ID: 1167380172

View in Genome Browser
Species Human (GRCh38)
Location 19:49133885-49133907
Sequence GGGGCGGAAGACTGCACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167380163_1167380172 16 Left 1167380163 19:49133846-49133868 CCAGCTGGAAGAGAAGAATCAAG 0: 1
1: 0
2: 5
3: 41
4: 285
Right 1167380172 19:49133885-49133907 GGGGCGGAAGACTGCACAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 145
1167380162_1167380172 17 Left 1167380162 19:49133845-49133867 CCCAGCTGGAAGAGAAGAATCAA 0: 1
1: 0
2: 0
3: 45
4: 323
Right 1167380172 19:49133885-49133907 GGGGCGGAAGACTGCACAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167380172 Original CRISPR GGGGCGGAAGACTGCACAGA GGG Intronic