ID: 1167377773

View in Genome Browser
Species Human (GRCh38)
Location 19:49120573-49120595
Sequence GTTCTAAGCAGAGCAAACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167377773_1167377779 16 Left 1167377773 19:49120573-49120595 CCAGCGTTTGCTCTGCTTAGAAC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1167377779 19:49120612-49120634 GACACACAGACTTAGCCTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167377773 Original CRISPR GTTCTAAGCAGAGCAAACGC TGG (reversed) Intronic
903536738 1:24071889-24071911 GTTCTGAGCAGAGCAGAGTCAGG - Intronic
907139986 1:52177748-52177770 GTTTTAAGCAGAGGAAAACCTGG + Intronic
907859243 1:58335402-58335424 GTTCTGAGCAAAGCAACAGCAGG + Intronic
914986950 1:152468059-152468081 GGTCTGAGCAGAGCAAACTTAGG - Intergenic
920316366 1:205078202-205078224 GGTCCAAGCAGAGCACAGGCAGG + Exonic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
920653354 1:207855163-207855185 CTGCTAAGTGGAGCAAACGCTGG + Intergenic
920722831 1:208403592-208403614 GATGTAAGCAGAGGAAACTCAGG + Intergenic
1064646277 10:17463295-17463317 GTTCTAGGCACTGGAAACGCAGG - Intergenic
1066386660 10:34947175-34947197 GTTCCAAGCAGAGGAAACAGTGG - Intergenic
1071342135 10:84658994-84659016 GGTCTCAACAGAGGAAACGCTGG - Intergenic
1074595911 10:114866910-114866932 GTTATAACCAGAACAGACGCCGG + Intronic
1076170056 10:128311649-128311671 CTCATAAGCAGAGCAAACACTGG + Intergenic
1077010733 11:378144-378166 GTTGCGAGCAGAGCAAAGGCAGG + Intronic
1077147647 11:1053162-1053184 GCTGTATGCAGAGCAAAGGCGGG + Intergenic
1077401331 11:2359298-2359320 CTTCTAAGCGGAGCACACACAGG - Intergenic
1081218996 11:40437352-40437374 GTTTTAAGCAGAGGAAAGACAGG - Intronic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1086731208 11:90251759-90251781 GTTCTAAGCAAAGGAATAGCAGG + Intergenic
1088545312 11:110953068-110953090 CTTCTAAGGAGAGAAAACACGGG - Intergenic
1108490348 13:50975418-50975440 GTTCTAAGCATAGCAGTCTCAGG - Intergenic
1113844532 13:113378973-113378995 GTTCCAAGCAGGGCACAGGCAGG + Intergenic
1113844553 13:113379087-113379109 GTTCCAAGCAGGGCACAGGCAGG + Intergenic
1117386365 14:55217761-55217783 GTTCTAAGTAGAGAAAAAACAGG + Intergenic
1117515162 14:56493348-56493370 CCTCTAAGCACAGCAAAGGCTGG - Intronic
1120381784 14:83789882-83789904 GTCCCAAGGAGAGCAAACTCGGG + Intergenic
1121778589 14:96607257-96607279 GTTCTGGGCAGAGCAACTGCAGG + Intergenic
1126217877 15:46177381-46177403 GTTCTAAGCAGAGGAAAGGAAGG - Intergenic
1129417740 15:75396807-75396829 GTCCTAAGCAAAGCACACGGTGG - Intronic
1131156022 15:90076094-90076116 GTTCTTAGCAAAGCAGCCGCTGG + Intronic
1134544218 16:15095197-15095219 GTTCCAAGCATAGGAAACGGAGG + Intronic
1135090713 16:19513704-19513726 GTTCCAAGTACAGCAAACTCTGG - Intronic
1138784474 16:59830118-59830140 GTTTGAAGCAGAGCAAACCTGGG - Intergenic
1140564961 16:76031263-76031285 TTTCTAAGGAGAGTAAACACTGG - Intergenic
1141480890 16:84306089-84306111 GTGCTGAGCCGAGCACACGCAGG + Intronic
1157696008 18:49724326-49724348 GTTCTAAGCACAGAAAATGCTGG - Intergenic
1166826615 19:45613827-45613849 GTTTTAAGCAGAGCAGGGGCAGG - Intronic
1167377773 19:49120573-49120595 GTTCTAAGCAGAGCAAACGCTGG - Intronic
1168493434 19:56830419-56830441 ATTCTTAGCAGAGTAAAAGCAGG + Intronic
925025348 2:602696-602718 GTTCAAAGAACAGCAAAGGCTGG + Intergenic
927000693 2:18791383-18791405 GCTCTGTGCAGAGCAAAGGCAGG + Intergenic
928393312 2:30925780-30925802 GTTCTAAGCAGGGCAAGAGGTGG + Intronic
930900919 2:56506907-56506929 GATCTGAGCAGTGCAAACGGCGG - Intergenic
937135545 2:119548734-119548756 GTGCTAGGCAGAGCAAAGACAGG + Intronic
937858605 2:126690773-126690795 GTTCAAAGCAAGGCAAAGGCAGG - Intronic
937859104 2:126694360-126694382 GTTCAAAGCAAGGCAAAGGCAGG - Intronic
1170939502 20:20836724-20836746 TTTCTTAGAAGAGCAAATGCAGG + Intergenic
1172606919 20:36220255-36220277 GTTCTAAGCAAAGCAGAAGAGGG + Intronic
1174062532 20:47842966-47842988 GTTCTGAGCAGAGGAAGCACAGG - Intergenic
1174073102 20:47912532-47912554 GTTCTGAGCAGAGGAAGCACAGG + Intergenic
1174150963 20:48486112-48486134 GTTCTGAGCAGAGGAAGCACAGG - Intergenic
1182097892 22:27638288-27638310 GTTCTCAGCAGAGGAAACTGAGG - Intergenic
1185197302 22:49479930-49479952 TTTCTGAGCAGGGCAAACCCAGG - Intronic
952834252 3:37590552-37590574 GTTATAAGCAGAACAAGGGCTGG - Intronic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
961365311 3:126395744-126395766 GTTCTAAGCACAGAAAAAGTAGG + Intronic
962044492 3:131741250-131741272 CATCCAAGCAGAGCAAATGCAGG + Intronic
963765641 3:149333377-149333399 GTTCTAAGCAGGGCAAAATGGGG - Exonic
965474538 3:169138954-169138976 GACCTAAGGAGAGCGAACGCGGG + Intronic
971363663 4:25959095-25959117 GTGCTAAGGAGAGCAAAGGGAGG + Intergenic
978103601 4:104873953-104873975 TTTCTAAGCAGAGTAAATGACGG - Intergenic
986801495 5:11265111-11265133 GTTCGAAGCAAAACAAACACAGG + Intronic
987387252 5:17341873-17341895 GTTTTAAGCAGAGAAATGGCAGG + Intergenic
1001886954 5:175301290-175301312 GTCCTAAGCAGAGAAAAAGCAGG + Intergenic
1002034143 5:176453207-176453229 GTTTTAAGGAGAGCTAATGCAGG + Intronic
1006915139 6:37589039-37589061 GTTCTAAGCACTGCAGACACAGG + Intergenic
1015375178 6:132501944-132501966 GAGCAAAGCAGAGCCAACGCCGG + Intronic
1016710025 6:147159685-147159707 TTTCCAAGCAGAGAAAATGCTGG + Intergenic
1016780024 6:147947117-147947139 ATTCTATGCAGAGCAAAAGATGG - Intergenic
1028113425 7:86970268-86970290 CTTCAAAGCAGAGAAAATGCTGG + Intronic
1031597572 7:123665730-123665752 GTTCTAAGAACAGCAAACCTTGG - Intergenic
1034970140 7:155413600-155413622 GTTCTAAGGAAAGCAGCCGCTGG + Intergenic
1035416679 7:158695170-158695192 GTTCTATTCAGGGCAAACTCTGG + Intronic
1041828468 8:62125151-62125173 ATTCTAAGCAGAGTAAAGTCTGG + Intergenic
1043218957 8:77634131-77634153 GTTCACAGCACAGCAAACACAGG - Intergenic
1044843562 8:96358903-96358925 CTGCTAAGCATAGCAGACGCTGG + Intergenic
1046454836 8:114444754-114444776 GTTCTAACCAGAGCAATCAGAGG + Intergenic
1052045740 9:23792201-23792223 GTTCTAAGCAGATTTAAGGCAGG + Intronic
1056811484 9:89768475-89768497 GGTCCAATCAGAGCAAAAGCAGG + Intergenic
1058790718 9:108442614-108442636 GAAATAAGCAGAGCAAACACAGG + Intergenic
1059450307 9:114367578-114367600 GTCCTCAGCAGAGCAGACCCAGG - Exonic
1186208567 X:7225768-7225790 TTTCTAAGGAGAGCAATCTCAGG + Intronic
1188249064 X:27869568-27869590 GTTCTAAAAAAAGCAAACTCAGG - Intergenic
1188983849 X:36752238-36752260 ATTCTAAGCTGAGCAGATGCAGG + Intergenic
1189040576 X:37538170-37538192 GTTGTAAGCAGAGCAGACGGAGG - Intronic
1189804627 X:44722829-44722851 GTTCTCAGCACAGCAAGGGCTGG - Intergenic
1195213495 X:102673145-102673167 TTTCTAAGGAGAGCAATCTCAGG + Intergenic
1202081174 Y:21085618-21085640 CCTCAAAGCAGAGCAAAGGCAGG - Intergenic