ID: 1167379495

View in Genome Browser
Species Human (GRCh38)
Location 19:49130326-49130348
Sequence CTGTGTCTCCGGAGACACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167379492_1167379495 -10 Left 1167379492 19:49130313-49130335 CCTTGGATTTCCTCTGTGTCTCC 0: 1
1: 0
2: 2
3: 35
4: 449
Right 1167379495 19:49130326-49130348 CTGTGTCTCCGGAGACACTCTGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167379495 Original CRISPR CTGTGTCTCCGGAGACACTC TGG Intronic
901183785 1:7359198-7359220 CTGGGTCTCCAGAGACTCACTGG - Intronic
904037649 1:27567490-27567512 CTGTGCCACCGGAGACACCTTGG + Intronic
905268863 1:36773565-36773587 CTGTGGTTCCAGAGCCACTCAGG - Intergenic
911193549 1:94971790-94971812 CTGTGTCTCATGAGAGACACGGG + Intergenic
917735990 1:177920934-177920956 CCCTGTCTCAGGACACACTCAGG - Intergenic
917819470 1:178747786-178747808 CTGTGCCAGCGGAGACGCTCAGG + Intronic
920301108 1:204989613-204989635 TTGTATCTCTGGAGACACACGGG - Intronic
921221535 1:212977401-212977423 CCGTGTGTCCAAAGACACTCTGG - Intronic
922883960 1:229003794-229003816 CTGACTCTGAGGAGACACTCTGG + Intergenic
1077089504 11:772046-772068 CTGTGTCTCCGAGGACACCCTGG + Intronic
1077143251 11:1034068-1034090 CTGTGTCTCCGGTGACGCAGGGG + Intronic
1080812083 11:35714910-35714932 ATGTGTCCCCAGAGACACCCAGG - Intronic
1081358524 11:42144088-42144110 CTGTGTCTCAGACGACACTTTGG - Intergenic
1085556467 11:77427185-77427207 CTGTCTCTGCAGAGACACTTAGG - Intronic
1089303049 11:117510032-117510054 CTGTGTCTTCTCAGCCACTCAGG - Intronic
1091533614 12:1385066-1385088 CTGGGTCTCAGGAGACAGTTTGG - Intronic
1096648240 12:53049617-53049639 CTGACTCTCAGGACACACTCGGG + Intronic
1097363137 12:58680154-58680176 CTGTGTCACCGGAGAGAGTGGGG + Intronic
1103915969 12:124375912-124375934 CTGGGTCTCCGGGGAGATTCAGG + Intronic
1103953182 12:124562896-124562918 CTGTGTGTCCTGCGACACACAGG + Intronic
1104235819 12:126935613-126935635 CTCTGTTCCCGGAGATACTCAGG + Intergenic
1104466814 12:128997108-128997130 CTGTGTCTCCTGAGCAACCCTGG - Intergenic
1110090941 13:71447310-71447332 CTGTGTCTGAGGAGACAGACAGG + Intronic
1114558933 14:23577616-23577638 CTCTTTCTCCGCAGCCACTCAGG - Exonic
1121962229 14:98272025-98272047 TTGTGTCTCAGGAGGCTCTCAGG - Intergenic
1124032016 15:26020337-26020359 CTGGGTCTTCAGAGGCACTCAGG + Intergenic
1124093746 15:26629558-26629580 CTGTGTCTCCGCAGCCCCACTGG - Intronic
1125807750 15:42508840-42508862 CTGTGGGTCGGGAGACATTCTGG - Intronic
1128459363 15:67854681-67854703 CTGTGTCTGTGGGGACACTGTGG + Intergenic
1131445108 15:92492283-92492305 TTGTGGCTCAGGAGATACTCTGG - Intronic
1133274049 16:4625946-4625968 GTGGGTGTCCGGAGACACCCAGG - Intronic
1133971298 16:10570033-10570055 CTGGGTCTGCTGAGACACTGGGG + Intronic
1142590215 17:1001441-1001463 CAGTGTCTCTGCAGGCACTCAGG + Exonic
1144389559 17:14780622-14780644 CTTTCTTTCCGGAGACCCTCTGG + Intergenic
1144541829 17:16150647-16150669 CTGTTTCTCCTGATACAGTCTGG - Intronic
1148482830 17:47971203-47971225 CTGTGTCTCCGGTCTCCCTCCGG + Intronic
1151030071 17:70727290-70727312 CTGGCTCTCCTGAGACACTGTGG - Intergenic
1154300305 18:13186113-13186135 CTGTGTCTCAGGGGACAGCCTGG + Intergenic
1156336780 18:36179649-36179671 CTCTGTGTCGGGAGACAGTCTGG - Intronic
1157785818 18:50481715-50481737 CACTGTCTCTGCAGACACTCTGG + Intergenic
1158694903 18:59695767-59695789 GTGAGTCTCCAGAGACAGTCAGG + Intronic
1159341666 18:67141644-67141666 CTGTGCCTCTGGAGGCAGTCTGG + Intergenic
1160240657 18:77120032-77120054 CTCTGTCTCTGGAGACATTGGGG - Intronic
1160543867 18:79640213-79640235 CTGTGTCTCCGGGGTGACTTGGG - Intergenic
1160935893 19:1594445-1594467 CTCTGTCTCCCGAGAAGCTCAGG + Intergenic
1161864216 19:6821988-6822010 CTGTGTCTCCCCAGACTCTCAGG - Intronic
1161932222 19:7348759-7348781 ATGTGTATCCGTAGAGACTCAGG - Intergenic
1163827394 19:19531272-19531294 CTGTGGCTCTGGAGACACCAAGG + Intronic
1167379494 19:49130323-49130345 GAGTGTCTCCGGAGACACAGAGG - Intronic
1167379495 19:49130326-49130348 CTGTGTCTCCGGAGACACTCTGG + Intronic
1168136361 19:54354953-54354975 CTGGGTCTCTGGAAACAGTCAGG + Exonic
1168507762 19:56950773-56950795 CTGTGTCTCCTGATTCACTATGG + Intergenic
925999168 2:9316510-9316532 CTGTGGCTTCTGTGACACTCTGG - Intronic
929862454 2:45691311-45691333 CAGTGTCTCCAGAGAGACTGTGG + Intronic
929944705 2:46361632-46361654 CTGTGTCTCCTAAGAGACACTGG - Intronic
943009639 2:182431773-182431795 CTCTGTCTCTGGGGTCACTCAGG + Intronic
946060019 2:216933766-216933788 CTGTGCCTCAGCAGACAGTCAGG - Intergenic
1168894433 20:1313544-1313566 CTGTGCCTCAGGAGACACTGGGG + Intronic
1171531960 20:25858970-25858992 GTGTGTCACCGGAGACATACGGG + Intronic
1176299836 21:5094437-5094459 CTTGGTCTCAGGAAACACTCAGG - Intergenic
1177640058 21:23834342-23834364 GTGTGTCTCCGAGGACACTTGGG - Intergenic
1178597542 21:33968330-33968352 CTGTGTCTAAGGAGATACCCTGG + Intergenic
1179471957 21:41616587-41616609 CTGTGACTCAGGAGTCATTCAGG - Intergenic
1179857186 21:44167474-44167496 CTTGGTCTCAGGAAACACTCAGG + Intergenic
1181625232 22:24118574-24118596 CTGTGGCTCCTTAGGCACTCAGG - Intronic
1183577008 22:38697904-38697926 CTGTGTATCCAGTCACACTCTGG - Intronic
1184739573 22:46419586-46419608 CTGTTTTTCCCGGGACACTCAGG - Intronic
1184848893 22:47107305-47107327 CTGTGACTCCTGATACATTCAGG - Intronic
1184984257 22:48118720-48118742 CTGGGTGTCCGGAAACCCTCTGG - Intergenic
950887560 3:16374720-16374742 CTGTGGCAACGGAGACACTGAGG + Intronic
950917011 3:16656381-16656403 TTGTGTCTTCAGAGACACTATGG + Intronic
954793699 3:53150581-53150603 CTGGGTCTCTGGAGCCAATCGGG - Intergenic
955094309 3:55782100-55782122 CTGTGTGCTCTGAGACACTCAGG + Intronic
955173916 3:56593598-56593620 CTGTGTCTCTCCTGACACTCAGG + Exonic
959911977 3:111773587-111773609 CTCTGTCTCAGGAGAAATTCAGG - Intronic
961676961 3:128573547-128573569 CTCTGGCACCAGAGACACTCGGG - Exonic
962238952 3:133733928-133733950 CAGTGGCTCCTGAGACACTGGGG + Intergenic
969197772 4:5576769-5576791 CTGTGTCTCCCAAGGAACTCAGG - Intronic
975666574 4:76740178-76740200 CTGTGTCTTCTCAGACTCTCAGG - Exonic
976001015 4:80373105-80373127 CTGTGTCTATGCAGCCACTCAGG - Intronic
980104003 4:128570021-128570043 CTGTGCCTCCTTAGACACTGTGG + Intergenic
980889883 4:138803712-138803734 CTGTGTCTCTGGAGAAATTCTGG - Intergenic
981449445 4:144879542-144879564 TTGTGTCTGTGGAGACACTTGGG - Intergenic
985851966 5:2395212-2395234 CTGTGGCTCCGGAGCACCTCTGG - Intergenic
991619498 5:68530929-68530951 CTGTGTCTCTTGAGAAACGCTGG + Intergenic
993090453 5:83419946-83419968 CTGTGTCTCCAGATACTCACTGG + Intergenic
998562494 5:143184414-143184436 CTGTGATGCTGGAGACACTCTGG - Intronic
1001319795 5:170671043-170671065 CTGTGTCTTCTGAGGCAGTCTGG + Intronic
1002971276 6:2023086-2023108 CTGTGTCTCCAGAGATGTTCTGG + Intronic
1007325046 6:41053318-41053340 CTGTGGCTCAGGAGTCACTGAGG - Exonic
1007342987 6:41204053-41204075 CAGTCTCTCCAGAGACACTAGGG + Intergenic
1015811331 6:137164597-137164619 CTGAGTCTCCGGAGGCAGCCGGG - Intronic
1018421458 6:163643935-163643957 CTGGGTCTCCATGGACACTCAGG + Intergenic
1018918128 6:168150707-168150729 CTGTGGCTCCGGGGACTCTAGGG - Intergenic
1019074311 6:169375355-169375377 CTGTGTCTCCTTAAACACTCTGG - Intergenic
1020240927 7:6394550-6394572 CTGAGTCTCAGGACACACACAGG - Intronic
1033244817 7:139708662-139708684 CTCTGTCTCTGGGGACACTGGGG + Intronic
1034315357 7:150126034-150126056 CTGTGTCATCAGAGAGACTCTGG - Intergenic
1034791537 7:153974760-153974782 CTGTGTCATCAGAGAGACTCTGG + Intronic
1037643716 8:20771587-20771609 CTGTGTCTTTGCAGTCACTCTGG + Intergenic
1039442478 8:37604846-37604868 CTGTGTCCCCGGAGAGCCCCTGG - Intergenic
1046746747 8:117884036-117884058 TTGTGTCTTCAGAGAGACTCAGG + Intronic
1047448239 8:124938737-124938759 CTGTTTCTTCGGATAGACTCAGG + Intergenic
1047763320 8:127970197-127970219 CTCTGTCTCCTCAGACCCTCAGG + Intergenic
1049374135 8:142281050-142281072 CAGTGTGTCCGGAGACCCTCAGG - Intronic
1053135752 9:35649505-35649527 CTGTGCCTGAGGAGACACTGAGG + Exonic
1055087090 9:72325376-72325398 CTGTGTCTCCAGTGGAACTCAGG - Intergenic
1061801346 9:133114924-133114946 CTGTGTCCCTGGAGACATTGGGG - Intronic
1203771731 EBV:53125-53147 CTACGTCTCCGCAGACACCCAGG - Intergenic
1188462023 X:30439167-30439189 CTGTGTGTCCCTAGACACACTGG + Intergenic
1193665179 X:84307809-84307831 CTGTGTCTCCGCTGGCACACTGG - Intergenic
1195537595 X:106026498-106026520 CTATGTCTCCTAAGACTCTCTGG - Intergenic
1201719826 Y:17084367-17084389 CTGTGTCACAGGAGAAACACAGG - Intergenic