ID: 1167380172

View in Genome Browser
Species Human (GRCh38)
Location 19:49133885-49133907
Sequence GGGGCGGAAGACTGCACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167380162_1167380172 17 Left 1167380162 19:49133845-49133867 CCCAGCTGGAAGAGAAGAATCAA 0: 1
1: 0
2: 0
3: 45
4: 323
Right 1167380172 19:49133885-49133907 GGGGCGGAAGACTGCACAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 145
1167380163_1167380172 16 Left 1167380163 19:49133846-49133868 CCAGCTGGAAGAGAAGAATCAAG 0: 1
1: 0
2: 5
3: 41
4: 285
Right 1167380172 19:49133885-49133907 GGGGCGGAAGACTGCACAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167380172 Original CRISPR GGGGCGGAAGACTGCACAGA GGG Intronic
901759248 1:11460002-11460024 AGGGAGGATGACAGCACAGACGG - Intergenic
902955481 1:19922075-19922097 GGGGCTGAGGGCTGCACTGATGG + Intronic
903030825 1:20463125-20463147 AGGAAGGAGGACTGCACAGAAGG + Intergenic
904618143 1:31760893-31760915 GAGCGGGAGGACTGCACAGAGGG - Intronic
908813895 1:68011971-68011993 GGCGGTGAAGACTTCACAGAAGG - Intergenic
911174896 1:94808878-94808900 GGTGCTGGAGACTGAACAGAAGG - Intergenic
912105273 1:106265227-106265249 GATGAGGAAGACTGCACAGCTGG + Intergenic
918332544 1:183473075-183473097 GGGGAGGAAGTCTGCACACCTGG + Intronic
919886516 1:201938891-201938913 GGGGTGGAAGCCTGCAGACAAGG + Intronic
1068061452 10:52072836-52072858 AGTGCGGAAGACTGGACACAGGG - Intronic
1070816972 10:79330855-79330877 GGGGTAGAAGTCAGCACAGAGGG + Intergenic
1073867243 10:107819037-107819059 GAGGCTGAAGCCTGCACAGAAGG + Intergenic
1073921635 10:108466263-108466285 GGGGCGGAGAACAGCAGAGAGGG + Intergenic
1076001486 10:126916652-126916674 GGGGAGGAAGAAAGGACAGAAGG - Intronic
1080648376 11:34203684-34203706 GGGGCAGAAGAATGCAGGGAAGG + Intronic
1083704469 11:64504501-64504523 GGGGCCGGAGCCTGCATAGAGGG - Intergenic
1089596419 11:119583795-119583817 GGGGAGCAACACTGCACACATGG + Intergenic
1089967588 11:122666095-122666117 GGGGAAGCCGACTGCACAGATGG + Intronic
1090983152 11:131741252-131741274 GGGGCGGTAGCCTACCCAGAAGG + Intronic
1091174620 11:133546984-133547006 GGGGCAGGAGGCTGCACAGGGGG - Intergenic
1091174636 11:133547038-133547060 GGGGGAGGAGGCTGCACAGAGGG - Intergenic
1092936970 12:13373284-13373306 GAGGCTGAAGAGTGGACAGACGG - Exonic
1107115331 13:36740477-36740499 GGGGAGGAGGGCTGCACAGTTGG - Intergenic
1114597644 14:23926893-23926915 GGAGCAGAAAACTGCAAAGATGG - Intergenic
1118897012 14:69953661-69953683 GAGGGGGAAGGCAGCACAGAGGG - Intronic
1120115620 14:80613817-80613839 GGGGCAGAAGACAGCAAATAGGG + Intronic
1124719511 15:32099197-32099219 GGGGCAGCAGGCTGCACAGTGGG + Intronic
1129155356 15:73714089-73714111 GGGGCGGAAACCTGGAGAGAGGG + Exonic
1129767365 15:78178844-78178866 GGGCCGGGAGACTGGTCAGAGGG + Intronic
1132345445 15:101105501-101105523 GGGGCTGCAGACTGCAGACAAGG + Intergenic
1132629594 16:910778-910800 GGGGCAGAAGAGTGCGCAGCTGG + Intronic
1132695179 16:1198871-1198893 GGGGCGGGTGACTGCACGGTGGG - Intronic
1139529641 16:67536841-67536863 GGGGCTGAAGAGTGGAAAGATGG - Intronic
1140908966 16:79434196-79434218 GGGCCAGAAGACTGCAGTGAAGG + Intergenic
1142386611 16:89769266-89769288 GAGGCGGAAGCCAGGACAGAGGG - Intronic
1144205067 17:12974168-12974190 GGGGCGGGAGGCTGCATGGAGGG - Exonic
1146006962 17:29166453-29166475 GGGGCGGCAGAGTGCTCTGAGGG + Exonic
1148924211 17:51067972-51067994 GGGGCAGAAGACAACAGAGATGG - Intronic
1151007775 17:70457872-70457894 GGGGCTAAAGAATGCTCAGATGG - Intergenic
1152603035 17:81274667-81274689 GGAGCGCAAGACAGCACAGCGGG + Intronic
1152603049 17:81274742-81274764 GGGGCGAAAGACAGCGCAGCGGG + Intronic
1152928585 17:83099029-83099051 GGGGCCGCTGCCTGCACAGAAGG - Intergenic
1154319620 18:13336779-13336801 GGGGAGGAAGACAGAAGAGAGGG - Intronic
1155492684 18:26415827-26415849 GGGGAGGAAGAGTGGTCAGAGGG - Intergenic
1156824593 18:41415240-41415262 TGGCTGGAAGACTGAACAGATGG + Intergenic
1158610737 18:58938180-58938202 GGGAAGGAAGACTGCAGACAGGG - Intronic
1163055408 19:14714094-14714116 GGGGAGGAAGTGGGCACAGAGGG + Intronic
1163315647 19:16538838-16538860 GGGGAGGAAGACACCTCAGACGG - Intronic
1165360916 19:35336424-35336446 CAGGGGGAAGCCTGCACAGACGG + Intronic
1165489170 19:36113441-36113463 GGGCCGGATCCCTGCACAGATGG - Exonic
1166725104 19:45022143-45022165 GTGGGGAAAGACTGCACCGACGG + Exonic
1166816091 19:45547086-45547108 GGGAGGGAGGACTCCACAGAGGG + Intronic
1167358170 19:49016553-49016575 GGGGCAGTAGCCGGCACAGATGG + Exonic
1167359667 19:49023442-49023464 GGGGCAGTAGCCGGCACAGATGG + Exonic
1167361464 19:49032643-49032665 GGGGCAGTAGCCGGCACAGATGG - Exonic
1167362189 19:49036142-49036164 GGGGCAGTAGCCGGCACAGATGG + Exonic
1167363894 19:49044716-49044738 GGGGCAGTAGCCGGCACAGATGG - Exonic
1167364604 19:49048211-49048233 GGGGCAGTAGCCGGCACAGATGG + Exonic
1167365889 19:49054847-49054869 GGGGCAGTAGCCGGCACAGATGG + Exonic
1167380172 19:49133885-49133907 GGGGCGGAAGACTGCACAGAGGG + Intronic
925093490 2:1174186-1174208 AGTATGGAAGACTGCACAGATGG - Intronic
925564580 2:5236304-5236326 GGAGGGGAAGACTGCAGGGAAGG - Intergenic
925991616 2:9259449-9259471 GGGGTGGGAGCCTGCAGAGAGGG - Intronic
927282053 2:21317669-21317691 GGGGCAGAAGACAGGACAGGAGG - Intergenic
933353707 2:81189539-81189561 GGGGCCCCAGACTGCAAAGAAGG - Intergenic
933750588 2:85600251-85600273 GGTGGGGAGGGCTGCACAGAAGG + Intronic
933764459 2:85697357-85697379 GGGGCCAGAGACTGTACAGACGG - Intronic
934511290 2:94946543-94946565 GGGGGGGAAGACTGAAAAGATGG - Intergenic
934739582 2:96710162-96710184 GGGGAGGAATACTGCAAAGGGGG + Intronic
935318825 2:101865066-101865088 GCTGTGGTAGACTGCACAGAAGG - Intronic
938468873 2:131542422-131542444 AGGGGGGAAGACTGAAAAGACGG - Intergenic
943769858 2:191704901-191704923 GGGGTGGGGGTCTGCACAGACGG - Intergenic
945976417 2:216274506-216274528 TGGACAGAATACTGCACAGAAGG + Intronic
947967507 2:234293989-234294011 GTGGGGAAAGACTGTACAGAGGG - Intergenic
948270643 2:236670734-236670756 TGGGCACAAGACTGCACTGAAGG - Intergenic
949044836 2:241867639-241867661 TGGGCGGCAGACAGCAGAGAGGG - Intergenic
1169308704 20:4517217-4517239 TGGGCAGAAGACTGGACAGGAGG - Intergenic
1170122388 20:12925372-12925394 GGCGCGGAAAAATGCACAAATGG - Intergenic
1174347422 20:49940745-49940767 GGAGGGGAAGACTGCAGAGACGG - Intronic
1174348235 20:49947738-49947760 GGAGAGGAAGACAGAACAGAGGG - Intronic
1174980295 20:55386798-55386820 GAGCAGGAAGGCTGCACAGAGGG + Intergenic
1176084770 20:63290907-63290929 GGGGCTGGAGGCTGCACAGGAGG + Intergenic
1176185132 20:63774138-63774160 AGGGCTGAGCACTGCACAGACGG - Intronic
1176547516 21:8208190-8208212 GGCGGGGAAGAGGGCACAGACGG - Intergenic
1176555425 21:8252399-8252421 GGCGGGGAAGAGGGCACAGACGG - Intergenic
1176566467 21:8391237-8391259 GGCGGGGAAGAGGGCACAGACGG - Intergenic
1176574343 21:8435424-8435446 GGCGGGGAAGAGGGCACAGACGG - Intergenic
1176610955 21:8986716-8986738 GGCGGGGAAGAGGGCACAGACGG - Intergenic
1177572676 21:22907516-22907538 GGAGGGGAAGAAGGCACAGAGGG + Intergenic
1181084175 22:20431690-20431712 GGGGCGGAATCCTGGAGAGATGG - Intronic
1182489886 22:30664525-30664547 GAGGAGGAAGACTGTACAAATGG - Intronic
1184161414 22:42699608-42699630 GGGACGCAGGACTGCACAGAGGG + Intronic
1185082910 22:48719461-48719483 GGAGAGGAAAACTGCCCAGAAGG + Intronic
1203252389 22_KI270733v1_random:124475-124497 GGCGGGGAAGAGGGCACAGACGG - Intergenic
1203260446 22_KI270733v1_random:169561-169583 GGCGGGGAAGAGGGCACAGACGG - Intergenic
949814764 3:8046789-8046811 GGGGTGAAAGACTGCAAATACGG + Intergenic
949964054 3:9340291-9340313 GAGGGGGAAGAGAGCACAGAGGG - Intronic
950134984 3:10574818-10574840 GGGGTGGGAGACTGCACGGTAGG + Intronic
950528651 3:13539834-13539856 TGGGCGGATGGCTGCACAGATGG + Intergenic
950544238 3:13629344-13629366 GGGGAGGTGGAGTGCACAGAGGG - Intronic
954389367 3:50260691-50260713 GAGGGGGAACCCTGCACAGAGGG + Intergenic
955965614 3:64385958-64385980 GAAACGTAAGACTGCACAGAAGG - Intronic
957137435 3:76307359-76307381 GGTTAGGAAGACTGCAGAGAAGG - Intronic
958119026 3:89260811-89260833 GGTGTGGAAGTCAGCACAGAGGG - Intronic
964155460 3:153579927-153579949 TGAACAGAAGACTGCACAGAAGG - Intergenic
980917978 4:139051978-139052000 ATGGTGGAAGACTGCACATAAGG + Intronic
981785094 4:148468530-148468552 GTGAAGGAGGACTGCACAGAAGG + Intergenic
985548571 5:521998-522020 GGGGCTGCAGAGTGCACAGTGGG + Intronic
985949323 5:3211195-3211217 GGGGAAGAAGACTTCTCAGAAGG - Intergenic
993805828 5:92407728-92407750 TGGGAGGAAGACAGCACAGGGGG - Intergenic
1003392083 6:5723043-5723065 GTTGGGGAAGACTCCACAGATGG + Intronic
1003566822 6:7229542-7229564 AGGGCGGAAGACTGATCTGAGGG - Exonic
1004816749 6:19319327-19319349 GGGGCGGAAGAATGGAAGGATGG - Intergenic
1005005188 6:21280976-21280998 GCTGGGGAAAACTGCACAGAAGG + Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1007278302 6:40691627-40691649 GGGGCAGGAGGCTGCTCAGAGGG - Intergenic
1010782898 6:79965820-79965842 GGGCTGGAAGACAGCAAAGATGG - Intergenic
1019425790 7:975907-975929 GGGGAGGAAGGCGGCACAGGAGG + Intergenic
1021792998 7:24225218-24225240 GGGCCGGAAGACAGCACACAGGG + Intergenic
1022309011 7:29177690-29177712 TGGATGGATGACTGCACAGATGG - Intronic
1023632766 7:42180150-42180172 GGGGCGGAGGACAACAGAGAAGG + Intronic
1024274089 7:47663740-47663762 GGGGAGGAAGAGGGCAGAGACGG + Intergenic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026495107 7:70895121-70895143 GGGGCAGAACACCCCACAGAGGG - Intergenic
1028738607 7:94246934-94246956 GGGGCAGAGGAATGCACACAGGG + Intergenic
1029071934 7:97906594-97906616 GAGGCAGAAAACTGCAAAGAGGG - Intergenic
1029203649 7:98855497-98855519 GGTGCTGAAGCCTGCTCAGAGGG + Intronic
1030283844 7:107804602-107804624 GGGGCTGATGATTACACAGAGGG + Intergenic
1032522324 7:132554738-132554760 GGGGCTGAAGACAGCTGAGATGG + Intronic
1034515023 7:151569725-151569747 GGGCCAGACGACTACACAGAAGG + Intronic
1035552659 8:542247-542269 GGGGAGGGAGGGTGCACAGAGGG + Intronic
1035842335 8:2826324-2826346 GGGACCGAAGCCTGCACAGAAGG + Intergenic
1036255027 8:7199060-7199082 GAGGCAGAAAACTGCAAAGAGGG - Intergenic
1036362461 8:8088447-8088469 GAGGCAGAAAACTGCAAAGAGGG + Intergenic
1036896104 8:12636724-12636746 GAGGCAGAAAACTGCAAAGAAGG - Intergenic
1040578044 8:48671534-48671556 AGGTCTGAAGACTGCACAGCAGG + Intergenic
1041101587 8:54401082-54401104 GGGACTGAAGTCTGCACAAAGGG - Intergenic
1045081885 8:98634518-98634540 AAGGCGGAAGATTGGACAGAGGG + Intronic
1047778524 8:128092873-128092895 GGGATGGAAGACTGAATAGATGG - Intergenic
1050740536 9:8814401-8814423 GGAGGGGAAGACCCCACAGAAGG + Intronic
1053474915 9:38375787-38375809 GGGGCGGGGGACTGGGCAGAAGG - Intergenic
1056994784 9:91445655-91445677 GGGGCGCAAGACTGCTCTGTAGG + Intergenic
1057794064 9:98143205-98143227 GAGGGGGAAGACAGGACAGAAGG + Intronic
1062277356 9:135737177-135737199 GAGGCCGAAGCCTGCACAGCAGG + Intronic
1203468794 Un_GL000220v1:107626-107648 GGCGGGGAAGAGGGCACAGACGG - Intergenic
1203476615 Un_GL000220v1:151598-151620 GGCGGGGAAGAGGGCACAGACGG - Intergenic
1186167630 X:6843780-6843802 GAGCAGGAAGACTGCACTGATGG - Intergenic
1187467875 X:19542587-19542609 TGGGGGGACAACTGCACAGAGGG + Intronic
1191122741 X:56922831-56922853 GGAGCAGAAGTCTGCACAGCTGG + Intergenic
1192148544 X:68697802-68697824 GGGGCAGAGGCCTGCACTGAGGG - Intronic
1197898455 X:131342357-131342379 GGGGAGGAAGAGGGCAGAGAAGG + Intronic
1198300662 X:135331665-135331687 GGAGAGGAAGAGGGCACAGAAGG - Intronic
1199677830 X:150202675-150202697 TGGACGGAAGGCTGAACAGAAGG + Intergenic