ID: 1167380172 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:49133885-49133907 |
Sequence | GGGGCGGAAGACTGCACAGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 153 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 145} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1167380163_1167380172 | 16 | Left | 1167380163 | 19:49133846-49133868 | CCAGCTGGAAGAGAAGAATCAAG | 0: 1 1: 0 2: 5 3: 41 4: 285 |
||
Right | 1167380172 | 19:49133885-49133907 | GGGGCGGAAGACTGCACAGAGGG | 0: 1 1: 0 2: 0 3: 7 4: 145 |
||||
1167380162_1167380172 | 17 | Left | 1167380162 | 19:49133845-49133867 | CCCAGCTGGAAGAGAAGAATCAA | 0: 1 1: 0 2: 0 3: 45 4: 323 |
||
Right | 1167380172 | 19:49133885-49133907 | GGGGCGGAAGACTGCACAGAGGG | 0: 1 1: 0 2: 0 3: 7 4: 145 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1167380172 | Original CRISPR | GGGGCGGAAGACTGCACAGA GGG | Intronic | ||