAGCCTCCCCACCATGCCCTAGG + Intergenic
1190070039 X:47272165-47272187 CTTGCTGCATACCAGGCCCTGGG + Intergenic
1191090142 X:56611570-56611592 GAGCCACCACACCAGGCCCATGG - Intergenic
1192214488 X:69149240-69149262 CAGCCTGCAGAGGAGGGCCTGGG - Intergenic
1194165422 X:90508513-90508535 CAGCAGGCCTACCAGGCCCTGGG - Intergenic
1195146885 X:102026988-102027010 CAGCTTGATCACCAGGCCCCTGG - Intergenic
1195178909 X:102338377-102338399 CAGCCTCCACAACTGGCACTTGG + Intergenic
1195247245 X:103005657-103005679 GAGCCAACACACCTGGCCCTGGG + Intergenic
1195380751 X:104268669-104268691 AAGCCACCACACCTGGCCCTTGG + Intergenic
1196179867 X:112678158-112678180 GAACCTCCACATCAGGCCCTGGG + Intronic
1197981219 X:132219113-132219135 CAGCCTAGACTCCTGGCCCTGGG - Intronic
1199719378 X:150531422-150531444 CTGTGTGCACACCAGGCACTGGG + Intergenic
1200112242 X:153746850-153746872 CTGCCTACACACCATCCCCTCGG - Intergenic
1200511690 Y:4086323-4086345 CAGCAGGCCTACCAGGCCCTGGG - Intergenic
1201278652 Y:12321751-12321773 CAGGCTGAACCCCAGGCCCTGGG + Intergenic