ID: 1167377259

View in Genome Browser
Species Human (GRCh38)
Location 19:49118862-49118884
Sequence TGCGTGGGAGTCGCGGGTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 221}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167377248_1167377259 8 Left 1167377248 19:49118831-49118853 CCGGGGGAACCCTGCAGGCCGCA 0: 1
1: 0
2: 0
3: 21
4: 172
Right 1167377259 19:49118862-49118884 TGCGTGGGAGTCGCGGGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 221
1167377253_1167377259 -10 Left 1167377253 19:49118849-49118871 CCGCACTACTGTCTGCGTGGGAG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1167377259 19:49118862-49118884 TGCGTGGGAGTCGCGGGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 221
1167377249_1167377259 -1 Left 1167377249 19:49118840-49118862 CCCTGCAGGCCGCACTACTGTCT 0: 1
1: 0
2: 1
3: 6
4: 89
Right 1167377259 19:49118862-49118884 TGCGTGGGAGTCGCGGGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 221
1167377243_1167377259 24 Left 1167377243 19:49118815-49118837 CCATTAGCCTCGTCCGCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1167377259 19:49118862-49118884 TGCGTGGGAGTCGCGGGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 221
1167377250_1167377259 -2 Left 1167377250 19:49118841-49118863 CCTGCAGGCCGCACTACTGTCTG 0: 1
1: 0
2: 2
3: 5
4: 103
Right 1167377259 19:49118862-49118884 TGCGTGGGAGTCGCGGGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 221
1167377245_1167377259 17 Left 1167377245 19:49118822-49118844 CCTCGTCCGCCGGGGGAACCCTG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1167377259 19:49118862-49118884 TGCGTGGGAGTCGCGGGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 221
1167377247_1167377259 11 Left 1167377247 19:49118828-49118850 CCGCCGGGGGAACCCTGCAGGCC 0: 1
1: 0
2: 0
3: 15
4: 207
Right 1167377259 19:49118862-49118884 TGCGTGGGAGTCGCGGGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167377259 Original CRISPR TGCGTGGGAGTCGCGGGTGG GGG Exonic
900215639 1:1480184-1480206 TGTGTGGGGGTGGGGGGTGGGGG - Intronic
900569906 1:3353120-3353142 TGCGTGGGAGTCTGGGCTGGGGG - Intronic
900663329 1:3797005-3797027 TGCATGTGAGACGCGGGTAGAGG + Intergenic
901216698 1:7559206-7559228 TGCGTGGGAGGCTCTGGGGGTGG - Intronic
901453517 1:9350609-9350631 TGCGTGTGTGTGGTGGGTGGCGG + Intronic
901852246 1:12022948-12022970 TGCCTGGGAGTGGGAGGTGGAGG + Intronic
901923097 1:12549684-12549706 AGCCTGGGAGACGCGGCTGGGGG + Intergenic
902054743 1:13590861-13590883 TGCGGTGGAGGGGCGGGTGGGGG + Intronic
902513908 1:16980007-16980029 CGCAGGGGAGTCGGGGGTGGGGG - Intronic
903142067 1:21344989-21345011 TGGGTCGGGCTCGCGGGTGGCGG - Intronic
904942962 1:34177669-34177691 TGTGTGGGAGGGGTGGGTGGAGG - Exonic
908195483 1:61742698-61742720 TGGGTGGGAGCCGGAGGTGGAGG + Intronic
913375635 1:118148800-118148822 TGCATGGTAGTTGCGAGTGGTGG - Intronic
915510737 1:156385723-156385745 TGGGTGGGGGTCGCGGCGGGGGG - Intergenic
915539977 1:156559524-156559546 TGTGTGGGGGTGGCGGGAGGTGG - Intronic
916051374 1:161039002-161039024 TGCGGGGGCGGCGCGGGAGGCGG - Intergenic
922433605 1:225581430-225581452 GGAGTGGGAGTGGAGGGTGGAGG + Intronic
922499104 1:226083691-226083713 GGCGGGGGAGTCCCGGGTCGTGG - Intergenic
922741286 1:228015692-228015714 TGGGGGGGAGGCGGGGGTGGTGG - Intronic
923108618 1:230873090-230873112 TGGGTGGGAGGCGGGGGCGGTGG - Intergenic
923169905 1:231405972-231405994 TGGGTGGGGGTGGGGGGTGGGGG - Intronic
923188336 1:231595905-231595927 GGACTGGGAGTCGGGGGTGGGGG + Intronic
1063386855 10:5621191-5621213 CGCGTGGGAGCCGGGGGTGCAGG + Intergenic
1063460548 10:6212559-6212581 GGCGTGAGAGGCTCGGGTGGAGG + Intronic
1064579962 10:16784189-16784211 TGCTTGGGAGTCTGAGGTGGGGG - Intronic
1064784658 10:18880617-18880639 GGCATGGGAATCGCGGGAGGCGG + Intergenic
1066079500 10:31916336-31916358 GGCGTGTGTGTCGGGGGTGGTGG - Intronic
1067572420 10:47381231-47381253 TGCTTGGGGGGAGCGGGTGGGGG - Intronic
1070708375 10:78657952-78657974 TGGGTGGGGGTGGGGGGTGGGGG + Intergenic
1071957741 10:90777909-90777931 TGTGTGGGATTTGGGGGTGGTGG - Intronic
1074162917 10:110848829-110848851 TGGGTGGGTGTGGGGGGTGGAGG - Intergenic
1075621321 10:123930057-123930079 TGCGTGGAAGACAGGGGTGGAGG - Intronic
1076782183 10:132730398-132730420 TGCGTGGGCAGCGCGGGAGGGGG + Intronic
1077355039 11:2112187-2112209 TGGTTGGGAGTGGGGGGTGGGGG + Intergenic
1077870683 11:6259551-6259573 TTCCTGGGAATCGGGGGTGGGGG + Intergenic
1079532375 11:21469780-21469802 TGCTATGGAGTCGAGGGTGGTGG + Intronic
1083609423 11:63998046-63998068 TGGTTGGGAGTCCTGGGTGGAGG + Exonic
1084360682 11:68667021-68667043 TGCGGGGGAGACGAGGGTGAGGG + Intergenic
1084360706 11:68667090-68667112 TGCGGGGGAGACGAGGGTGCGGG + Intergenic
1084373896 11:68763310-68763332 TGTGTTGGACTCGGGGGTGGGGG - Intronic
1084517158 11:69643271-69643293 TGCGTGCGGCTCGCGGGGGGCGG - Intronic
1084518749 11:69650310-69650332 TGCGTGGGACTTGCCCGTGGTGG + Intronic
1085395129 11:76203359-76203381 TCCGTGGGAGTGGCAGGTGTGGG + Intronic
1085640994 11:78192569-78192591 TGCGTGGGAGTTGGGGCAGGTGG + Intronic
1086833297 11:91592834-91592856 TGCTTGGGTGTCGCAGGTGATGG + Intergenic
1086959005 11:92963281-92963303 TGTGTGTGTGTGGCGGGTGGTGG + Intergenic
1088685320 11:112280139-112280161 GGCGTGGGCGGGGCGGGTGGGGG + Intergenic
1090619585 11:128549237-128549259 CGCGTGAGAGTGGAGGGTGGGGG - Intronic
1091235889 11:134021795-134021817 TGCGTGTGTGTTGGGGGTGGTGG + Intergenic
1091588093 12:1827489-1827511 TGCGTGGGCGTCGGTGGTGCAGG + Exonic
1092223438 12:6730908-6730930 TGCATGGGAGTAGGGAGTGGGGG + Intronic
1092239742 12:6829284-6829306 TGTGTGTGTGTCGGGGGTGGTGG + Intronic
1094624292 12:32107585-32107607 TGAGTGGGCCTTGCGGGTGGGGG - Intronic
1096007410 12:48184100-48184122 TGAGTGGCAGAAGCGGGTGGCGG - Exonic
1096436159 12:51592056-51592078 GGCGTGGGGGTGGGGGGTGGGGG - Intronic
1097638720 12:62153135-62153157 TGCATGAGAGTGGCTGGTGGTGG + Intronic
1100396938 12:94193846-94193868 TGCATGGGAAACGCGGGGGGTGG + Intronic
1101310764 12:103576259-103576281 TTTGTGGGCGTTGCGGGTGGGGG - Intergenic
1101932826 12:109028762-109028784 TGTGTGGTAGTCGGGTGTGGTGG - Intronic
1103424720 12:120823205-120823227 TGTGTGGGGGTGGGGGGTGGGGG + Intronic
1103479270 12:121240744-121240766 TGCGGGGGAGCCGGGGGCGGGGG + Exonic
1103902795 12:124311948-124311970 TGCGCGGGAGGAGGGGGTGGGGG + Intronic
1104050240 12:125189796-125189818 TGGCTGGGAGTCTGGGGTGGGGG + Intronic
1104915042 12:132260189-132260211 GGCGTGGGGGTCGGAGGTGGGGG + Intronic
1105767997 13:23579601-23579623 TGGGTGGGAGCCGGGAGTGGAGG + Intronic
1106502066 13:30338457-30338479 TGCTTGGGAGTTGCGTGGGGTGG - Intergenic
1108584615 13:51859482-51859504 TGGTTGGGAGTCGGGGGTGCAGG - Intergenic
1108638165 13:52356810-52356832 TGGGTGGGGGTTGGGGGTGGTGG - Intergenic
1113799505 13:113079035-113079057 TGAATGGCAGTGGCGGGTGGAGG - Intronic
1115604937 14:34991716-34991738 TGCGTGTGTGTTGGGGGTGGGGG + Intronic
1119703957 14:76772766-76772788 TGCGAGGCAGTCGGGGGAGGAGG - Intronic
1120864397 14:89283616-89283638 AGGGTGGGAGTGGCGGGTGAAGG + Intronic
1121737044 14:96225896-96225918 AGGGTGGGAGTGGAGGGTGGTGG - Intronic
1122606023 14:102948168-102948190 TGGGAGGGAGTGGGGGGTGGTGG + Intronic
1123827912 15:24101655-24101677 GGCGTGAGGGCCGCGGGTGGAGG + Intergenic
1123842371 15:24261066-24261088 GGCGTGAGGGCCGCGGGTGGAGG + Intergenic
1123862031 15:24477657-24477679 GGCGTGAGGGCCGCGGGTGGAGG + Intergenic
1124903286 15:33844472-33844494 TGGGTGGCAGTGGTGGGTGGGGG + Intronic
1125054261 15:35339033-35339055 GGGGTGGGGGTAGCGGGTGGGGG + Intronic
1128456147 15:67832502-67832524 TGGGTGGGAGTTGGGGGTAGGGG + Intronic
1128627256 15:69222318-69222340 TGGGTGGGAGGCAGGGGTGGTGG + Intronic
1129150653 15:73685484-73685506 TGTGTGTGTGTGGCGGGTGGGGG + Intronic
1129152443 15:73697358-73697380 TGTGTAGGAGTGGAGGGTGGCGG + Intronic
1132664552 16:1075689-1075711 TGCGTGGGAGTCCAGGTGGGTGG - Intergenic
1132696604 16:1204850-1204872 GGGGTGGGAGCCGCGGGTGGGGG + Intronic
1132696640 16:1204934-1204956 GGGGTGGGAGCCGCGGGTGGGGG + Intronic
1132696677 16:1205018-1205040 GGGGTGGGAGCCACGGGTGGGGG + Intronic
1132720186 16:1311915-1311937 CACGTGGGAGTGGAGGGTGGAGG + Intronic
1134195389 16:12155646-12155668 TGCGTTTGAGTAGAGGGTGGTGG + Intronic
1134254109 16:12597655-12597677 TGCGTTGGAATCACGGCTGGGGG - Intergenic
1136428365 16:30183787-30183809 CGCGTGGGAGCCGCGGGCTGCGG + Intronic
1137926550 16:52546828-52546850 CGCGTGGGACTCGCGGCCGGAGG + Exonic
1144483429 17:15645856-15645878 TGCCTGGGAGTGGGGAGTGGGGG + Intronic
1144915255 17:18719171-18719193 TGCCTGGGAGTGGGGAGTGGGGG - Intronic
1146057690 17:29589413-29589435 AGCGTGGGGGGCGCGGGCGGCGG + Exonic
1146173453 17:30650030-30650052 TGCGGGGGAGTCGGCGTTGGTGG + Intergenic
1146346910 17:32066060-32066082 TGCGGGGGAGTCGGCGTTGGCGG + Intergenic
1147988575 17:44320168-44320190 TGTGTGGGTGTCGGGGGTGGGGG - Intronic
1152200607 17:78943707-78943729 TGAGTGGGAGTTGTGGGTGAGGG + Intergenic
1152455781 17:80415351-80415373 TGCTTTGGAGTCTCGGGCGGTGG - Intronic
1152526423 17:80890533-80890555 AGGGTGGGAGGGGCGGGTGGAGG + Intronic
1152538362 17:80963071-80963093 TGGGTGGGGGTCGGGGGTCGGGG + Intronic
1152635140 17:81427729-81427751 TGCGTGCCAGCCGCGGGGGGCGG - Intronic
1152725281 17:81942055-81942077 TGCGCGGGAGGCGGAGGTGGGGG - Intronic
1153538544 18:6130250-6130272 TGTGTGTGTGTGGCGGGTGGGGG - Intronic
1154070808 18:11149705-11149727 GGCGCGGGAGCCGCGGGTGGGGG - Intergenic
1154425535 18:14269074-14269096 ACAGTGGGAGTCGGGGGTGGGGG + Intergenic
1155348007 18:24877682-24877704 TGGGTGGGGGGCGGGGGTGGGGG + Intergenic
1160505056 18:79422450-79422472 TGAGTGGGTGACGGGGGTGGTGG + Intronic
1161256768 19:3314164-3314186 TGGGTGGGTGTTGCGGGGGGGGG + Intergenic
1161307984 19:3577927-3577949 TGCCGGGGAGTCGCGGGGCGGGG - Intronic
1162808465 19:13150957-13150979 AGCCTGGGGGTAGCGGGTGGTGG + Intronic
1162988969 19:14290030-14290052 TGCGGGGGAGTCGGCGTTGGCGG - Intergenic
1164681491 19:30136787-30136809 TGCTTGGGAGTCACTGGGGGAGG - Intergenic
1165481294 19:36066034-36066056 TGAGTGGGAGTCGGGGGCTGGGG + Intronic
1166112250 19:40629709-40629731 TCAGTGGGAGGCGCTGGTGGAGG - Intronic
1166366499 19:42280916-42280938 TGGGTGGGATGCGGGGGTGGGGG - Intronic
1167230392 19:48279438-48279460 TGTGTGGGGGGCGGGGGTGGGGG + Intronic
1167377259 19:49118862-49118884 TGCGTGGGAGTCGCGGGTGGGGG + Exonic
925041291 2:733324-733346 GGCGTGGGAGAAGCGGGTGAGGG - Intergenic
926761901 2:16285466-16285488 TGCCTGGGAGGAGAGGGTGGAGG + Intergenic
927472168 2:23385085-23385107 TGGGCGGGGGTGGCGGGTGGGGG - Intergenic
929822231 2:45282799-45282821 TGCGTGTGTGTCCTGGGTGGAGG - Intergenic
931255602 2:60569487-60569509 TGTGTGTGTGTCGGGGGTGGGGG - Intergenic
931774399 2:65527998-65528020 TCTGTGGGAGTCACGGGTGCTGG + Intergenic
932416919 2:71579118-71579140 TGGGTGGGAGGCGGCGGTGGTGG - Intronic
933108500 2:78365154-78365176 TGTGTGTGTGTCGGGGGTGGTGG - Intergenic
934987924 2:98900644-98900666 TGCGTGTGTGTGGAGGGTGGCGG + Intronic
938288326 2:130136565-130136587 TGCGTGGGCTCCGGGGGTGGGGG - Intergenic
943046529 2:182867291-182867313 GGCCTGGGAGTCGCAGGCGGTGG + Intergenic
946247473 2:218396025-218396047 GGCGTGGGAGTCGCGGCCGCCGG - Exonic
948991761 2:241559161-241559183 TGCGTGGGCGGCGGGGGCGGAGG - Intronic
1168804177 20:662989-663011 TGTGTGGGAGTGGGGTGTGGGGG + Exonic
1171406522 20:24915539-24915561 AGCCTGGGAGACGCGGGTGGTGG + Intergenic
1172684250 20:36741647-36741669 TGCGTGTGAGTCAGGTGTGGGGG - Intronic
1173471092 20:43324143-43324165 TGCTTGGGAGGCTGGGGTGGGGG - Intergenic
1175998570 20:62821996-62822018 TCCGTGGGAGTGGGGGCTGGTGG + Intronic
1179550837 21:42142395-42142417 TGCGGGGGCCGCGCGGGTGGTGG - Exonic
1179656582 21:42849759-42849781 TGCGTGTGAGCCGGTGGTGGCGG - Exonic
1179769681 21:43605469-43605491 TGTGTGGGTGTGGCGTGTGGGGG - Intronic
1180193940 21:46182544-46182566 TCCCCGGGAGTCGAGGGTGGCGG - Intronic
1181528145 22:23501841-23501863 TGAGTGGAGGTGGCGGGTGGTGG - Intergenic
1183395465 22:37568649-37568671 TGCGCGGCAGGAGCGGGTGGAGG + Exonic
1183437698 22:37804970-37804992 TGCGTGGCGGGCGCGGGGGGCGG + Intergenic
1184393396 22:44218567-44218589 TGTGTGTGTGTTGCGGGTGGTGG - Intronic
1184736081 22:46398500-46398522 TGCGTGGGGGTTGTGGGGGGCGG - Intronic
949640348 3:6029612-6029634 TGCCTGGGAATCGCCAGTGGAGG + Intergenic
961000961 3:123373761-123373783 TGCGGGGGGGTCGGGGGGGGGGG - Intronic
961366477 3:126402802-126402824 TGCCTGGGGGTCGGTGGTGGGGG + Intronic
961717081 3:128865095-128865117 TGCGTGGGAGGAGCAGGTTGTGG + Intergenic
965166151 3:165196128-165196150 TGGGTGGGAGTGGGGGTTGGTGG + Intronic
966412903 3:179661641-179661663 TGAGTGGGAGTGGAGGGTGAAGG + Intronic
967503030 3:190222314-190222336 TGCGTGTGTGTCGGGGGGGGTGG + Intergenic
967693154 3:192500439-192500461 TGTGTGTGTGTGGCGGGTGGGGG - Intronic
969559584 4:7938997-7939019 TGCGCGGGGGGCGCGGTTGGTGG - Exonic
972396621 4:38663990-38664012 GGCGCGGGAGGCGGGGGTGGCGG + Intergenic
972850667 4:43046046-43046068 TGTGTGTGTGTTGCGGGTGGGGG + Intergenic
974066369 4:57081379-57081401 TGAGTGGGAGGGGCTGGTGGGGG - Intronic
975610511 4:76198088-76198110 TGCGGTGGAGTCGAGAGTGGGGG - Intronic
985704471 5:1392452-1392474 TGCGTGGGAGCCTGGGGAGGGGG + Intergenic
985704485 5:1392496-1392518 TGCGTGGGAGCCTGGGGAGGGGG + Intergenic
985895379 5:2747686-2747708 TGCCTGGGAGTGGAGGATGGTGG - Intronic
986433038 5:7700692-7700714 TGCGAGGGGGTGGGGGGTGGGGG - Intronic
988035604 5:25823633-25823655 CGCGGGGGAGTTCCGGGTGGGGG - Intergenic
989093060 5:37754803-37754825 TGGGTGGGAGTGGGGGGTGAGGG - Intergenic
989671073 5:43917716-43917738 TGCCTGGGAATCACGAGTGGAGG + Intergenic
992569802 5:78043664-78043686 TGCCTGGGAGTCTCTGCTGGGGG - Intronic
992668566 5:79035724-79035746 TGGGTGGGAGTGGTGGGCGGGGG + Intronic
993460065 5:88172453-88172475 TGCCTGGGTGTCACTGGTGGAGG + Intergenic
994362291 5:98866072-98866094 TGGGTGGGAGTCAGGGGAGGTGG - Intronic
995419212 5:111944415-111944437 TGCCTGGGAGTCTTAGGTGGAGG - Intronic
995471952 5:112511860-112511882 TGAATGGGAGTTGAGGGTGGAGG - Intergenic
997286691 5:132684645-132684667 TGGGTGGGAGGCGGGTGTGGAGG + Intergenic
998236532 5:140402560-140402582 TGCTTTGGAGTTGGGGGTGGGGG + Intronic
998545854 5:143026799-143026821 TGGGTGGGGGTGGGGGGTGGGGG + Intronic
1000796367 5:165670007-165670029 TGTGTGTGTGTCGGGGGTGGGGG - Intergenic
1003881370 6:10482819-10482841 TGCGGGGGACTCGGGCGTGGCGG + Intergenic
1004797365 6:19102779-19102801 TGGGTGGGGGTTGGGGGTGGAGG - Intergenic
1006801911 6:36765182-36765204 TGCGTGTGTGTGGAGGGTGGGGG - Intronic
1007109375 6:39304178-39304200 TGCGTGGGAGCCGAGGGAGCTGG + Intronic
1007349176 6:41256133-41256155 TGTGTGGGTGTCCCAGGTGGTGG - Intergenic
1007436575 6:41817125-41817147 TGCGTGGGAGCCAGGCGTGGTGG - Intronic
1011034187 6:82955710-82955732 TGAGTGTGAGTGGTGGGTGGAGG - Intronic
1011488421 6:87867025-87867047 TTGGTGGGAGTCCCCGGTGGAGG + Intergenic
1011882897 6:92053137-92053159 TGCGGGGTGGTGGCGGGTGGGGG + Intergenic
1017765756 6:157605791-157605813 TGCGTGGGCACAGCGGGTGGGGG + Intronic
1018094753 6:160375450-160375472 TGCTTGGGGGTGGAGGGTGGTGG - Intronic
1019308300 7:346800-346822 GGCGTGTGAGCCCCGGGTGGCGG - Intergenic
1020130233 7:5555380-5555402 GGCGTGGGGGTCGCGGCAGGGGG - Intronic
1022068546 7:26886665-26886687 TGCCTGGGGGCCGGGGGTGGCGG - Intronic
1022094408 7:27130084-27130106 CGCTTGGGAGGCGCGGGAGGTGG - Intronic
1022137161 7:27459333-27459355 TGAGAGGGAGTGACGGGTGGAGG - Intergenic
1022747530 7:33188101-33188123 TGTGTGTGTGTGGCGGGTGGGGG + Intronic
1022797731 7:33745466-33745488 AGCATGGGAGTCGGGCGTGGTGG + Intergenic
1034508909 7:151519190-151519212 GGCGTGGGAGGCGCGGGGCGGGG - Intronic
1035010482 7:155711374-155711396 TGCTGTGGAGTCACGGGTGGCGG - Exonic
1037503280 8:19505786-19505808 TGCGTGGATTTCCCGGGTGGTGG - Exonic
1037802439 8:22043024-22043046 CGCGTGGGAGTCCCGGGAAGAGG - Intronic
1037879468 8:22565874-22565896 TGAGTGGGAGACGCGGGAGGAGG + Intronic
1038490364 8:27966232-27966254 TGCGTGGGAGTAGCTGGCAGGGG - Intronic
1038828453 8:31032874-31032896 GGCGTGGGGGTCGCGGGCGGCGG - Exonic
1041480904 8:58318610-58318632 TGTGTGCGAGTGACGGGTGGAGG + Intergenic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1049180700 8:141220644-141220666 TCCGTGGGAGGCGCGGGAGAAGG + Intronic
1049181701 8:141226297-141226319 TGGGTGGGAGGCACGGGCGGTGG - Intronic
1049572696 8:143376644-143376666 GGCATGGGAGGTGCGGGTGGGGG + Exonic
1049583501 8:143422948-143422970 TGTGTGGGGGTCGAGGGTGTGGG + Intronic
1050658370 9:7854566-7854588 TGCTTGGGGGCTGCGGGTGGGGG - Intronic
1053223032 9:36327258-36327280 TGGGTGGGAGTCGGGGGTAAAGG + Intergenic
1054719016 9:68585134-68585156 TGCTTGGGGGTGGGGGGTGGGGG - Intergenic
1056077808 9:83059605-83059627 TGTGTGGGTGTTGAGGGTGGAGG - Intronic
1058187430 9:101871420-101871442 CCTGTGGGAGTCGGGGGTGGTGG - Intergenic
1059248076 9:112865168-112865190 TGTGTGGGTGTCGTGTGTGGGGG - Intronic
1061000278 9:127898970-127898992 TGAGCGGGAGCCGAGGGTGGGGG + Intronic
1061138513 9:128750588-128750610 TGCGGGGCCGTGGCGGGTGGGGG + Intronic
1061256082 9:129454600-129454622 TGTGTGGCAGTGGTGGGTGGTGG + Intergenic
1062029906 9:134357530-134357552 AGTGGGGGAGTCGTGGGTGGAGG + Intronic
1062444504 9:136587969-136587991 TGCGGGGGAGGCGGGGGCGGGGG + Intergenic
1186808231 X:13161481-13161503 TGTGTGTGTGTGGCGGGTGGGGG + Intergenic
1187363648 X:18649803-18649825 TGGAGGGGTGTCGCGGGTGGGGG - Intronic
1187547177 X:20266254-20266276 TGCGTGGGGGAAGCGGGAGGCGG - Intronic
1189133335 X:38523132-38523154 TGCTAGGGATTGGCGGGTGGTGG - Intronic
1189195852 X:39151934-39151956 TGTGTGGGAGTGGGTGGTGGGGG - Intergenic
1190713985 X:53088652-53088674 TGCGGGGGTTTGGCGGGTGGGGG + Intergenic
1192577977 X:72258080-72258102 TTCGTGGAAGTCTCGGGTTGGGG + Intronic
1193483791 X:82060481-82060503 TGGGTGTGGGTCGCTGGTGGTGG - Intergenic
1196898591 X:120361741-120361763 TGGGTGGGAGTTGGGGGTGAGGG - Intergenic
1200036551 X:153334861-153334883 TGGGTGGGAGTGGGGGGGGGCGG + Intronic
1200217569 X:154374756-154374778 TGCGTGGGGGGCGGGGGTGCGGG + Intergenic
1201511631 Y:14770384-14770406 TGCGTGGGTATCACTGGTGGAGG - Intronic