ID: 1167374839

View in Genome Browser
Species Human (GRCh38)
Location 19:49105076-49105098
Sequence CTTGGCAGTGACGCATGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167374831_1167374839 12 Left 1167374831 19:49105041-49105063 CCGAGTTCACTGAGCTCAGTGTA 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1167374839 19:49105076-49105098 CTTGGCAGTGACGCATGCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 91
1167374830_1167374839 13 Left 1167374830 19:49105040-49105062 CCCGAGTTCACTGAGCTCAGTGT 0: 1
1: 0
2: 0
3: 17
4: 208
Right 1167374839 19:49105076-49105098 CTTGGCAGTGACGCATGCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 91
1167374829_1167374839 14 Left 1167374829 19:49105039-49105061 CCCCGAGTTCACTGAGCTCAGTG 0: 1
1: 0
2: 0
3: 16
4: 123
Right 1167374839 19:49105076-49105098 CTTGGCAGTGACGCATGCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167374839 Original CRISPR CTTGGCAGTGACGCATGCTG GGG Intronic
905790559 1:40787041-40787063 CTTCCCAGAGACGCAGGCTGTGG + Intronic
908246158 1:62229014-62229036 CTTGCCAGTGACCCAGGCTGGGG - Intergenic
908267710 1:62395334-62395356 CTTGCCAGTGATCCAGGCTGAGG + Intergenic
917299212 1:173555396-173555418 CTTTTCAGTGAAGGATGCTGTGG - Intronic
919812903 1:201420204-201420226 TTTGTCAGTGAGGCAGGCTGGGG - Intronic
921067324 1:211632205-211632227 CTTGGCAGACATGCCTGCTGTGG + Intergenic
922774213 1:228207502-228207524 CTTAGCAGTGATGCGGGCTGGGG - Intronic
1069644332 10:69981596-69981618 CTTGGATGTGAGGCTTGCTGGGG + Intergenic
1069799539 10:71073593-71073615 CTGGTCTGTGATGCATGCTGGGG + Intergenic
1071503500 10:86219488-86219510 CTTGGCTGCAAGGCATGCTGGGG - Intronic
1073490486 10:103850004-103850026 CTGGTCAGTGACTCAGGCTGAGG + Intronic
1081778240 11:45691728-45691750 CTTGGTAGGGAAGCAAGCTGAGG - Intergenic
1083706487 11:64519930-64519952 CGTGGCAGAGAGGGATGCTGTGG - Intergenic
1085972063 11:81605214-81605236 GGTGGCAGTGAAGCATGCAGTGG - Intergenic
1093078909 12:14787296-14787318 CTTGGCACTGATGGTTGCTGTGG + Exonic
1108945770 13:56020626-56020648 CGTGACTGTGACCCATGCTGAGG + Intergenic
1118436878 14:65779647-65779669 CTTGCCAATGATGCCTGCTGGGG - Intergenic
1118547560 14:66908909-66908931 CTTGGCAGTGATAGATGCTCAGG - Intronic
1122943156 14:104992259-104992281 CGTGGCAGTGGCGCATGTGGTGG - Intronic
1123744655 15:23310276-23310298 CTGTGCAGAGAGGCATGCTGAGG + Intergenic
1127809968 15:62557190-62557212 AGTGGCAGTGACCCAGGCTGGGG + Intronic
1128814619 15:70598670-70598692 CTGGGCAGTGTCGCACCCTGGGG - Intergenic
1132767043 16:1539668-1539690 CGTGGCAGTGACGCTCACTGGGG + Intronic
1132912182 16:2319799-2319821 CCTGGCCGTGCAGCATGCTGTGG - Exonic
1142227169 16:88883176-88883198 CTTGGCACTGAGGCATCCTCAGG - Intronic
1142666078 17:1464585-1464607 AGTGGCAGTGAGGCACGCTGAGG + Exonic
1142992156 17:3738729-3738751 CAGTGCAGTGCCGCATGCTGGGG + Intronic
1144632247 17:16880222-16880244 CTTGGCAGTGGTGCCTGCTGTGG + Intergenic
1144808632 17:17984451-17984473 CTTGGCAGTGAGACCTGATGTGG - Intronic
1145208763 17:20997977-20997999 CTTGGCAGTGGTGCCTGCTGTGG - Intergenic
1146059304 17:29596180-29596202 CTTGGCAGTGCAGCTGGCTGAGG + Intronic
1147009207 17:37430454-37430476 TTTGGGAGTTACTCATGCTGTGG + Intronic
1147143987 17:38474801-38474823 GTTGGCAGTGACCCATGGGGTGG + Intronic
1147214317 17:38890529-38890551 CCTGGCAGGGAGGGATGCTGGGG + Intronic
1147965388 17:44191966-44191988 CCTGGCATTACCGCATGCTGGGG - Exonic
1148151113 17:45396849-45396871 CTGGGGAGTGACGGTTGCTGGGG - Intronic
1148167282 17:45492116-45492138 GTTGGCAGGGACCCATGCTCTGG + Intergenic
1150398462 17:64838530-64838552 GTTGGCAGGGACCCATGCTCTGG + Intergenic
1150579759 17:66461744-66461766 CTTGGCATAGAGGCATTCTGTGG + Intronic
1152538114 17:80961994-80962016 CTTGGGATGGACGCCTGCTGGGG + Intronic
1156012811 18:32513537-32513559 TTTGGCAGTGACGGTTGCTGTGG - Intergenic
1156939246 18:42744879-42744901 GGTGGCAGTTACCCATGCTGTGG + Intronic
1165129542 19:33623074-33623096 TTTGGCAGTGCCCGATGCTGGGG + Intronic
1165774199 19:38395355-38395377 CTTGGGAGAGAAGCAAGCTGGGG + Intronic
1167374839 19:49105076-49105098 CTTGGCAGTGACGCATGCTGGGG + Intronic
1167424599 19:49423504-49423526 CCGGGCAGTGACGCAGGCCGGGG + Intergenic
1168177728 19:54636517-54636539 CCAGGCAGTGACGTATGCCGAGG + Exonic
932891502 2:75600905-75600927 CTTGGCAGACACACATGCTCTGG + Intergenic
935201715 2:100862501-100862523 CTTGGCAGTGCAGAAGGCTGTGG + Intronic
935991061 2:108719537-108719559 CTTGGAAGTGGCGACTGCTGCGG + Exonic
936126656 2:109794396-109794418 CTTGGAAGTGGCGACTGCTGCGG + Exonic
936218037 2:110577072-110577094 CTTGGAAGTGGCGACTGCTGCGG - Exonic
936427479 2:112433501-112433523 CTTGGAAGTGGCGACTGCTGCGG - Exonic
936466189 2:112753347-112753369 CTTGGCAGTGACACAGCCTGGGG - Intronic
937936500 2:127249531-127249553 CTTGGCACTGATGGTTGCTGTGG - Intergenic
942503924 2:176621553-176621575 CTTGGCTGTGAGGCACTCTGAGG + Intergenic
945062273 2:205919689-205919711 CTTGGATGTGAGGCTTGCTGGGG + Intergenic
945443282 2:209905903-209905925 CTTGGCTGTGACGCCTGTTCAGG - Intronic
948577492 2:238964184-238964206 CTTGGGTGTGAGGCCTGCTGTGG - Intergenic
948970954 2:241426479-241426501 ATTGGCAGTGACAGATGTTGAGG + Intronic
1170326353 20:15158125-15158147 CTTGGCAGTGACACATAATAGGG + Intronic
1175763596 20:61577998-61578020 CTTGGCAGTCCTGCATGGTGGGG - Intronic
1176743094 21:10624582-10624604 CTTGGAAGTAAACCATGCTGTGG + Intergenic
1178943534 21:36927209-36927231 CTTGGCTGAGATGCAGGCTGTGG - Intronic
1182251514 22:29004698-29004720 CTTGGCAGGGCCTCATCCTGAGG + Intronic
1183585637 22:38751443-38751465 CTAGGCAGGGCCGCAGGCTGTGG - Intronic
956338613 3:68194219-68194241 CTTGGTAGTGACTCCTCCTGTGG - Intronic
958943045 3:100335529-100335551 CTGGGCAGTTCCTCATGCTGAGG - Intronic
965077153 3:163993642-163993664 GTTGGCAGTGGCGCCTGGTGGGG + Intergenic
969326577 4:6447706-6447728 CTTGGCAGGGACACAGCCTGGGG + Intronic
971041405 4:22756496-22756518 CTTGGCAGTGGAGAATGTTGAGG - Intergenic
976656664 4:87496072-87496094 CTGGGCAGTGATGCATGATGGGG + Intronic
978641685 4:110878367-110878389 CTTGGCAATGAGACATGCTGTGG - Intergenic
983917348 4:173307105-173307127 AGTGGCAGTGAGGCATGTTGGGG + Intronic
991589909 5:68239772-68239794 CTTGCCAGTGACGTGTGATGCGG + Intronic
997718972 5:136062955-136062977 CTTGGCAGGAACCCATGGTGAGG + Intronic
1001312269 5:170619588-170619610 TTTGGCACTGATGGATGCTGTGG - Intronic
1002372683 5:178767688-178767710 CTTGGATGTGACACATGCAGCGG - Intergenic
1006293655 6:33160004-33160026 CTTGGCTGTCTTGCATGCTGAGG - Intergenic
1006454298 6:34123150-34123172 CTTGCCAGTGAAGCAACCTGTGG - Intronic
1007702741 6:43774052-43774074 CTCGACAGTGAAGCATTCTGGGG + Intronic
1013086921 6:106864616-106864638 CTTGGCAGTGGCCGCTGCTGCGG + Intergenic
1021016047 7:15535540-15535562 CCAGGTAGTGAGGCATGCTGTGG - Intronic
1022787418 7:33652301-33652323 CTTGGCACTGAGGAATGCTCTGG + Intergenic
1025251219 7:57352801-57352823 CTTGGGAGTGCCTCAGGCTGAGG + Intergenic
1029177753 7:98676914-98676936 CCTGGCACTGACCCATGATGTGG - Intergenic
1032008513 7:128324631-128324653 CTTGGCGGTGACCCGTGATGAGG - Exonic
1033017142 7:137682861-137682883 CTATTCAGTGACCCATGCTGAGG - Intronic
1035323736 7:158051410-158051432 CTTGGGAGGGACCCAGGCTGGGG - Intronic
1039896899 8:41723377-41723399 CTGGGCAGTGCCGCGTGCAGTGG - Intronic
1040533268 8:48283177-48283199 TTTGGCAGTGTTGCCTGCTGTGG + Intergenic
1047367568 8:124226065-124226087 CTTGGCAGAGCCTGATGCTGTGG - Intergenic
1047408058 8:124601679-124601701 AGTGGCAGTGATGCACGCTGAGG - Intronic
1049018798 8:139939914-139939936 CTGTGCAGAGCCGCATGCTGTGG - Intronic
1059913987 9:119078030-119078052 CATGGCAGTGATGAGTGCTGTGG - Intergenic
1060877634 9:127094696-127094718 CTTGGCACTCACGCATTCTGAGG + Intronic
1192503600 X:71668171-71668193 TTTGGCAGTGGCGCCTTCTGGGG - Intergenic
1194125221 X:90008320-90008342 CTGAGCAGTGGCTCATGCTGAGG + Intergenic
1196319688 X:114271574-114271596 CTTGGCAGTAACACATGATTTGG + Intergenic
1199523859 X:148769513-148769535 CTTCCCAGTGACACATTCTGAGG - Intronic