ID: 1167382482

View in Genome Browser
Species Human (GRCh38)
Location 19:49146551-49146573
Sequence CAAGGAGGACACACTGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167382471_1167382482 29 Left 1167382471 19:49146499-49146521 CCCTATAGTGGAGGGGGCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1167382482 19:49146551-49146573 CAAGGAGGACACACTGGCTGTGG 0: 1
1: 0
2: 2
3: 29
4: 337
1167382473_1167382482 28 Left 1167382473 19:49146500-49146522 CCTATAGTGGAGGGGGCGGGGGC 0: 1
1: 0
2: 0
3: 17
4: 196
Right 1167382482 19:49146551-49146573 CAAGGAGGACACACTGGCTGTGG 0: 1
1: 0
2: 2
3: 29
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167382482 Original CRISPR CAAGGAGGACACACTGGCTG TGG Intronic
900470879 1:2854370-2854392 CTAGGAGGACACCCAGGCTGAGG - Intergenic
900553649 1:3269186-3269208 CAAGGAGCAGGCAGTGGCTGGGG + Intronic
900733446 1:4278891-4278913 GAAGGAGGCAACACAGGCTGAGG + Intergenic
901005474 1:6169783-6169805 CGAGTAGGACAAGCTGGCTGGGG - Intronic
902124943 1:14201518-14201540 GGAGCAGGACAGACTGGCTGAGG - Intergenic
902806133 1:18862352-18862374 CAAGGAGGCCAGTGTGGCTGTGG - Intronic
905132554 1:35771771-35771793 CAAGCTGGCCACACTGGCAGTGG - Intergenic
906154234 1:43604801-43604823 CCAGGATGAGACACTGGTTGGGG - Intronic
906580857 1:46934268-46934290 CCAGGAGATCCCACTGGCTGTGG + Exonic
906602866 1:47144626-47144648 CCAGGAGATCCCACTGGCTGTGG - Exonic
907574897 1:55517564-55517586 CAAGGAGGCCAGTGTGGCTGGGG + Intergenic
907719401 1:56957747-56957769 CAAGGAGGTCACAGATGCTGGGG + Intronic
907993177 1:59602690-59602712 CGAGGAGGACATACTTGCTTGGG - Intronic
911718813 1:101167378-101167400 CTAGGAGGACAGACTGACAGAGG - Intergenic
912491181 1:110063693-110063715 CAAGCAGGAGACACTGGGAGGGG - Intronic
914938877 1:152004415-152004437 GAAGGTAGACATACTGGCTGGGG + Intergenic
915065303 1:153219851-153219873 CATGGAGGAAACACAGGCAGTGG + Intergenic
915190351 1:154145183-154145205 CAAGGCGGTCAGACTGCCTGAGG + Intronic
915231970 1:154452357-154452379 CAAGGAGGGCAGTGTGGCTGGGG - Intronic
916506273 1:165430652-165430674 CAAGGAGAAAACACATGCTGTGG + Intronic
917929985 1:179816476-179816498 CAAGGAGGACACGGCTGCTGTGG - Intergenic
918107269 1:181425708-181425730 GAAGGAGGACAGTGTGGCTGGGG - Intronic
919340326 1:196298665-196298687 CAAGGAGGGCAGAGGGGCTGGGG - Intronic
924573484 1:245258769-245258791 CAAGCAGGACCCACGGGCGGGGG + Intronic
1065071666 10:22031232-22031254 CAACGATGCCACTCTGGCTGGGG - Intergenic
1065434077 10:25689382-25689404 CAAGGAGGCCAGCCTGGTTGTGG + Intergenic
1067037337 10:42930374-42930396 CAAGGAGGATCCAGAGGCTGGGG + Intergenic
1067474925 10:46558555-46558577 CAAGGAGGCTCCCCTGGCTGTGG + Intergenic
1069893850 10:71668286-71668308 CAAGAAGGGCAAACTGCCTGTGG + Intronic
1069909918 10:71752690-71752712 CAGGGAGGAAGCACTGTCTGGGG - Intronic
1071145708 10:82568220-82568242 GAAGGAGGACACACTTGCCTAGG + Intronic
1071820117 10:89271424-89271446 TAAGGAGTACAAAGTGGCTGGGG - Intronic
1072094805 10:92167623-92167645 CAAGGTGGGCACAGTGGCTCAGG + Intronic
1075352331 10:121734890-121734912 AGTGGAGGAGACACTGGCTGTGG - Intergenic
1075746903 10:124734414-124734436 CAAGGAGGACACAGTGGGTGAGG + Intronic
1076046995 10:127302130-127302152 GAAGCAGGAAACACAGGCTGTGG - Intronic
1077288754 11:1779227-1779249 CATGGAGGACACACAGGTCGTGG + Intergenic
1078454582 11:11465224-11465246 CAAGGAGGCCACATTGGCACCGG + Intronic
1079336970 11:19578469-19578491 CAAGGAGGCCACACATGCAGGGG + Intronic
1080907572 11:36561980-36562002 CAAGGAGGCTACTGTGGCTGCGG + Intronic
1083314904 11:61808627-61808649 CAAGGAGGAAGCAATGGATGGGG + Intronic
1083422213 11:62560396-62560418 CAATGAGGACACACTCTCTGTGG - Exonic
1083658732 11:64242278-64242300 CAAGGAAGATACAGTGGCGGTGG + Intronic
1083755208 11:64788535-64788557 CAAGGAGGACGCCCTCCCTGGGG + Intergenic
1084051146 11:66600760-66600782 CAAGGAGCACACAGTCTCTGGGG + Intronic
1084147127 11:67270968-67270990 CGGGGAGGAAACACTGGCTGCGG - Intronic
1084998159 11:73003872-73003894 CAAGGTGGGCAGACTGCCTGAGG + Intronic
1085275849 11:75299668-75299690 GAATGGGGACACACTGGATGTGG - Intronic
1085399073 11:76224776-76224798 CAAGGAGAAGACAGTGCCTGAGG + Intergenic
1086921737 11:92595306-92595328 CCAAGAGGACACACAGGCTGGGG - Intronic
1089381439 11:118035619-118035641 TGAGGAGGGCAGACTGGCTGGGG - Intergenic
1090853229 11:130588796-130588818 CAGGGATGTGACACTGGCTGAGG + Intergenic
1091070841 11:132561480-132561502 CAAGGAGCCCACACTGAGTGGGG - Intronic
1092507388 12:9117598-9117620 GAAGGAGGACAGAAGGGCTGAGG + Intergenic
1095216453 12:39555853-39555875 CAGGCAGGACTCAGTGGCTGGGG + Intronic
1095567754 12:43646414-43646436 TAAGAAGGAAACTCTGGCTGAGG - Intergenic
1096136408 12:49205468-49205490 CAAGGAGGGCAGATTGCCTGAGG + Intronic
1096272844 12:50180066-50180088 CGAGGAGGGCAGACTGACTGAGG + Intronic
1096579427 12:52574883-52574905 CAAGGAGGGCAGATTGCCTGAGG + Intergenic
1096595980 12:52695804-52695826 CAGGGTGGACACTCTGACTGGGG - Exonic
1096634542 12:52949869-52949891 AGAGGAGGAGACACTGGCTCTGG + Intronic
1096651109 12:53062370-53062392 CAAGGCGGACAGGCTGCCTGTGG - Exonic
1097246662 12:57611125-57611147 GAAGGAGGACTCAGTGGATGGGG - Intronic
1097299010 12:57998196-57998218 CAAGGAGGACCTAAAGGCTGGGG - Intergenic
1098049765 12:66441351-66441373 CAAGGAGGGGACTCTGCCTGAGG - Intronic
1104954073 12:132455204-132455226 CAAGGAGCAGACACTGCCAGGGG + Intergenic
1105505962 13:21009965-21009987 CGAGGTGGACAGACTGCCTGAGG + Intronic
1105699154 13:22922898-22922920 CAAGGAGGGAACACCGGCTAAGG + Intergenic
1105850898 13:24335747-24335769 CAAGGAGGGAACACCGGCTAAGG + Intergenic
1106006870 13:25778790-25778812 TAAGGAGGATACAGTGGCAGAGG - Intronic
1106820742 13:33462239-33462261 CAAGAAAGACACAATGGCAGTGG - Intergenic
1106990422 13:35412814-35412836 CAAGGAAGTCAGACTGCCTGAGG + Intronic
1107417664 13:40216489-40216511 CAAGGAAGTCAGACTGTCTGGGG - Intergenic
1108517165 13:51214369-51214391 CAGGAAGAACACTCTGGCTGTGG + Intergenic
1109442816 13:62397618-62397640 CAAGGAGGAAGCCCAGGCTGTGG + Intergenic
1112465592 13:99642042-99642064 CAAGGAGGACAGACACCCTGGGG + Intronic
1113025510 13:105937019-105937041 CAAGGCAGACACAGAGGCTGTGG - Intergenic
1113967498 13:114162384-114162406 GAGGGAGGAGACACTGGCTCAGG + Intergenic
1115294654 14:31812361-31812383 CAAGGAGGCAAGCCTGGCTGGGG - Intronic
1117150656 14:52884367-52884389 CAAGGTGGGCAGACTGCCTGAGG + Intronic
1117453069 14:55870955-55870977 GAAGGAGGACACAAAGGCTTAGG + Intergenic
1118819602 14:69336404-69336426 CAAAGAGGCCATGCTGGCTGGGG - Intronic
1119631721 14:76237746-76237768 AAAGGAGGACACCCAGGCAGGGG + Intronic
1119751242 14:77079066-77079088 CAAGCAAGACACCATGGCTGGGG + Intergenic
1120546163 14:85813974-85813996 CAAGTGGTACACACTGGCTAAGG + Intergenic
1122981390 14:105193779-105193801 CATGGAGCCCACAGTGGCTGGGG + Intergenic
1123955085 15:25326867-25326889 AAATGAGGACACTCTCGCTGAGG - Intergenic
1124386090 15:29209267-29209289 CAAGGTGGGCAGACTGCCTGAGG + Intronic
1125484453 15:40102678-40102700 ATGGGAGGACACAGTGGCTGTGG - Intronic
1127262279 15:57335117-57335139 CTAGTGGGACACACTGGGTGAGG + Intergenic
1127942973 15:63719367-63719389 CAAGGAGGCCAGTGTGGCTGGGG + Intronic
1132912892 16:2324730-2324752 CCAGGAGAACTCACTGCCTGGGG - Intronic
1134245377 16:12535792-12535814 CAAGGCTTACACAGTGGCTGCGG - Intronic
1135207178 16:20493240-20493262 CACGGAGGACAGGCTTGCTGGGG + Intergenic
1135211707 16:20530392-20530414 CACGGAGGACAGGCTTGCTGGGG - Intergenic
1137568323 16:49548151-49548173 CTTGGAGGACCCACTGGGTGAGG - Intronic
1137669542 16:50271395-50271417 CAAAGAGGACAGGCTGGGTGTGG - Intronic
1138002351 16:53294988-53295010 TAAGTAGGGCACTCTGGCTGAGG - Intronic
1138226943 16:55303991-55304013 CAAGCAGGACACAGTAGCAGGGG + Intergenic
1138439985 16:57028397-57028419 CCAGGAGGGCTCACTGACTGGGG + Intronic
1138528047 16:57620182-57620204 CAAGGGGGACAGGCTGGCAGTGG - Intronic
1138585153 16:57964505-57964527 CAAGGAGGAGGAAGTGGCTGTGG - Exonic
1139399971 16:66673736-66673758 CAAGAAGAGAACACTGGCTGAGG - Intronic
1139942205 16:70613385-70613407 CATGGCGGCCACACTGGATGGGG + Intronic
1140707518 16:77644401-77644423 CAAGTAGGACAAAAAGGCTGAGG - Intergenic
1140911337 16:79455783-79455805 CAAGGTGGGCAGACTGCCTGAGG + Intergenic
1142768700 17:2081241-2081263 CCAGGAAGAAACACTTGCTGGGG + Intronic
1143900438 17:10170386-10170408 CAAGGAGGTCAGTGTGGCTGGGG - Intronic
1144051057 17:11497443-11497465 CAAGCACAAGACACTGGCTGTGG + Intronic
1144464645 17:15487587-15487609 CAAGGAGGCTACAGTGGCTGGGG - Intronic
1144684146 17:17215154-17215176 CAAAAAGGACACTCTGCCTGGGG + Intronic
1144699283 17:17326339-17326361 CCAGGGGAACACACTGGCGGTGG - Intronic
1144714686 17:17425730-17425752 CACGGAGGACAGGCTTGCTGGGG + Intergenic
1145002908 17:19317976-19317998 GAAGGAGGTCACACTGGCCACGG + Intronic
1146568629 17:33934586-33934608 CAAGGAGGACACCCTGGAGGAGG + Intronic
1148003082 17:44401769-44401791 CAAGGTGGACAGACTGCTTGAGG + Intronic
1148754766 17:49967348-49967370 ATAGGAGAAAACACTGGCTGGGG - Intergenic
1150261474 17:63795562-63795584 CAAGGTGGAGAGACTGCCTGAGG - Intronic
1150880377 17:69018784-69018806 CAAGCAGGACACCTTGGCTTCGG + Intronic
1151807797 17:76417299-76417321 CAAGGAGGCCCCCATGGCTGGGG + Intronic
1152513489 17:80806216-80806238 CCAGGAGGATATACTGGCTCAGG - Intronic
1152677957 17:81651293-81651315 CTCTGGGGACACACTGGCTGTGG + Intronic
1152828168 17:82480443-82480465 CCAGGAGGCTCCACTGGCTGGGG + Intronic
1152858419 17:82679946-82679968 CAAGGCAGCCACAGTGGCTGTGG + Intronic
1152893950 17:82899107-82899129 CACTGAGGACACACGCGCTGCGG - Intronic
1152893964 17:82899269-82899291 CACTGAGGACACACGCGCTGAGG - Intronic
1152895273 17:82907306-82907328 CAAGGTGGTCACATTGGCAGGGG + Intronic
1156933868 18:42679053-42679075 CAAGGCGGACAGATTGCCTGAGG - Intergenic
1159997843 18:74983784-74983806 GAGAGAGGCCACACTGGCTGTGG + Intronic
1160085616 18:75774598-75774620 CAGGGAGGACCCAGAGGCTGTGG - Intergenic
1160117709 18:76097383-76097405 TGAGGAGGACACACTGCCTCCGG + Intergenic
1160757427 19:765020-765042 CAAGGAGGAGACACTGGCCTAGG - Intergenic
1161055550 19:2189037-2189059 CAAGGAGGGCAGAGTTGCTGCGG + Intronic
1161238304 19:3208604-3208626 CAGGGAGGACCAACTGGCCGTGG - Exonic
1161570459 19:5027771-5027793 CAAGGTGGGCAGACTGCCTGAGG - Intronic
1162235272 19:9304051-9304073 CAAGGTGGGCAGACTGCCTGAGG - Intronic
1162869312 19:13573488-13573510 CCAGAAGGCCACCCTGGCTGTGG - Intronic
1163348409 19:16759477-16759499 GAATGAGGACTCACTGGCCGGGG + Intronic
1163466271 19:17470151-17470173 CAAGGTGGACATGCTGGCTCTGG + Intronic
1163928155 19:20364684-20364706 CAGGGAAGTCAGACTGGCTGAGG - Intergenic
1164101735 19:22060716-22060738 CAAGGCGGGCAGATTGGCTGAGG - Intronic
1164560651 19:29289768-29289790 GATGGAGGAAACACTGGATGTGG + Intergenic
1164578551 19:29419996-29420018 CACGCAGCACCCACTGGCTGGGG + Intergenic
1164707657 19:30332344-30332366 CAAGAAGGAGACAAAGGCTGGGG - Intronic
1165122371 19:33568507-33568529 CAGGGAGGACAAAATGCCTGGGG - Intergenic
1165476604 19:36034275-36034297 CAAGGAGGCCAGTGTGGCTGGGG - Intergenic
1166535452 19:43571231-43571253 CAAGGAGGCCAGTATGGCTGGGG - Intronic
1167135457 19:47612877-47612899 AAAGGAGGGGACAGTGGCTGCGG - Intronic
1167259266 19:48449322-48449344 CGAGGAGGGCAGACTGCCTGAGG - Intronic
1167382482 19:49146551-49146573 CAAGGAGGACACACTGGCTGTGG + Intronic
1167395074 19:49223154-49223176 CAAGTAGGACAGGCTGGGTGCGG - Intergenic
924963977 2:58659-58681 CATGGAGGACAGGCTTGCTGGGG + Intergenic
925516201 2:4684995-4685017 AAAGGAGGTCACACTGGATTAGG + Intergenic
930151941 2:48068436-48068458 AAAGAAGGACACAGTGGATGTGG + Intergenic
930475349 2:51875148-51875170 GAGAGAGGACACAGTGGCTGGGG + Intergenic
931180476 2:59895280-59895302 TAAGGAGCACACACTGTTTGTGG - Intergenic
932660218 2:73645022-73645044 CCAGGAGGACACACCTGATGGGG + Intergenic
932666789 2:73704705-73704727 CCAGGAGGACACACCTGATGGGG + Intergenic
932668727 2:73718721-73718743 CCAGGAGGACACACCTGATGGGG + Intergenic
935127832 2:100239741-100239763 CAAGGAGGGCAGGTTGGCTGGGG + Intergenic
935295359 2:101644608-101644630 CAAGGTGGGCAGACTGCCTGAGG + Intergenic
936235013 2:110734975-110734997 CATGGAGTAAACACTGGTTGTGG + Intronic
937849485 2:126620127-126620149 CAAGCAGAACACACTGGATAAGG - Intergenic
937912902 2:127084821-127084843 TTAGGAGGCCACACTGACTGTGG + Intronic
938371621 2:130772157-130772179 CAAGCAGGAAACACTGGCCAGGG + Intergenic
939372924 2:141326310-141326332 CAAGGAGAAAACATTGCCTGAGG + Intronic
940390742 2:153130030-153130052 TAAGGAGGACTCAAAGGCTGTGG - Intergenic
941857385 2:170244972-170244994 CAATATGAACACACTGGCTGGGG + Intronic
943180066 2:184529957-184529979 CACGGAGGACAGGCTTGCTGGGG - Intergenic
943731778 2:191309628-191309650 CAAGGAGGACAGCGTGGCTGGGG - Intronic
943837622 2:192533421-192533443 GAAGGAGGACATACTGTCAGAGG - Intergenic
943993853 2:194734204-194734226 CAAGGAGGGCAGATTGCCTGAGG + Intergenic
944281365 2:197902110-197902132 CAAGGATGGCATACTGGCTGTGG + Intronic
945002727 2:205368790-205368812 CAAGGTAGACACAGTGCCTGAGG - Intronic
945459036 2:210083004-210083026 AGATGAGGACACACTGGATGAGG + Intronic
946980878 2:225213801-225213823 CAAGAGGGAAGCACTGGCTGTGG - Intergenic
947653109 2:231803937-231803959 CAAGGAGCAAACTCTGCCTGTGG - Intronic
948464574 2:238146026-238146048 CAGGGAGGACACCTGGGCTGTGG - Intronic
948476654 2:238225024-238225046 AAAGGAGGACAGACTCGGTGGGG - Intronic
948949426 2:241239426-241239448 GAAGGAGGCCAGACAGGCTGAGG + Intronic
1169456518 20:5757307-5757329 CAAGGTGGACAGACTGCTTGAGG - Intronic
1169481453 20:5985776-5985798 CAAGGAGGACACATCACCTGAGG - Intronic
1170316907 20:15052202-15052224 CAAGGAGCACACACAGTTTGAGG - Intronic
1171250084 20:23640080-23640102 GCAGGAGGACACACCGTCTGGGG - Intergenic
1171504413 20:25622178-25622200 TGTGGAGGACACACTGGATGTGG + Intronic
1173131458 20:40397962-40397984 CAAGGAGGCAACTCTGGCTGAGG - Intergenic
1173255280 20:41390226-41390248 CAGGGAGGTCAGGCTGGCTGGGG - Intergenic
1173587404 20:44193273-44193295 CAAGGTGGGCAGACTGCCTGAGG + Intergenic
1174109467 20:48188223-48188245 CAAGGAGGCCAGTTTGGCTGGGG - Intergenic
1175297893 20:57921839-57921861 CCGGGAGGACACCCTGGCTTTGG + Intergenic
1175403760 20:58714528-58714550 CCAGGAGGACACAGTGCCTGTGG - Intronic
1175403831 20:58714862-58714884 TATGGAGGACAGGCTGGCTGGGG - Intronic
1175936874 20:62518040-62518062 CAAGGAGACCTCACTGGCTGGGG - Intergenic
1176162539 20:63655141-63655163 CAGGGAGGACACAGCTGCTGTGG - Intergenic
1176993959 21:15532151-15532173 CAAGGAGGACTCAGTGCCTGAGG + Intergenic
1178873439 21:36394440-36394462 CAAGGTAGACAGACTGCCTGTGG - Intronic
1178885292 21:36480052-36480074 AGAGGAGGACACAGTCGCTGTGG - Exonic
1179362756 21:40727884-40727906 CAAGGAGGCCAGTGTGGCTGCGG - Intronic
1179392647 21:41008111-41008133 AAAGGAAGACACACTGGCATGGG + Intergenic
1179711186 21:43264092-43264114 GAAGGAAGACACACTGGGAGAGG + Intergenic
1180085845 21:45507497-45507519 CAGGGAGGGCACCCTGGCTCAGG + Intronic
1180594586 22:16964880-16964902 CAAGGAGTACATCCTGGGTGGGG + Intronic
1181546471 22:23605374-23605396 CTAGGAGGTGACTCTGGCTGAGG + Intergenic
1182793876 22:32976377-32976399 CACGGAGGAAAGACTGGCCGTGG + Intronic
1184338393 22:43869624-43869646 CAAGGAGGATAGATTGTCTGAGG + Intergenic
1184981107 22:48096634-48096656 TGAGGAGGAGACACTGGCTGAGG - Intergenic
1185315426 22:50176909-50176931 CAAAGAGGAGACACGGGCTGGGG - Intronic
950239961 3:11360276-11360298 CAAGGCGGGCAGACTGTCTGAGG - Intronic
950262778 3:11554452-11554474 CAAGGAGAACAAGCTGGCTTGGG + Intronic
950786019 3:15436571-15436593 AAAGGAGTACACACTTACTGAGG - Exonic
951906713 3:27714123-27714145 CAGGGAGGAGATACTGGCTCGGG - Intergenic
952656641 3:35794018-35794040 CAAGGTGGGAAAACTGGCTGAGG + Exonic
952704179 3:36360631-36360653 CAAGGCGGGCAAACTGCCTGAGG + Intergenic
952824592 3:37514392-37514414 AGAGGAGGACACAATGGCTGGGG + Intronic
953181158 3:40596596-40596618 TAAGGAGGACACACTCTCTGTGG - Intergenic
953472008 3:43175697-43175719 CAATGAGGACTCACAGGCTAAGG + Intergenic
954249244 3:49355482-49355504 CAAGGGGGACTCAAAGGCTGGGG + Intergenic
958801891 3:98765632-98765654 AAAGAAGGACTCACTGGCAGAGG - Intronic
959381492 3:105646182-105646204 CAAGGAGGACAGATCGCCTGAGG + Intergenic
962501275 3:135995703-135995725 CAAGGTGGGCAGACTGCCTGAGG - Intronic
962787085 3:138778521-138778543 CATGATGGACACATTGGCTGTGG - Intronic
963920953 3:150905026-150905048 AAAGGAGAACACACTGGCTTTGG + Intronic
964472467 3:157069839-157069861 CCAGGAGATCTCACTGGCTGGGG - Intergenic
965784559 3:172322181-172322203 CGAGGAGGGCTCATTGGCTGGGG + Intronic
968526131 4:1058377-1058399 CAGGGAGGAGACGCTGCCTGTGG + Intronic
968761581 4:2445024-2445046 CAAGGTGGACCCAATCGCTGCGG + Intronic
968980186 4:3843781-3843803 CACAGAGCACACACTGGCTGCGG + Intergenic
969235152 4:5860296-5860318 CCAGGAGAACAGAGTGGCTGGGG + Intronic
969306869 4:6330869-6330891 CCAGGAGGACACGGGGGCTGGGG - Intronic
970462661 4:16290904-16290926 CAAGCAGGACAAGCTGGCAGAGG + Intergenic
970543523 4:17103503-17103525 CATGGTGGAGACACAGGCTGTGG + Intergenic
971560753 4:28077353-28077375 CAAGGAGGCAAGCCTGGCTGGGG + Intergenic
973238979 4:47936915-47936937 CAAGGAAGGCAAACTCGCTGTGG - Exonic
974181215 4:58386674-58386696 ACAGGACAACACACTGGCTGTGG - Intergenic
975654625 4:76629301-76629323 CAAGAAGGCCACTGTGGCTGGGG + Intronic
977811546 4:101361263-101361285 CAAGGGGGGCAGACTGCCTGAGG + Intergenic
978567086 4:110094616-110094638 CAAGGAGGCAAGAGTGGCTGAGG + Intronic
979263349 4:118673191-118673213 CCAGGGGGCCACACTGACTGAGG - Intergenic
981486754 4:145294951-145294973 CAAGGAGGACAGTGTGACTGGGG - Intergenic
983772515 4:171569528-171569550 CAGGGAGGACAGGCTGACTGAGG + Intergenic
984195139 4:176650106-176650128 CAATGAGGTCACACTGGAGGAGG - Intergenic
984562020 4:181282085-181282107 CTAAGAGGACATGCTGGCTGCGG + Intergenic
984682840 4:182630494-182630516 CAAGGAGAACACACGGGCACAGG + Intronic
985260546 4:188110791-188110813 AAAGGAGGATGGACTGGCTGAGG - Intergenic
985773160 5:1825508-1825530 AGAGGGGGACACACTGCCTGGGG - Intergenic
986035611 5:3934127-3934149 CAAGGATGACACATTTGCTGAGG - Intergenic
986287731 5:6372366-6372388 CAATGAGGACAGAGGGGCTGAGG + Exonic
987302212 5:16606926-16606948 CAAGGAGGCCATTGTGGCTGGGG - Intronic
988706373 5:33729796-33729818 AAAGGAAGAGACACTGGCAGTGG + Intronic
990564164 5:57012238-57012260 CAGGGAGGACAGTCTGGCAGTGG + Intergenic
990940719 5:61200537-61200559 CAAGGAGGCCCCACTGGTTGAGG + Intergenic
993105475 5:83595693-83595715 CAAGGTGGACACACTGGCAGTGG + Intergenic
994995580 5:107058258-107058280 CAAGGTGGGCACAGTGGGTGTGG + Intergenic
996187217 5:120491774-120491796 CAAGGCGGGCAGACTGCCTGAGG - Intronic
997864363 5:137448013-137448035 CAAGGTGGACAGATTGCCTGAGG + Intronic
997894172 5:137701278-137701300 CAAGGAGGACAGATCGTCTGAGG - Intronic
999176246 5:149633501-149633523 CAAGGAGGACTGACCTGCTGGGG + Exonic
999224571 5:150010425-150010447 CTAGGAGCACATCCTGGCTGAGG - Exonic
999280180 5:150360043-150360065 CAAGGAGGACACTTTGCCTGAGG + Intronic
1000286532 5:159831341-159831363 CAAAGAGGAAACATTTGCTGAGG - Intergenic
1001141250 5:169145813-169145835 CAAGGCGGACAGATTGCCTGAGG + Intronic
1002066677 5:176655307-176655329 CCAGGAGCAGACAATGGCTGCGG - Intronic
1002534676 5:179869726-179869748 CAAGTGGGAGACCCTGGCTGGGG + Intronic
1003516687 6:6824182-6824204 CATAGAAGACACACTGGCAGGGG + Intergenic
1004118968 6:12800651-12800673 CAAGGAGGACAGATTGCTTGAGG + Intronic
1005522215 6:26611388-26611410 TAAGCAGGACACTCTGACTGAGG + Intergenic
1005690281 6:28298225-28298247 CAAGCAGGACAGACTGGATCAGG - Intronic
1006183542 6:32167876-32167898 CATGGCAGACACAGTGGCTGTGG - Intronic
1006284495 6:33082111-33082133 GAAGGTGGACACACTGGGTGGGG + Intronic
1006400350 6:33813888-33813910 CAAGGAGGCCAAACTCACTGAGG + Intergenic
1008193237 6:48486139-48486161 GAAGCAGGACAGACTGGATGTGG + Intergenic
1008448559 6:51622115-51622137 AAAGGAGGACTCACTGGTTCTGG + Intronic
1009916785 6:70005947-70005969 AAAGCCTGACACACTGGCTGTGG - Intronic
1011730791 6:90261161-90261183 AAAGGAGGAAAGACTGGGTGTGG - Intronic
1013296630 6:108763602-108763624 CAAGGAGGAGACGGTGGCGGTGG - Intergenic
1018164363 6:161079343-161079365 CAAGGTGGACAGATTGCCTGAGG + Intronic
1018232288 6:161687152-161687174 CAAGGCGGGCAGACTGCCTGAGG + Intronic
1018321233 6:162611591-162611613 CAAGAAGGACACACACACTGAGG + Intronic
1018679560 6:166252859-166252881 CAAGCACGGCACACTGGCTGGGG + Intergenic
1019194399 6:170272747-170272769 CAGGGAGGGAACGCTGGCTGGGG + Intergenic
1019292582 7:257835-257857 CAGGGTGGACCCACTGCCTGGGG + Intronic
1019292606 7:257908-257930 CTGGGTGGACACACTGCCTGGGG + Intronic
1019292680 7:258161-258183 CAGGGTGGACCCACTGCCTGAGG + Intronic
1019292691 7:258197-258219 CAGGGTGGACCCACTGACTGGGG + Intronic
1019292712 7:258269-258291 CAGGGTGGACCCACTGCCTGGGG + Intronic
1019292735 7:258341-258363 CAGGGTGGACCCACTGCCTGAGG + Intronic
1019391625 7:790726-790748 CAAGGAGCACAGGCTGGGTGCGG + Intergenic
1019938062 7:4269257-4269279 CAGGGGGGTCTCACTGGCTGAGG - Intergenic
1020023056 7:4880594-4880616 CAGGCAGCACACACTGGCAGAGG + Intronic
1021493829 7:21250203-21250225 CAAGGAGCAGACACTTGCAGGGG + Intergenic
1023167598 7:37358115-37358137 CAGGGAGTACAGACAGGCTGTGG - Intronic
1023315705 7:38934272-38934294 CAAGCACGCCACACTGGTTGTGG - Intergenic
1023961295 7:44928442-44928464 GAAGGAGCAGACTCTGGCTGGGG + Intergenic
1023975703 7:45028267-45028289 ACAGGAGGCCACACTGGCGGTGG - Intronic
1024546752 7:50528815-50528837 CAAGCAGGAGACAGTGGCGGTGG - Intronic
1026155555 7:67822725-67822747 CAGGCAGGACAGACTGGGTGGGG - Intergenic
1026818320 7:73529578-73529600 CAAGGCGGGCATACTGCCTGAGG - Intergenic
1027889629 7:83954527-83954549 GAAGTAGGACACACAGCCTGAGG - Intergenic
1028566305 7:92235230-92235252 CAAGGAGGGCAGATTGCCTGAGG - Intronic
1029295701 7:99538743-99538765 CATAGAGGAAAAACTGGCTGAGG + Intergenic
1029474899 7:100777275-100777297 CAAGGCGGCCACATTGCCTGAGG - Intronic
1029630370 7:101746460-101746482 GAAGGAGGAGGCACTGGCTGGGG - Intergenic
1032183753 7:129705521-129705543 CAAGGAGAGCAGACTGCCTGAGG - Intronic
1032398317 7:131606657-131606679 GGAGGAGGACACCCTGGCTGCGG - Intergenic
1032505115 7:132428576-132428598 CAAGAAGGAAACACTCACTGAGG - Intronic
1032574166 7:133035005-133035027 CAATGAGGACACACTCTCTGTGG - Intronic
1033145871 7:138869558-138869580 CACGGAGGGCACGCTGGCCGTGG + Exonic
1034562640 7:151891225-151891247 CCAGGAGCACGCACTTGCTGTGG - Intergenic
1035339387 7:158150834-158150856 AAAGGAGGCCAGAGTGGCTGGGG - Intronic
1035439715 7:158886364-158886386 CAAGGTGGGCAGACTGCCTGAGG - Intronic
1036943221 8:13070827-13070849 AAATGAGGTCACACTGGATGGGG - Intergenic
1038212487 8:25532408-25532430 CAATGAGCACACACTGACTCAGG - Intergenic
1038644412 8:29350675-29350697 CGAGGAGAAAACTCTGGCTGGGG - Intergenic
1040915223 8:52562194-52562216 CCAGTAGGACACACTGTCAGGGG + Intronic
1042621123 8:70705574-70705596 CAAGGAGGCCATACTGGAAGTGG + Intronic
1042694988 8:71546734-71546756 CCAGGAGGGCAGACTGCCTGAGG - Intronic
1044008595 8:86965472-86965494 TAAGGAGGACAGGCTTGCTGGGG - Intronic
1045624741 8:104030586-104030608 CATGGAGGTCACTTTGGCTGGGG - Intronic
1047309795 8:123682654-123682676 GCAGGGGGACACACAGGCTGGGG - Intronic
1049642952 8:143723590-143723612 CAAGCAGGACAGAGAGGCTGTGG + Intergenic
1050267219 9:3903910-3903932 CAAGGAGGTCAGCATGGCTGGGG + Intronic
1050311146 9:4354390-4354412 CAAGGAGGTGACTCTGGCTAGGG - Intergenic
1053276881 9:36789930-36789952 AAAGGAGGACACTGAGGCTGAGG - Intergenic
1055330842 9:75181875-75181897 CTAGGAGCAAAGACTGGCTGGGG + Intergenic
1055421026 9:76142483-76142505 CAAGGAGGCCATCCTAGCTGGGG + Intronic
1055583585 9:77732926-77732948 CAAAGAGGCCACAAAGGCTGAGG + Intronic
1056236690 9:84601537-84601559 CAGGAAGGAAACATTGGCTGGGG + Intergenic
1056738375 9:89229598-89229620 CAAGGAGGGCAGATTAGCTGAGG + Intergenic
1057693312 9:97306495-97306517 CAAGGAGGCCCTACTGGCTTTGG - Intergenic
1058144712 9:101398872-101398894 CAAGGAGGAGGAACTGGCAGCGG + Intronic
1058253584 9:102732864-102732886 CAAGGAGAACACAAAAGCTGAGG + Intergenic
1058543595 9:106037615-106037637 CCATGACGACACACTAGCTGTGG + Intergenic
1059002555 9:110365337-110365359 GAAGGAGGAGTCAATGGCTGAGG + Exonic
1060225315 9:121786715-121786737 CAGAGAGAACACACAGGCTGGGG - Intergenic
1060442554 9:123655311-123655333 CACGGAGGAAGCAATGGCTGAGG + Intronic
1060777531 9:126386603-126386625 CATCAAGGACACACTGCCTGTGG + Exonic
1061090205 9:128421737-128421759 CAGGGAGGAGTCCCTGGCTGAGG + Intronic
1061093892 9:128443251-128443273 CAATGTGGAGAGACTGGCTGGGG - Intergenic
1061189320 9:129072332-129072354 CAAGGTGGGCAGCCTGGCTGTGG + Intergenic
1061592589 9:131607540-131607562 CAAGCAGGATGCACTGGCTGAGG + Intronic
1061896724 9:133652163-133652185 GAGGGAGGACACAGTGGCCGGGG + Intronic
1062018021 9:134301530-134301552 CAGGGAGGGGACACTGGCAGGGG - Intergenic
1062048930 9:134437418-134437440 CAAGGAGAAGACTCAGGCTGGGG - Intronic
1185470335 X:377848-377870 CACGGCGGACCCACTGGGTGTGG - Intronic
1186024775 X:5297367-5297389 TAGGGAGGTCACTCTGGCTGGGG - Intergenic
1187531404 X:20100240-20100262 AAAGGAGGATGCACTGCCTGGGG + Intronic
1187811646 X:23185282-23185304 CAAGGAGGCCAGTGTGGCTGTGG + Intergenic
1189811013 X:44780712-44780734 CAAGGTGGGCAGACTGCCTGAGG - Intergenic
1189991404 X:46598663-46598685 CAAGGAGGAGTCACAGGCAGAGG + Intergenic
1190455116 X:50619435-50619457 CAAGGAGGATACACAGGGAGGGG + Intronic
1192090325 X:68148286-68148308 CAAGGAGAACAGACTAGCTTTGG - Intronic
1192689609 X:73348652-73348674 CAAGGAAGTCGCCCTGGCTGAGG + Intergenic
1193468569 X:81874177-81874199 CATGGAGGACAGGCTTGCTGGGG - Intergenic
1194377611 X:93154307-93154329 CATGGAGGCCACACTGCCAGTGG - Intergenic
1195789276 X:108564302-108564324 CTAGGAGGATACACAGCCTGAGG - Intronic
1196928549 X:120658479-120658501 CAAGGAGGACAAACTGTCTCAGG + Intergenic
1197519455 X:127479083-127479105 CAAGGGGGGCAGATTGGCTGAGG + Intergenic
1199511792 X:148630665-148630687 AAAGGAGGGCAGGCTGGCTGGGG - Intronic
1199685203 X:150259216-150259238 CAAGAATGACACAATGGCTTAGG - Intergenic
1199853859 X:151743985-151744007 TAAGGAGGGCAAACTGGCAGTGG + Exonic
1200296147 X:154922749-154922771 CAAGGAGGTCAGTGTGGCTGAGG + Intronic
1200699410 Y:6389436-6389458 CAGGGAGTAAACACTGGCTTGGG - Intergenic
1200710145 Y:6475990-6476012 CAAGGAGAACACAACGACTGAGG - Intergenic
1201023970 Y:9688718-9688740 CAAGGAGAACACAACGACTGAGG + Intergenic
1201034701 Y:9775262-9775284 CAGGGAGTAAACACTGGCTTGGG + Intergenic
1201304207 Y:12536906-12536928 CAAAGAGCACCCACTGGGTGAGG + Intergenic
1202042452 Y:20699396-20699418 CTTGGATGACACAGTGGCTGTGG + Intergenic
1202073363 Y:21015256-21015278 CAGGGAGGACAGGCTTGCTGAGG - Intergenic
1202078063 Y:21057110-21057132 CAGGGAGGACAGGCTTGCTGAGG - Intergenic