ID: 1167376089

View in Genome Browser
Species Human (GRCh38)
Location 19:49112898-49112920
Sequence CCACCTTGCCTGGCCGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167376089_1167376100 21 Left 1167376089 19:49112898-49112920 CCAGTATCGGCCAGGCAAGGTGG No data
Right 1167376100 19:49112942-49112964 CTTTGGGAGGCTGAGGCAGGTGG 0: 25296
1: 77323
2: 157079
3: 168016
4: 148902
1167376089_1167376093 5 Left 1167376089 19:49112898-49112920 CCAGTATCGGCCAGGCAAGGTGG No data
Right 1167376093 19:49112926-49112948 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1167376089_1167376099 18 Left 1167376089 19:49112898-49112920 CCAGTATCGGCCAGGCAAGGTGG No data
Right 1167376099 19:49112939-49112961 GCACTTTGGGAGGCTGAGGCAGG 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
1167376089_1167376092 4 Left 1167376089 19:49112898-49112920 CCAGTATCGGCCAGGCAAGGTGG No data
Right 1167376092 19:49112925-49112947 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
1167376089_1167376097 14 Left 1167376089 19:49112898-49112920 CCAGTATCGGCCAGGCAAGGTGG No data
Right 1167376097 19:49112935-49112957 CCCAGCACTTTGGGAGGCTGAGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
1167376089_1167376095 8 Left 1167376089 19:49112898-49112920 CCAGTATCGGCCAGGCAAGGTGG No data
Right 1167376095 19:49112929-49112951 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167376089 Original CRISPR CCACCTTGCCTGGCCGATAC TGG (reversed) Intergenic
No off target data available for this crispr