ID: 1167383738

View in Genome Browser
Species Human (GRCh38)
Location 19:49152437-49152459
Sequence AGGGTGCAGGGGTGGGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 858
Summary {0: 1, 1: 1, 2: 4, 3: 69, 4: 783}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167383738 Original CRISPR AGGGTGCAGGGGTGGGCCAG GGG (reversed) Intronic
900001492 1:17212-17234 AGGTGGGAGGGGTGGGACAGAGG - Intergenic
900003595 1:29430-29452 AGGGCGCAGTGGAGGGCGAGCGG - Intergenic
900021211 1:187734-187756 AGGTGGGAGGGGTGGGACAGAGG - Intergenic
900023313 1:199946-199968 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
900097684 1:946728-946750 AGTGGGCAGGGTTGGCCCAGAGG - Intronic
900112700 1:1015251-1015273 AGGGTGCATGGGTGGGGGAAGGG - Intergenic
900329142 1:2125517-2125539 GGGGAGCAGGGGTGGGACAAGGG - Intronic
900386921 1:2414808-2414830 AGGGTTCTGGGGTGGGGCATGGG + Intergenic
900677198 1:3895080-3895102 AGGGAGGAGAGGTGGGGCAGTGG - Intronic
900993090 1:6106869-6106891 GGGGTGGAGGGGTGGAGCAGTGG + Intronic
901178066 1:7319167-7319189 AAGGTGCAGGGGTGAGAAAGTGG + Intronic
901334679 1:8439190-8439212 AGAGAGCAGAGGTGGGCAAGTGG - Intronic
901635513 1:10668458-10668480 AGGAGGCAGGCTTGGGCCAGAGG + Intronic
901768607 1:11519319-11519341 AGGGGACAGGGGTGAACCAGAGG - Intronic
902112374 1:14093115-14093137 AGGATGCAGAGGTGGGTCAGAGG - Intergenic
902450011 1:16490986-16491008 TGGGTGCCAGGGTGGGGCAGGGG - Intergenic
902472191 1:16656850-16656872 TGGGTGCCAGGGTGGGGCAGAGG - Intergenic
902486612 1:16750596-16750618 TGGGTGCCAGGGTGGGGCAGAGG + Intronic
902509908 1:16960915-16960937 AGGCTGCAGAGCTGGGCCTGCGG + Exonic
902533022 1:17102666-17102688 AGGCTGCAGGGGAGAGGCAGGGG + Intronic
902561921 1:17282951-17282973 AAGGTGCAGTGGAGGCCCAGCGG - Exonic
902822546 1:18952003-18952025 AGAGGGCAGCGGTTGGCCAGAGG + Intronic
902877542 1:19349848-19349870 AGTGAGCAGGGGCGGGCAAGGGG - Intronic
903768451 1:25749437-25749459 AGGGGGCAGGGATGGGCCTGGGG + Intronic
904033524 1:27547523-27547545 AGGGCCACGGGGTGGGCCAGGGG + Exonic
904465588 1:30705377-30705399 AGGCTGCCGGGCTGGGCAAGGGG + Intergenic
904750110 1:32736727-32736749 AGGGTGCAGGGGGAGGAAAGAGG - Intergenic
904940813 1:34164238-34164260 AGGGTGCAGGTGGGGGCTGGAGG - Intronic
905168646 1:36098004-36098026 AGGGTGCCGTGCTGGGCAAGGGG - Exonic
905168890 1:36098651-36098673 GGGGGACAGGGGTGAGCCAGGGG - Exonic
905293235 1:36937599-36937621 AGGGAGCAGCGGTGGAGCAGAGG + Intronic
905402568 1:37714402-37714424 AGGCTGCAGGTGTGGGCCAAAGG - Intronic
905647036 1:39632270-39632292 AGTGTGCCGGGGTGGGGGAGGGG - Intronic
905857527 1:41323830-41323852 GGGGTGCTGGGGTAGGGCAGCGG - Intergenic
905868463 1:41389235-41389257 AGGATGCAGGGGCGAGCCTGTGG - Intergenic
905869305 1:41394097-41394119 AGGGTGGGGGGATGGGGCAGAGG + Intergenic
905885770 1:41491088-41491110 AGGGTGTGGGGGTGAGTCAGAGG + Intergenic
906297445 1:44657946-44657968 AGGTTGCAGGGTTGGGGGAGGGG - Intronic
906641562 1:47444015-47444037 AGGGAGGAGGGGTGGGCCTGGGG - Intergenic
907053031 1:51342586-51342608 AGGGTGGTGTGGTGGGCGAGGGG + Intronic
907483015 1:54757708-54757730 TGGGGGCAGGGGTGGGCTGGGGG + Exonic
908622257 1:65997141-65997163 GGGGGGCGGGGGTGGGTCAGGGG - Intronic
909498672 1:76309131-76309153 AGGGTGCTGTGGGAGGCCAGAGG - Intronic
910359838 1:86404543-86404565 AGGGTGGAGGGGTGGGGAGGGGG + Intergenic
910660030 1:89661861-89661883 AGGGTGAAGGCTTGGACCAGAGG + Intronic
911114725 1:94235878-94235900 AGGGGGCATGCGTGGGGCAGCGG - Intronic
912753622 1:112306116-112306138 AGGGTGCAGGGTGGGATCAGAGG + Intergenic
912755433 1:112321253-112321275 AGGGAAGAGGGGTGGGCCACAGG - Intergenic
912878894 1:113390186-113390208 AGGGCGCAGAGGAGGGGCAGGGG - Intergenic
912910930 1:113758943-113758965 TGGGTGCGGGGGAGGGGCAGGGG + Intronic
912951461 1:114123426-114123448 TGGGTGCAGGGGTGGCTCAAGGG + Intronic
914716242 1:150257346-150257368 AGGGTGCAGGGGAGGGGTGGAGG - Exonic
914947228 1:152078593-152078615 ACGGTGCAGGGGCTGGGCAGAGG + Intergenic
915130131 1:153690042-153690064 AGGGCGAGGGGCTGGGCCAGGGG - Intronic
915278734 1:154807942-154807964 AGAGTACAGGGTTGGGCTAGAGG - Intronic
915436509 1:155910922-155910944 AGGGTGCAGTGGTGAGCAAGAGG - Intronic
915462582 1:156079073-156079095 AGGTTGGAGGGTTGGGGCAGAGG - Intronic
915473673 1:156139971-156139993 GGGGTGGAGGGGTGTGGCAGTGG + Exonic
915518513 1:156428092-156428114 AGGGTGGAGGGAGGAGCCAGAGG - Intronic
917309191 1:173660467-173660489 AGGAGGCAGGGGTGGGACATTGG - Intronic
917536015 1:175875202-175875224 TAGGTGCAGGACTGGGCCAGGGG + Intergenic
918675912 1:187285924-187285946 AGGATACAGGGGTGGGAGAGAGG - Intergenic
919899296 1:202032241-202032263 TGGGTGCAGGGGTGAGACATTGG - Intergenic
919972955 1:202592391-202592413 AGGAGGCAGGGGTGGGGCTGGGG + Exonic
920091460 1:203455911-203455933 GGGGCGCAGGGTGGGGCCAGAGG + Intergenic
920278947 1:204828998-204829020 AGGGTGTTGGGGTGGGCAGGGGG - Intronic
920697475 1:208192226-208192248 AGGGCCCAGAGGTGGGCCAGAGG - Intronic
921007864 1:211112145-211112167 ACGGTGCAGTGGCGGGGCAGAGG - Intronic
921646164 1:217620806-217620828 AAGGGGTAGGAGTGGGCCAGCGG - Intronic
921936426 1:220800976-220800998 ATGGTGCAGGGCTGGGTCAAGGG - Intronic
922718595 1:227889191-227889213 TGGGTGCATGGGTAGGGCAGGGG - Intergenic
922801809 1:228367966-228367988 AGGGTGCATGGCTGGGGCAGTGG - Intronic
923553250 1:234980707-234980729 AGGGGTCAAGGGAGGGCCAGCGG + Intergenic
923647481 1:235838971-235838993 AGGGCGCAGGGGTGGGGGATAGG - Intronic
923845051 1:237720667-237720689 AGGGTGCAGGGGATCCCCAGGGG + Intronic
924582077 1:245331226-245331248 AGGGTGCACGTGCGGACCAGAGG + Intronic
924608360 1:245554079-245554101 AGGGGACAGGGGTGGGACATGGG - Intronic
1062958264 10:1554240-1554262 CAGGGGCAGGGGTGGGCCTGTGG + Intronic
1063141474 10:3259951-3259973 AGGGTGGACGGCTGGCCCAGGGG + Intergenic
1063372542 10:5531277-5531299 GGGGTCCAGTGCTGGGCCAGAGG - Intergenic
1063392411 10:5659179-5659201 AGGGTGCAGGGATTGGGGAGGGG - Intronic
1063457125 10:6191707-6191729 AGTGGACAGCGGTGGGCCAGAGG - Intronic
1063474701 10:6318200-6318222 TGGGTGCATGGATGGGCAAGGGG - Intergenic
1063881567 10:10537663-10537685 AGCGTGAGGGTGTGGGCCAGTGG - Intergenic
1064179232 10:13100318-13100340 GGGCTGCAGCGGTGGGCGAGGGG + Intronic
1065441274 10:25755912-25755934 ACAGTGCAGTGGTGGGCCAAAGG - Intergenic
1065816492 10:29487636-29487658 TGGGTGCAGGAGGTGGCCAGGGG - Intronic
1065824585 10:29558156-29558178 AGAGTGCAGTGCTGGGCTAGTGG - Intronic
1065945352 10:30601045-30601067 GGTGTGCAGGGCTGGGACAGAGG + Intergenic
1065956373 10:30697019-30697041 TGGGTGCAGGAGGTGGCCAGGGG + Intergenic
1065968151 10:30785234-30785256 GCGGTGCAGGGGTGGGTGAGTGG + Intergenic
1065978338 10:30864018-30864040 ATAGGGCAGGGGTGGGACAGAGG - Intronic
1066025998 10:31361595-31361617 ACGGTGCAGGGGCTGGGCAGAGG + Intronic
1066432177 10:35362776-35362798 AGGGTGTGGGGGCCGGCCAGAGG + Intronic
1067078960 10:43203122-43203144 GGGGTCCAGGGTGGGGCCAGGGG - Intronic
1067109700 10:43391536-43391558 AGGGTGCTGGGGTAGGACAGTGG - Intronic
1067461546 10:46461998-46462020 ATGGTGCGGTGGTGAGCCAGTGG + Exonic
1067474439 10:46556652-46556674 CGGGTACAGGGAGGGGCCAGCGG + Intergenic
1067625648 10:47922603-47922625 ATGGTGCGGTGGTGAGCCAGTGG - Intergenic
1067740200 10:48889759-48889781 GGATTGCAGGGCTGGGCCAGCGG + Intronic
1067786511 10:49253471-49253493 AGGGTGCAGGGGTGGCAGACAGG - Intergenic
1067786569 10:49254708-49254730 AGGGTGCAGGGGTGGCAGATTGG - Intergenic
1067877606 10:50019381-50019403 GGGGTGCAGGCCTGGGGCAGTGG - Intergenic
1068178121 10:53487716-53487738 ATGGCGCAGGGCGGGGCCAGGGG + Intergenic
1068679413 10:59803596-59803618 AGGGTGGAGTGGGTGGCCAGTGG - Intronic
1069521347 10:69124125-69124147 CGGGTGCGGGGGTGGGGGAGAGG + Exonic
1069607287 10:69747695-69747717 GGGGTGCAAGGGGTGGCCAGGGG + Intergenic
1069707791 10:70469561-70469583 AGCAGGCAGGGGTGGCCCAGGGG - Intergenic
1070250343 10:74767605-74767627 AGGGAGCAGGGAAGAGCCAGAGG + Intergenic
1070364564 10:75723762-75723784 ATGGTGTAGCGGTGGGACAGTGG + Intronic
1071299409 10:84245188-84245210 GGGGTGCAGCGGGGGCCCAGTGG + Intronic
1071434584 10:85635407-85635429 AGGGGGCAGGGGAGGGCAGGGGG - Intronic
1071477377 10:86036391-86036413 AGGGTGCAGGGTTGGGCATTTGG - Intronic
1071527419 10:86366525-86366547 AGGGCGCAGGGGCGGGCGCGCGG - Intergenic
1071718227 10:88118167-88118189 AAGATGCAGAGGTGGTCCAGAGG + Intergenic
1072728160 10:97827546-97827568 AGGGTGCTGGCAAGGGCCAGGGG - Intergenic
1072805136 10:98419210-98419232 AGAGTGCAGGGTGGGGGCAGGGG + Intronic
1073176290 10:101559581-101559603 AGGGAGAAGGGGGTGGCCAGGGG - Intergenic
1073569434 10:104564136-104564158 AGAGTGCAGCGGTGGGGCATTGG + Intergenic
1073606054 10:104896594-104896616 AGTGGGCAGGGGTCAGCCAGTGG + Intronic
1074275654 10:111999429-111999451 AGGGTGCATGGGTCAGACAGGGG + Intergenic
1074783763 10:116820983-116821005 GGGGTGCAGGGGGAGGCCATAGG - Intergenic
1074859761 10:117501537-117501559 AGAGTGGAGGGGGCGGCCAGGGG + Intergenic
1075091690 10:119447372-119447394 AGGGTGCAGAGATGGGTCAAGGG - Intronic
1075413188 10:122244169-122244191 AGGGAGCAGGGGTGGGGATGGGG - Intronic
1075719673 10:124577326-124577348 AGGCTGTATGGGTGGGCCAGGGG - Intronic
1075936117 10:126342912-126342934 AGGGTGGAGGGGTGGGGCATGGG + Intronic
1076005346 10:126944311-126944333 AGGGTGCAGGGCTGTGCCCGTGG + Intronic
1076398744 10:130162798-130162820 AGGCCGCAGGGGTGGGCCTGAGG - Intronic
1076670374 10:132117654-132117676 AGGGTGCAGGCGTGGGCTCGGGG + Intronic
1076738186 10:132468008-132468030 AAGGTGCTGGGTGGGGCCAGGGG + Intergenic
1077220449 11:1413303-1413325 GGGTGGGAGGGGTGGGCCAGAGG - Intronic
1077390454 11:2298615-2298637 GGGGTGGAGGAGTGGGGCAGAGG - Intronic
1077607151 11:3620058-3620080 ATGGTGCAGGGGCAGGACAGAGG + Intergenic
1077893471 11:6436721-6436743 AGGGAGCAAGGGAGAGCCAGAGG + Intronic
1079383327 11:19958009-19958031 AGGATGCAGGGGTGGGAGGGAGG - Intronic
1080646267 11:34190241-34190263 GCGGGGCAGGGGTGGGGCAGGGG - Intronic
1080979166 11:37379360-37379382 AGGGTGGTGGGGTGTGTCAGGGG + Intergenic
1081811926 11:45918886-45918908 TGGGTGGAGCCGTGGGCCAGTGG + Intergenic
1083266345 11:61548579-61548601 AGAGCGCTGGGGTGGGCCTGGGG + Intronic
1083601935 11:63954211-63954233 AGGGTGCAGGAGGTGGACAGTGG - Intronic
1084113962 11:67031111-67031133 AGGGGGCAGGGTGGGGGCAGGGG - Intronic
1084329593 11:68422849-68422871 AGGGTGCAGGGGCGGGTGAGTGG - Intronic
1084740064 11:71133625-71133647 AGAGTGGAGGGGTGGTCTAGGGG + Intronic
1085442452 11:76577250-76577272 AGGGGGCAGGAATGAGCCAGGGG - Intergenic
1085448650 11:76617506-76617528 GGGGTGGAGGGGTGGGTGAGAGG + Intergenic
1085607544 11:77915623-77915645 TGGGTGCAGGGGTGGGAGTGAGG - Intronic
1086598193 11:88600283-88600305 AGGGGGAAGGGGTGGGGGAGAGG - Intronic
1088704585 11:112450394-112450416 AGAGGGCAGGGGTGGACCTGGGG - Intergenic
1088741832 11:112773878-112773900 GGAGAGCAAGGGTGGGCCAGAGG - Intergenic
1088906991 11:114162564-114162586 AGGGTGCATGGATTGGCCATGGG - Intronic
1089319287 11:117613951-117613973 TGGCTGCTGGGGTGGGGCAGGGG + Intronic
1089365178 11:117917134-117917156 AGGGTGCAGGGGTGGGTTCTGGG - Intronic
1089606005 11:119641680-119641702 AGAGTGCAGGGGAAGTCCAGAGG - Intronic
1089828002 11:121296361-121296383 AGGGTGATGGGGTGGAGCAGAGG - Intronic
1089966084 11:122655968-122655990 AGGGAGTCGGGCTGGGCCAGGGG - Exonic
1090077379 11:123587829-123587851 AGGGTGTTGGGGTTGGGCAGCGG + Intronic
1090234719 11:125139137-125139159 GGGGTGCAGCGGGGGGCCTGAGG - Intergenic
1090664600 11:128906063-128906085 AGGGGGCAGGGCTGGGAAAGGGG - Intronic
1091207783 11:133833084-133833106 AGGGTGCGGGGGTGAGGGAGGGG + Intergenic
1091279680 11:134374790-134374812 AGGGTGGAGGGGCGTGTCAGCGG + Intronic
1091374577 12:17327-17349 AGGTGGGAGGGGTGGGACAGAGG - Intergenic
1091377012 12:31484-31506 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
1092259786 12:6946665-6946687 AGGGGGCGGGGCTGAGCCAGCGG - Intronic
1092664844 12:10784402-10784424 AGGCTGCAGGGTTGGGGAAGGGG + Intergenic
1093755838 12:22850913-22850935 AGTGGGCAGGGGTGGGCCACAGG + Intergenic
1093809551 12:23474856-23474878 AGGTTGCATGAGTGTGCCAGTGG - Intergenic
1093894465 12:24561803-24561825 AAGGTTAGGGGGTGGGCCAGGGG + Intergenic
1094159732 12:27377885-27377907 AGGGTGAATGGTTGGGGCAGGGG + Intronic
1094555698 12:31497816-31497838 AGGGGGCAGGGAGGGGCAAGGGG + Intronic
1094555731 12:31497878-31497900 AGGGGGCAGGGAGGGGCAAGGGG + Intronic
1094841375 12:34343997-34344019 GAGCCGCAGGGGTGGGCCAGGGG - Intergenic
1095497559 12:42801288-42801310 AGGGTGTAGGGGTGGGGATGGGG + Intergenic
1095950109 12:47777211-47777233 TGGATGCTGGAGTGGGCCAGAGG - Intronic
1095966714 12:47872658-47872680 AGAGGGAAGGGCTGGGCCAGGGG - Intronic
1096122098 12:49094834-49094856 AGGGCGGAGGGCGGGGCCAGGGG - Intergenic
1096542116 12:52313731-52313753 ATGGGGGAAGGGTGGGCCAGGGG + Intergenic
1098301133 12:69055238-69055260 AGGAGGCCGGGGTGGGGCAGGGG - Intergenic
1099684436 12:85866619-85866641 GGGGTGGAGGGGTGGGGCTGAGG - Intergenic
1100575616 12:95889440-95889462 TGGGGGCAGGGGTGGGGTAGAGG - Intronic
1101254634 12:102965324-102965346 AGGTTGCGGGGGTGGGAGAGAGG + Intergenic
1101356039 12:103978369-103978391 AGGTTCCAGGGGTGGGAGAGTGG + Intronic
1101995766 12:109523885-109523907 AGGGTGCAGACATGGCCCAGGGG - Intronic
1102688844 12:114744697-114744719 AGATTCCAGGGGTCGGCCAGAGG + Intergenic
1103331856 12:120159786-120159808 TGGCTGCAGGGATGGCCCAGGGG - Intronic
1103587700 12:121968394-121968416 AGGGAGCAGGGGTGAGCCCAAGG - Intronic
1103624319 12:122206678-122206700 AGGGTGGGGGGATGGGCTAGGGG + Exonic
1103907828 12:124336302-124336324 AGGGAGCAGGGATGGGGCTGCGG - Intronic
1103999151 12:124849342-124849364 AGGCTGCAGGGGTGTGCCGTGGG - Intronic
1104108874 12:125687824-125687846 AGGGTGCAGAGGAAGGCAAGGGG + Intergenic
1104387173 12:128361063-128361085 ATGGTGCAGGAGTTGGGCAGGGG + Intronic
1104670124 12:130674770-130674792 AGGGTGCAGGGGCGGGGGTGGGG - Intronic
1104729058 12:131095014-131095036 AGGGTACAGGGGAGGGCCCTGGG - Intronic
1105469334 13:20678320-20678342 AGGGTGCAGAGTGGGACCAGGGG + Intronic
1105707473 13:22977133-22977155 AGGGTGCAGGGGAGGAACAAGGG + Intergenic
1106241618 13:27917952-27917974 AGGGAGCAGGGGAGGGAGAGTGG + Intergenic
1106283950 13:28302792-28302814 GGGCTGCAGGGCTGGCCCAGTGG + Exonic
1106804843 13:33295696-33295718 AGGGTGCCCGGGGGGGGCAGAGG + Intronic
1107559928 13:41549800-41549822 AGAGTGCAGGGCTGGCCCTGAGG - Intergenic
1108673362 13:52714029-52714051 AGGGTGCCCGGGTGACCCAGTGG + Intronic
1108933263 13:55858754-55858776 AGGATGCAGGGGTGGGGAGGTGG - Intergenic
1110390918 13:74972952-74972974 AGGAGGCTGGGGTGGGCCAGAGG - Intergenic
1111680959 13:91440875-91440897 ATGGTTCAGGGGTCAGCCAGAGG + Intronic
1113134263 13:107072290-107072312 AGGATGCAGGAGTGGGCTCGAGG - Intergenic
1113431157 13:110251348-110251370 AGGGTGAGTGGGTGGGGCAGGGG + Intronic
1113592128 13:111508355-111508377 AGAATGCAAGGGTGAGCCAGTGG + Intergenic
1113924328 13:113931938-113931960 AGGGTGGAGGGACGGGGCAGGGG - Intergenic
1114534285 14:23413057-23413079 AGGGTTCTGGGGTTGGTCAGAGG + Intronic
1117057037 14:51922876-51922898 AGGCTGCAGGGTGGGGGCAGAGG + Intronic
1117182214 14:53202486-53202508 AGGGAGCAGTGGTGTGCCTGTGG - Intergenic
1118115207 14:62768055-62768077 AGGGTGCCAGGGTGGGAGAGGGG + Intronic
1118699176 14:68416326-68416348 CAGGTGCAAGTGTGGGCCAGAGG - Intronic
1118992664 14:70809808-70809830 AGGGAGCTGCGGCGGGCCAGTGG - Intergenic
1119034090 14:71215390-71215412 AGGATGCTGGGGTGGCTCAGTGG + Intergenic
1119050563 14:71364358-71364380 AGGGTGCAGGGGTTGGGGAGGGG - Intronic
1119758837 14:77137531-77137553 AGGGTGGGTGGGTGGGCTAGTGG - Intronic
1119892169 14:78191172-78191194 GGGGTGTGGGGCTGGGCCAGGGG + Intergenic
1119955618 14:78795937-78795959 AAGGAGCAGGGGTGAGCTAGCGG - Intronic
1119998671 14:79279433-79279455 AGGCTGCAGAGGTGGCCGAGAGG - Intronic
1121577612 14:95001214-95001236 AAGGGGCAGCGGTGGGCCATGGG + Intergenic
1121887289 14:97555303-97555325 AGGGTACATGGGTGGGGCAGTGG - Intergenic
1122266759 14:100550285-100550307 AAGGTGAAGGCGTGGGCCGGCGG - Intronic
1122278952 14:100610099-100610121 AGGTGGCAGGGCTGGGACAGCGG - Intergenic
1122291188 14:100681277-100681299 AGGGGGCATGGGTGGGGCAGTGG + Intergenic
1122324517 14:100874597-100874619 AGGGTGCAGAGGAGGGTCCGGGG - Intergenic
1122810875 14:104287300-104287322 AGACTGAAGGGGTGGGCAAGGGG + Intergenic
1122835425 14:104428413-104428435 CGGGGGCAGGGGTGGGCCAATGG + Intergenic
1122836895 14:104434913-104434935 AGGGTGCAAGGGAGGGCCAGGGG + Intergenic
1122847927 14:104510870-104510892 AGAGTGCAGGGGTGGGGCAGTGG + Intronic
1122885141 14:104707538-104707560 AGGGAGCAGGGGTGGGGGTGGGG - Exonic
1123477399 15:20599297-20599319 TGGGGGCAGGGGAGGGGCAGTGG + Intergenic
1123640617 15:22401085-22401107 TGGGGGCAGGGGAGGGGCAGTGG - Intergenic
1123689104 15:22822454-22822476 AGGGGGCAGGGGTAAGGCAGGGG - Intronic
1123857304 15:24426758-24426780 AGGCTCCTGGGCTGGGCCAGGGG + Intergenic
1124243594 15:28051767-28051789 AGGGTGCAGGCGGGGACCATGGG + Intronic
1125366443 15:38921366-38921388 GGGGTGCAGGGGTGGGGCAAGGG + Intergenic
1125609572 15:40961262-40961284 AGGGTGGTGGGGCGGGGCAGGGG - Intergenic
1126662186 15:51044064-51044086 AGAGGGCAGGGATGGGCAAGTGG + Intergenic
1127930845 15:63596361-63596383 AGAGGGCAGGGGTGGCCCACTGG + Intergenic
1128513622 15:68328279-68328301 AGTGAGCTGGGGTGGGGCAGGGG + Intronic
1128683987 15:69670430-69670452 AGGAGGCAGGGATGGGGCAGAGG + Intergenic
1128704073 15:69825874-69825896 AGGGGGAAGTGGTGGGGCAGGGG - Intergenic
1128768547 15:70265623-70265645 AGGGGGCAGGGCTGGGCCTCGGG - Intergenic
1129801104 15:78414965-78414987 AGGCTATAGGGGTGGGCTAGAGG - Intergenic
1130034234 15:80342792-80342814 AGGGTTCAGGGATGGGGCTGGGG - Intergenic
1130213201 15:81945204-81945226 AAGGTGCAGAGGTGGGAGAGGGG - Intergenic
1130312419 15:82767025-82767047 AGGCTGCAGCTCTGGGCCAGAGG + Intronic
1130331496 15:82925642-82925664 AGGGTGGTGGGTTGGGCTAGAGG - Intronic
1130972104 15:88741559-88741581 AGGGTGCCAGGGTGGGGCTGAGG - Intergenic
1131289910 15:91098753-91098775 AGGGTGGAGGGGTGAGGCTGTGG + Intergenic
1131303866 15:91224116-91224138 AGGAAGCAGGTGTGGGGCAGAGG + Intronic
1132449908 15:101961510-101961532 AGGGCGCAGCGGAGGGCGAGCGG + Intergenic
1132452018 15:101973726-101973748 AGGTGGGAGGGGTGGGACAGAGG + Intergenic
1132531296 16:451329-451351 GAGGTGCAGGGGTGAGGCAGGGG - Intronic
1132614105 16:831858-831880 AGGGTGCCGGGGTGGCACAAGGG - Intergenic
1132632985 16:928755-928777 GGGGTGTAGGGATGGGCCCGTGG - Intronic
1132647363 16:1005132-1005154 AGGGAGCAGGGATGGGGGAGGGG + Intergenic
1133009132 16:2900643-2900665 AGGAGGCCGGGGTGGGTCAGAGG + Intergenic
1133046189 16:3089605-3089627 TGGGTGCAGTGGTGGGGCCGAGG + Exonic
1133128494 16:3662252-3662274 AGGGAGCAGCGCTGGTCCAGGGG - Exonic
1133570777 16:7038075-7038097 AGTGTGGAGGGGAGGGCAAGTGG - Intronic
1133818021 16:9212974-9212996 GGGGTGCAGAGATGGGGCAGTGG + Intergenic
1135241491 16:20810782-20810804 AGGGTGTGAGGGTGGGTCAGCGG - Intronic
1135376475 16:21951895-21951917 AAGGTGGAGGGGTGGGAGAGAGG + Intergenic
1136109656 16:28056870-28056892 GGGGTGCAGGGGAGTGCCGGCGG + Intronic
1136228374 16:28873459-28873481 AGGGGGCTGGGGTGGGTCATGGG - Exonic
1136499751 16:30664433-30664455 TGGGGGCAGGGTGGGGCCAGGGG - Exonic
1137290667 16:47050039-47050061 TGGGTGCTGGGGTGGGCGTGGGG - Intergenic
1137701360 16:50500313-50500335 AGGGTGGAAGGGCGGGGCAGAGG + Intergenic
1137712030 16:50573260-50573282 AGGGTGCAGGGGGGCACCACAGG - Intronic
1138510707 16:57507183-57507205 AGGGTCCAGGGGTGGGCTGATGG + Intergenic
1138517173 16:57542578-57542600 GGGGTGCAGGTGTGGGGCAAAGG + Intronic
1138542164 16:57695027-57695049 GGGGTGCAGGGAAGGGCCGGTGG + Intronic
1138582873 16:57952988-57953010 GAGCTCCAGGGGTGGGCCAGGGG - Intronic
1138630893 16:58293458-58293480 TGGGTACAGGGGTGAGCAAGAGG - Intronic
1138829153 16:60357854-60357876 ACGGTGCAGGGGCTGGGCAGAGG + Intergenic
1138950439 16:61906381-61906403 AGGCTGCAGTGGGTGGCCAGAGG - Intronic
1140634006 16:76889155-76889177 GGGTTGGGGGGGTGGGCCAGGGG + Intergenic
1141188506 16:81806696-81806718 AGGGTCCAGGTGTGGGGCTGGGG + Intronic
1141326504 16:83065000-83065022 GGGGTGCAGGGGAGGGACTGGGG - Intronic
1141717577 16:85735630-85735652 AGGGCTCGGGGGTGGCCCAGAGG + Intronic
1141781858 16:86167898-86167920 AGTGTGCCTGGGTGGCCCAGGGG + Intergenic
1142154038 16:88525129-88525151 AAGAGGCAGGGGTGGCCCAGAGG + Intronic
1142218589 16:88841842-88841864 GGGGTGCAGGGTTGGGCAGGTGG - Intronic
1142261036 16:89042540-89042562 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261046 16:89042573-89042595 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261056 16:89042606-89042628 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261066 16:89042639-89042661 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261076 16:89042672-89042694 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261086 16:89042705-89042727 AGGGTGCAGCGATGGGCGTGGGG + Intergenic
1142539619 17:647994-648016 AGGCGGCAGGGGTGGGCCTCTGG + Intronic
1142781826 17:2187088-2187110 AGGCTGGAAGGGTGGGCTAGAGG - Intronic
1143404461 17:6667957-6667979 GGTGTGCAGGGGTGGGCAAGAGG - Intergenic
1143631719 17:8143718-8143740 TGGCTGGTGGGGTGGGCCAGGGG + Exonic
1143655186 17:8289687-8289709 AGGAAGCAGGAGTGGGCCAGAGG + Intronic
1143749865 17:9020819-9020841 AGGGAGCAGTGGTGGGCAGGAGG - Intergenic
1143953743 17:10653404-10653426 AGGGGGAAGAGGTGGGCCGGGGG - Intronic
1144707697 17:17380437-17380459 AGGGGGAAGGGCTGGGCCTGAGG - Intergenic
1144834845 17:18151381-18151403 AGGGTGAAGCTGTGGGCAAGGGG - Exonic
1145976570 17:28987346-28987368 AGAGGGCAGGGCTGGGCCCGTGG - Intronic
1146379603 17:32319018-32319040 AGGGTGCAGTGGGGTGGCAGTGG + Intronic
1146917313 17:36686531-36686553 TGGGCGCAGGGGTAGGACAGAGG - Intergenic
1147145013 17:38479654-38479676 AGGGTGGAGGGGAGGTCCCGAGG + Intronic
1147168436 17:38605248-38605270 AGGATGCAGGGGAGGGGAAGGGG - Intronic
1147249597 17:39145145-39145167 AGGGTGCAGGGGCAGCCCCGGGG + Intronic
1147752552 17:42745055-42745077 ACGGCGCAGGGGTGGGGCCGCGG - Intergenic
1147926030 17:43946464-43946486 AGGATGCGGGGGTGGGGCGGGGG - Intergenic
1148061286 17:44838348-44838370 GGGGGGCAGCGGTGGGGCAGGGG - Intergenic
1148240924 17:45998921-45998943 GGGGTGCATGGGTGGGCAATGGG - Intronic
1148245214 17:46025793-46025815 AGGGTGCAAGTGGGGGACAGCGG - Exonic
1148470333 17:47889176-47889198 GGAGTGCAGGGGAGGGGCAGAGG + Intergenic
1148687018 17:49506689-49506711 GGGGTGCGGGGGTGGGCTGGGGG + Intronic
1149496511 17:57121772-57121794 AGGGGGCAGGGGCGGGGCACTGG - Intergenic
1149582660 17:57762130-57762152 AGCCTGCAGGGGAGGGGCAGTGG + Intergenic
1149863852 17:60139575-60139597 AGGCTGCAAGTCTGGGCCAGCGG + Intergenic
1149991426 17:61385681-61385703 TGGGTTCCGGGGTGGCCCAGGGG - Intronic
1150004700 17:61462542-61462564 AGGGTGCAGGGAGGGGAGAGGGG + Intronic
1150075762 17:62190745-62190767 AGAGTGGAGGGGTGGGACACTGG + Intergenic
1150327862 17:64271182-64271204 AGGGTGCGGGGATGGGGCAGAGG - Intergenic
1151392693 17:73798289-73798311 AGGGTCCAAGGGTTGACCAGGGG + Intergenic
1151578383 17:74963990-74964012 AGGCTGCAGAGGAGGGTCAGGGG + Intronic
1151595585 17:75076421-75076443 TGGATGCAGGGAGGGGCCAGAGG - Intergenic
1151730536 17:75908594-75908616 ATGGTGCAGGGGAGGGACTGTGG - Intronic
1151730547 17:75908639-75908661 AGGGGGCAAGAGTGGGACAGAGG - Intronic
1151748291 17:76023180-76023202 AGGGTGTAGGGGTGGCTCAGGGG - Intronic
1151954213 17:77372699-77372721 AGGGTGCAGCGGTGGCCCCCGGG + Intronic
1152040877 17:77901882-77901904 TGGGTGCAGGAGTGGGCTGGGGG + Intergenic
1152375107 17:79914880-79914902 AGGCAGGTGGGGTGGGCCAGGGG - Intergenic
1152394279 17:80023181-80023203 AGGGTGGAGGGGGTGGCCTGGGG - Intronic
1152460011 17:80437549-80437571 GGGGTGCAGGTGTGTGCCAGGGG + Exonic
1152497931 17:80687542-80687564 AGTGTGCTGGTGTGGGGCAGAGG - Intronic
1152779490 17:82219926-82219948 AGGAGGCAGGGGTGGGACACAGG + Intergenic
1152821849 17:82441458-82441480 AGCGTGCAGGTGTGGGTGAGGGG + Intronic
1152863498 17:82709325-82709347 CGGGGGCAGGGGTGGGTCATGGG - Intergenic
1152946782 17:83202238-83202260 AGGATGCAAGGGTGGCCAAGGGG - Intergenic
1153720438 18:7896312-7896334 AGGGTGTAGGGGTGGGAAACAGG - Intronic
1153807684 18:8723670-8723692 AAGGTGCAGGGTGGGGCAAGGGG - Intronic
1153967211 18:10192697-10192719 AGGTCTCAGGGCTGGGCCAGGGG - Intergenic
1154446796 18:14441230-14441252 TTGGAGCAGGGGTGGGCCATTGG + Intergenic
1155086894 18:22467616-22467638 AGGGGGCTGGGGTGGGACTGGGG + Intergenic
1155634498 18:27936632-27936654 AGGATGCTGAGGTGGGACAGTGG - Intergenic
1156368862 18:36454688-36454710 AGGTTGCAGGGGTGGGCTCCAGG - Intronic
1156384546 18:36593677-36593699 AGGCTCAAGGGGTGGGCGAGAGG + Intronic
1156462927 18:37331788-37331810 AGAGTGGAGGGAAGGGCCAGTGG + Intronic
1157807040 18:50665793-50665815 TGGCTGCAGGAGTGGGGCAGAGG - Intronic
1158395678 18:57077115-57077137 CTGCTGCAGGGCTGGGCCAGGGG + Intergenic
1158868934 18:61665603-61665625 TGGGTGAAGGGGTGGGGCTGGGG - Intergenic
1158931848 18:62330608-62330630 AGTGTCCAGGGGCGGGCCGGAGG + Intronic
1159010055 18:63050562-63050584 AGGGTGCAGGTCTGGGGTAGGGG - Intergenic
1159559865 18:69982624-69982646 TGGCTACAGGGGTGGGCCTGTGG - Intergenic
1160217802 18:76948552-76948574 AGGGTGCAGGTGAGAACCAGCGG + Intronic
1160635348 19:71037-71059 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
1160754706 19:751307-751329 AGGGTGACGGGGTGGGGCAGGGG - Intronic
1160793057 19:931858-931880 AGGGTGCCGTGGAGGGGCAGTGG + Intronic
1160794743 19:940036-940058 AGGGGTCAGGGCTGGGCTAGAGG + Intronic
1160817696 19:1043655-1043677 AGGGGGCAGGGGGTGGGCAGGGG + Intronic
1160828538 19:1091762-1091784 AGGCTGGCGGGGTGGGGCAGGGG + Intronic
1160861734 19:1240111-1240133 AGGGAGCAGGGGAGGCCCTGGGG - Intergenic
1160975337 19:1790083-1790105 AAGGGGCAGGGGTGGGGGAGTGG - Intronic
1161354486 19:3811245-3811267 GGGGGGCAGGGGTGGAGCAGGGG - Intronic
1161410213 19:4112782-4112804 GGGGTGCTGGGGTGGCCCTGGGG - Intronic
1161411848 19:4122001-4122023 AGGGTGCCAAGGTGGGGCAGGGG - Intronic
1161501286 19:4617481-4617503 AGGGGTCAGGGCTGGGACAGAGG - Intergenic
1162044410 19:7988983-7989005 AGGGTGAAGGGGGTGGTCAGAGG + Intronic
1162068229 19:8138351-8138373 AGGGGACAGGGGAGGGCCAAGGG - Intronic
1162457859 19:10796702-10796724 GGGGTGCAGGGGGTGGGCAGGGG - Intronic
1162809033 19:13153383-13153405 CGGGTGCAGGCGAGGGTCAGAGG - Exonic
1163035471 19:14566676-14566698 GGGGGGCTTGGGTGGGCCAGGGG + Intronic
1163266648 19:16226189-16226211 AGGCTGGAGGGGTGAGCCTGGGG + Intronic
1163605784 19:18274554-18274576 AGGATGCAGGGCAGGGCCAAAGG + Intergenic
1163645949 19:18489235-18489257 ATGGTGCAGGTGTGAGCGAGGGG + Intronic
1164145609 19:22510757-22510779 AGGCTGCAGGTGTGGGTGAGTGG - Intronic
1164156777 19:22602051-22602073 AGGGGGCAAAGGTGGGGCAGGGG - Intergenic
1164524726 19:29004993-29005015 AGGCTGCGGGGATGGGCCGGCGG - Intergenic
1164562108 19:29299584-29299606 AGGGAGTAGGGGTGGGGCATGGG - Intergenic
1164720358 19:30427466-30427488 AGGGTGCAGGGGACAGCAAGTGG + Intronic
1164788963 19:30959766-30959788 AAGGTGCAGGGATGGGCCTGTGG + Intergenic
1165058139 19:33191871-33191893 AGGGAGCAGTGGTGGGGCAGAGG - Intronic
1165129343 19:33622310-33622332 CGGGAACAGGGGTGGGGCAGGGG - Intronic
1165172882 19:33906214-33906236 AGGGTGGTGGGGTGGGGGAGCGG - Intergenic
1165306453 19:35005587-35005609 AGGCTGCTGGGATGGCCCAGGGG + Intronic
1165348005 19:35261088-35261110 TGGGTGCAGAGCTGGGCCTGTGG + Intronic
1165434171 19:35787586-35787608 CGGGGGCAGGGATGCGCCAGAGG + Exonic
1165552294 19:36597578-36597600 TGTGTGCAGGGGTGGGGGAGAGG + Intronic
1165936136 19:39390193-39390215 TGGGAGCAGAGGTGGGGCAGCGG - Intronic
1166105136 19:40594438-40594460 AAGTTGCAGTGGTGAGCCAGAGG + Intronic
1166326465 19:42053935-42053957 AGGGTGGGGAGGTGGGGCAGAGG + Intronic
1166326964 19:42056892-42056914 TGGGGGCAGAGATGGGCCAGAGG + Intronic
1166380018 19:42350943-42350965 AGGATCCAGAGGTGGGCAAGGGG - Intronic
1166720344 19:44992747-44992769 TGGGTGCAGGTGTGGGCGTGAGG - Exonic
1166786508 19:45370414-45370436 AGGGTGAAGGGGTGGGACGGGGG - Intronic
1166856764 19:45786111-45786133 AGGGTGCGGGTGCGGGCCAGGGG + Exonic
1166859315 19:45800609-45800631 AGGGTGCAGTGCAGGGCCTGGGG - Intronic
1166876416 19:45900505-45900527 AGGGAGCAGGGCTGGGGTAGGGG - Intronic
1166988226 19:46675003-46675025 AGGGGGCAGGGCTGGCCCATTGG - Intronic
1167033653 19:46979868-46979890 AAGGGGCAGGGGAGGGACAGAGG + Intronic
1167127445 19:47559915-47559937 AGGGAGTAGGGATGGGGCAGGGG - Intergenic
1167147998 19:47694272-47694294 AGGGTGCAAGGGTGGCTCTGAGG - Exonic
1167327088 19:48833263-48833285 AGGGTCAGGGGGTGGGGCAGGGG + Intronic
1167383738 19:49152437-49152459 AGGGTGCAGGGGTGGGCCAGGGG - Intronic
1167432552 19:49462745-49462767 AGGGTGCACAGGTGAGGCAGGGG + Exonic
1167440634 19:49506772-49506794 AGGGTGGAGAGGAGGGGCAGCGG + Intergenic
1167513682 19:49910399-49910421 AGAGTGCAGGTGTGGGCCTGGGG - Intronic
1167614701 19:50526061-50526083 AGGGCCCAGGGGAGGGACAGGGG - Intronic
1167622193 19:50566575-50566597 GGGGTGGAGGGGTGGGCAAGAGG + Intronic
1167646175 19:50706315-50706337 TGGGGGCAGGACTGGGCCAGTGG + Intronic
1168141563 19:54391443-54391465 AAAGTGCAGCGGTGGTCCAGGGG + Intergenic
1168423801 19:56222870-56222892 GGGGTGATGGGGTGGTCCAGGGG - Intronic
1168443136 19:56389097-56389119 AGGGTGCATGGTAGGGCCAATGG - Intronic
1168725344 19:58578191-58578213 GGGGTCCAGGGGTTGGCCAGAGG + Intergenic
1202704587 1_KI270713v1_random:13644-13666 TGGGTGCCAGGGTGGGGCAGAGG - Intergenic
925069615 2:956223-956245 GCGGGGCAGGGGTGGGGCAGGGG - Intronic
925185285 2:1842685-1842707 GGGGTGCAGGGGTGGACGTGAGG - Intronic
925752773 2:7104706-7104728 ACTGTGCTGGGGTGGGGCAGGGG + Intergenic
926181322 2:10646302-10646324 AGTGTTCAGGGTTGAGCCAGTGG - Intronic
926542977 2:14204397-14204419 TGGGGGCTGGGGTGGGCCATGGG - Intergenic
926726867 2:16005303-16005325 AGGGGGGAGGGGTGGGGGAGGGG - Intergenic
927089590 2:19700442-19700464 AGTGAGCAGGGGGAGGCCAGTGG + Intergenic
927374977 2:22403200-22403222 CGGCTACAGGGGTGGGACAGAGG - Intergenic
927906633 2:26863188-26863210 TGGAGGAAGGGGTGGGCCAGGGG - Intronic
928187490 2:29125612-29125634 ATAGTTCAGGGGTGGGGCAGGGG - Intronic
928194442 2:29204978-29205000 AGAGTACAGGGCTGGGTCAGAGG - Intronic
928205288 2:29279406-29279428 AGGCTGCAGGGAAGGGACAGTGG + Intronic
929582845 2:43094234-43094256 AGGGTGGAAGGTTTGGCCAGTGG - Intergenic
929583795 2:43101191-43101213 AGGGAGCCGGGGTGGGCAGGGGG + Intergenic
930704908 2:54495164-54495186 AGGTTGCAGGTGTGTGGCAGAGG + Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
932062940 2:68527090-68527112 ACGGTGCAGGGGCTGGGCAGAGG + Intronic
932347041 2:71002188-71002210 GGGGTGAAGGGGTGGGGCTGGGG + Intergenic
932625846 2:73295243-73295265 AGGGTACAGGGGTGGAAGAGAGG - Intergenic
933242964 2:79943202-79943224 AGCGAGCGGGGGTGGGGCAGGGG + Intronic
934973945 2:98787179-98787201 AGGGCTCAGGGGTGGGGCTGGGG + Intergenic
935237594 2:101151461-101151483 CGGGTGCGGGGCGGGGCCAGGGG - Intronic
935289921 2:101601450-101601472 AGAGAGCAGAGGTGGGCAAGGGG - Intergenic
936102682 2:109597085-109597107 AGTGTGCTGGGATGTGCCAGTGG - Intronic
936267415 2:111021171-111021193 AGGGTAGAGGAGTGGGCCAGTGG + Intronic
936462157 2:112721928-112721950 AGGGAGCAGGGGTGGGCAGCTGG + Intronic
936498008 2:113039343-113039365 TGGTTGCAGGGGTGGGATAGTGG - Intronic
936501912 2:113073356-113073378 AGGGTCCATGGGAGGGGCAGAGG - Intronic
936528339 2:113257576-113257598 AGGGAGCTGGGGAGGGACAGGGG + Intronic
936568233 2:113596202-113596224 AGGTGGGAGGGGTGGGACAGAGG + Intergenic
937020095 2:118642439-118642461 AGGGTGCTGTGGAAGGCCAGAGG - Intergenic
937049464 2:118876485-118876507 AGGTGGCAGGGCTGGGTCAGGGG - Intergenic
937164253 2:119796088-119796110 CGAGGGCAGGGGTGGCCCAGAGG + Intronic
937205202 2:120231954-120231976 AGGGGGCCAGGGTGGCCCAGAGG + Intergenic
937225924 2:120368597-120368619 AGGCTGGAGGGGTGGCCAAGGGG + Intergenic
937297008 2:120815572-120815594 AGGCTAGAGAGGTGGGCCAGGGG - Intronic
937343059 2:121104251-121104273 AGGGTGCAGGAGTGGGCGAGAGG + Intergenic
937365066 2:121255629-121255651 GGTGTGGAGGGGTGGCCCAGTGG - Intronic
937953145 2:127403671-127403693 AGGGTCCAGGTGAGGGGCAGAGG - Intergenic
940211653 2:151261607-151261629 AGGGTGCAGGGCTGCGCGGGAGG - Intronic
940348559 2:152654786-152654808 AGGCTGAAGGGGTGGGTGAGGGG - Exonic
941608324 2:167628706-167628728 AGGGTGGAGGCATGGGCCTGGGG + Intergenic
942675293 2:178420651-178420673 AGGAAGCAGGGGTGGGGAAGAGG + Intergenic
942812684 2:180017367-180017389 AGAGGCCAAGGGTGGGCCAGAGG - Intergenic
943209004 2:184938623-184938645 AGGCTGCAGAGGTGTGCTAGGGG - Exonic
944338796 2:198570002-198570024 AAGGCCCAGGGGTGGCCCAGGGG + Intronic
944403930 2:199360909-199360931 AGGGTGCAGTGGAGGGGCAGGGG - Intronic
944782959 2:203039296-203039318 GGGGGGGAGGGGAGGGCCAGGGG - Intronic
946005375 2:216520336-216520358 AGCCTGCAGGAGTGGGCGAGAGG - Intronic
946189881 2:218002587-218002609 GGGGTGGGGGGGTGGGGCAGGGG + Intronic
946195121 2:218028246-218028268 AGGGTGCAGGTGTGGGAATGGGG - Intergenic
946431219 2:219628117-219628139 GGGGTCCCGGGGTCGGCCAGAGG - Intronic
946923635 2:224604150-224604172 AGGGTGCAGCGGTGGGCTGAAGG + Intergenic
947156071 2:227164245-227164267 AGGGTGGAGGGAGTGGCCAGCGG - Intergenic
947542024 2:230986261-230986283 AGGGGCCAGGGGTGGGGAAGTGG - Intergenic
948223521 2:236291434-236291456 AGGGGGCAGGGGTGGGACCAGGG + Intergenic
948398387 2:237664035-237664057 AGGGTGAAGGGTGGGGGCAGAGG + Intronic
948465636 2:238150398-238150420 GGGGTGCAGGGGTGAGGCAAGGG + Intronic
948665819 2:239534238-239534260 AGGGAGCAGGTGTGGGACTGGGG - Intergenic
948726392 2:239936575-239936597 AGGATGCAAGTGTGGGGCAGGGG + Intronic
948858951 2:240743639-240743661 AGGATGCTGGGGTGGCCCCGGGG - Intronic
1169208460 20:3752904-3752926 AGGGTGGATGGGGAGGCCAGAGG + Exonic
1170584353 20:17723157-17723179 GGGCTGCAGGGGTGGGGCTGGGG - Intronic
1170585198 20:17729222-17729244 AGGGATCAGGGATGGGGCAGCGG - Intronic
1170653424 20:18263931-18263953 AGGGTGCAGGGCTGTGTGAGTGG - Intergenic
1170732147 20:18984870-18984892 ATGGTGCTGGGATGGGCCAAAGG + Intergenic
1170764168 20:19275811-19275833 AGGGGACAGGAGTGGGCCATGGG - Intronic
1170789486 20:19496086-19496108 AGGGAGCCGGGGTGTCCCAGAGG - Intronic
1170864710 20:20142975-20142997 AGGGTGGGGGGATGGGCCTGGGG + Intronic
1171274773 20:23847328-23847350 AGGGTCATGGGGTGGGGCAGAGG - Intergenic
1172113962 20:32562995-32563017 AGAGTGGAGGGGAGGGACAGTGG + Intronic
1172328374 20:34055442-34055464 AGGAAGCAGGGGTGGGGCATGGG + Intronic
1172526344 20:35602270-35602292 AGGGCGAAGGGGCGAGCCAGGGG + Intergenic
1172528904 20:35617406-35617428 AGGGGCCGGGGGTGGGCCTGGGG - Intronic
1172670570 20:36632236-36632258 GTGGTGCTGGGGTGGGCCAGTGG - Intronic
1172772756 20:37391239-37391261 AGGCTGCAGGGCGGGGTCAGAGG - Intronic
1172963239 20:38813600-38813622 AGGGTGCAGAGCTTGGCAAGTGG - Intronic
1173620026 20:44429689-44429711 AGGGGGCTGGGGGGAGCCAGTGG - Exonic
1173686080 20:44924318-44924340 AGGGTGGAGGGGTGGGGTTGTGG - Intronic
1173793296 20:45841681-45841703 AGGCTGCAGGTCTGGCCCAGGGG + Exonic
1173947302 20:46961869-46961891 ATGGTGCAGGGGTGAACCAGAGG + Intronic
1174040698 20:47697512-47697534 AGGGAACAGGGGTGAGCCCGGGG - Intronic
1174912732 20:54624217-54624239 AGGGTGAAGGGGTGGGCTGCTGG - Intronic
1175066169 20:56290680-56290702 AGGGTGCAGGACTGAGTCAGGGG - Intergenic
1175142797 20:56873295-56873317 TGGGCGCAGGGTTGGGCGAGTGG + Intergenic
1175382147 20:58570742-58570764 AGCGTTCAGGGGAGGGCCAGAGG + Intergenic
1175402581 20:58708860-58708882 CGGGGGCAGGGGTGGGCAAGTGG + Intronic
1175490977 20:59381134-59381156 AGGGTGAAGGTGAGGTCCAGAGG - Intergenic
1175785363 20:61708562-61708584 AGGGAGCAGGGCTGGGGAAGTGG - Intronic
1175794670 20:61764219-61764241 AGGGTGCAGGTGTGGACTTGGGG + Intronic
1175872484 20:62215097-62215119 GGCGTGCAGGGGCGGTCCAGAGG - Exonic
1176080052 20:63267911-63267933 ACGGGGCAGGGCAGGGCCAGGGG + Intronic
1176235154 20:64050445-64050467 AGGGTCCAGGGAGGGGCCAGTGG - Intronic
1176449178 21:6848610-6848632 TTGGAGCAGGGGTGGGCCATTGG - Intergenic
1176549296 21:8214489-8214511 CGGGTGCGGGGGTGGGCGGGCGG + Intergenic
1176557189 21:8258712-8258734 CGGGTGCGGGGGTGGGCGGGCGG + Intergenic
1176568228 21:8397527-8397549 CGGGTGCGGGGGTGGGCGGGCGG + Intergenic
1176576131 21:8441747-8441769 CGGGTGCGGGGGTGGGCGGGCGG + Intergenic
1176827346 21:13713634-13713656 TTGGAGCAGGGGTGGGCCATTGG - Intergenic
1178344099 21:31810388-31810410 TGGGGGCAGGGAGGGGCCAGTGG + Intergenic
1178485504 21:33017634-33017656 AGGTTGGGGGGGTGGGGCAGTGG + Intergenic
1178490786 21:33050057-33050079 CGGGGTGAGGGGTGGGCCAGGGG + Intergenic
1178601749 21:34000493-34000515 GGGGTGTAGAGGTGAGCCAGGGG + Intergenic
1178690477 21:34746033-34746055 AGGGTGGAGGGGTTGGCTGGAGG - Intergenic
1178914150 21:36697737-36697759 CTGGCGCAGGGGAGGGCCAGGGG + Intergenic
1178974506 21:37209462-37209484 AGGGAGCAGGGCTGTGGCAGGGG - Intergenic
1179452479 21:41475445-41475467 GGGGTGCAGGGGTGAGTGAGGGG + Intronic
1179826249 21:43968153-43968175 AGGGTCCCGGGGAGGGCCGGGGG + Intronic
1179826351 21:43968416-43968438 CGGGTGCTGGGGTGAGCAAGAGG + Intronic
1180042301 21:45287132-45287154 TGGGGGCAGGGTCGGGCCAGCGG - Intronic
1180058839 21:45374528-45374550 AGGAGGCAGGGGAGGGGCAGGGG - Intergenic
1180254017 21:46610195-46610217 AGTGTGCAGTGGTCGGCCACTGG - Intergenic
1180708361 22:17823221-17823243 TGGGTGCTGGGGGGGGCCCGGGG + Intronic
1180891471 22:19291841-19291863 CGGGGGCAGGGGCGGGGCAGAGG - Intergenic
1181285927 22:21752483-21752505 ATGGTGCAGGGGTGGGTGTGTGG + Intergenic
1181433079 22:22894663-22894685 AGGCTGCTGGGGTGGGCCTGGGG + Intronic
1181541206 22:23574172-23574194 AGGCTGCTGGGGTGGGCATGGGG - Intronic
1181637191 22:24179998-24180020 TGGGTGCAGGGGAGGGTCCGAGG - Intergenic
1181797177 22:25319158-25319180 AGGCTGCTGGGGTGGGCATGGGG + Intergenic
1181966047 22:26657404-26657426 AGGGTGGAGGTGAGGGCCGGGGG + Intergenic
1182319892 22:29471894-29471916 AGGGGGCAGGGGCTGGGCAGAGG - Intergenic
1182422329 22:30254555-30254577 AGGGTCCAGGGGTGGGGTGGGGG - Intergenic
1182586530 22:31346794-31346816 AGCGGGCAGGGGAGGGGCAGTGG - Intergenic
1182910617 22:33981219-33981241 ATGGGGCAGGGGTGAGACAGGGG - Intergenic
1183412897 22:37665889-37665911 AGTGGGGAGGGGTGGGCCTGTGG - Exonic
1183638757 22:39080863-39080885 GGAGAGCAGGGGTGGGGCAGGGG - Intronic
1183746995 22:39697782-39697804 AGGGTGCAGGGGTGGGTGCCTGG + Intergenic
1183859658 22:40660601-40660623 AGGGAGCTGGGGTGGGACTGAGG + Intergenic
1184095920 22:42316392-42316414 TGGGTGCAGGGAAGGCCCAGGGG - Intronic
1184240121 22:43207445-43207467 AGGGGCCAGGGCTGGGGCAGGGG + Intronic
1184356092 22:43980478-43980500 AGGGAGCAAGGGTAGGACAGCGG + Intronic
1184511184 22:44934220-44934242 GAGGTGCAGGTGAGGGCCAGCGG - Intronic
1184607382 22:45581884-45581906 AGGGTGCAGGGAGGGTCGAGGGG + Intronic
1184806562 22:46798396-46798418 AGGGGGCAGGGGTGAGGCTGGGG + Intronic
1185171066 22:49294938-49294960 AGGGAGCAGGGCTGGGACTGCGG + Intergenic
1185398167 22:50603185-50603207 AGATAGCAGGGCTGGGCCAGAGG - Intronic
1185399421 22:50608250-50608272 GGGGTGGAGAGGTGGGACAGCGG + Intronic
1185399435 22:50608307-50608329 GGGGTGGAGAGGTGGGACAGCGG + Intronic
1185399480 22:50608473-50608495 GGGGTGGAGAGGTGGGACAGCGG + Intronic
1185399497 22:50608530-50608552 GGGGTGGAGAGGTGGGACAGTGG + Intronic
1185399526 22:50608639-50608661 GGGGTGGAGAGGTGGGACAGCGG + Intronic
1185399541 22:50608696-50608718 GGGGTGGAGAGGTGGGACAGTGG + Intronic
1203254181 22_KI270733v1_random:130805-130827 CGGGTGCGGGGGTGGGCGGGCGG + Intergenic
1203262237 22_KI270733v1_random:175884-175906 CGGGTGCGGGGGTGGGCGGGCGG + Intergenic
949938218 3:9134106-9134128 AGGGTGCAGGCAAGGGGCAGAGG - Intronic
949987335 3:9551614-9551636 ATGGTGCAGGGGTGGGAGTGGGG + Intronic
950263610 3:11559512-11559534 AGGGTGCTGGGGAGGGCCCCAGG - Intronic
950566378 3:13772141-13772163 AGGGTGGGGGCGGGGGCCAGAGG + Intergenic
950580721 3:13860303-13860325 AGGGAGCTGGGGTGGGGCTGAGG - Intronic
952199004 3:31106117-31106139 AGGGTGAAGGGGTCGGAGAGGGG - Intergenic
952386676 3:32846632-32846654 TGGGTGCAGGGGAGGGGCAAGGG - Intronic
953807951 3:46087871-46087893 AGGGTTCAGGAGAGGCCCAGTGG + Intergenic
953873117 3:46644838-46644860 AGGATTCAAGGGTGAGCCAGTGG + Intergenic
953885071 3:46710397-46710419 GGGCTGCAGGGCTGGGTCAGGGG + Exonic
953912047 3:46898253-46898275 AGGGGTCAGGGCTGGGTCAGGGG - Intronic
954121726 3:48503841-48503863 AGGGTGCTGGGGTGGAGGAGGGG + Intronic
954502324 3:51029968-51029990 GGGGTCGGGGGGTGGGCCAGAGG + Intronic
954754844 3:52833560-52833582 GGGGTGCAGGTGTGTGTCAGTGG - Intronic
955137961 3:56238563-56238585 AGTCTGCAGGGCTGGCCCAGGGG + Intronic
955390878 3:58521442-58521464 AGAGTGCTGGGGTGGGAAAGAGG - Intronic
958025064 3:88040175-88040197 AGGGGGCTGTGGTGGGCCAAAGG + Intergenic
959907757 3:111729587-111729609 AGGTTGCAAGGGAGGGACAGTGG + Intronic
961322283 3:126084133-126084155 AGGACGCAGGGGCGGGCCTGCGG + Exonic
961385671 3:126522055-126522077 AGGGTGCCGGGGCAGGCCTGGGG - Intergenic
961390129 3:126547647-126547669 ATAGTGCAGGTGTGGACCAGAGG + Intronic
961655242 3:128438292-128438314 TGGGCCCAGGGCTGGGCCAGAGG - Intergenic
961817518 3:129558880-129558902 AGGGTTCAGGGAGGAGCCAGGGG - Intronic
962334099 3:134510596-134510618 AAGGTGCAGGGGTGGGAAATTGG + Intronic
962370012 3:134813531-134813553 AGAGTCCAGGGCTGGGCTAGGGG - Intronic
963316568 3:143765173-143765195 AGGGAGGAAGGGTGGGCCTGAGG - Intronic
963885976 3:150582742-150582764 AGTGTGCTGGGGTGGCCCTGGGG + Intronic
964479756 3:157129279-157129301 AGGGGTCAGGGGTGGGACGGAGG + Intergenic
965634609 3:170768573-170768595 AGGGTGGAGGGGGGTGGCAGAGG + Intronic
966903817 3:184507703-184507725 AGGGAGTAAGGGCGGGCCAGTGG - Intronic
967724695 3:192850624-192850646 AGCGTGCAGGGCTGAGCCTGAGG - Intronic
967866398 3:194193404-194193426 TGGGTGGAGGGGTGTCCCAGAGG + Intergenic
967870992 3:194228966-194228988 AGGGTGGAGGGGAGGGAAAGAGG - Intergenic
968523058 4:1043013-1043035 AGTGTGCAGGGGTGGGTGGGTGG - Intergenic
968525104 4:1052787-1052809 GGTGTGCTGAGGTGGGCCAGTGG + Intergenic
968566674 4:1316993-1317015 TGGGGGCCGGGGTGGGCCTGGGG - Intronic
968566700 4:1317065-1317087 TGGGGGCCGGGGTGGGCCTGGGG - Intronic
968566725 4:1317137-1317159 TGGGGGCTGGGGTGGGCCTGCGG - Intronic
968566761 4:1317248-1317270 TGGGGGCTGGGGTGGGCCTGCGG - Intronic
968569847 4:1333799-1333821 TGGGTGCAGGGGTGGGCACATGG - Intronic
968569898 4:1333940-1333962 TGGGTGCAGGGGTGGGCACATGG - Intronic
968584384 4:1409344-1409366 ATGGGGGAGGGGTGGGGCAGGGG - Intergenic
968606232 4:1537003-1537025 AGGCTGCAGGGATGGGTCTGGGG - Intergenic
969253879 4:5989804-5989826 GGGGTGCAGGGGTGCCCCCGAGG - Exonic
969671570 4:8592932-8592954 AGGGTGGAGGGTGGGGGCAGGGG - Intronic
969673387 4:8601843-8601865 AGAGTGCAGGGCTGGCCCTGGGG + Intronic
969694002 4:8724758-8724780 AGGGAGGAGGGGCGGGCCAGCGG - Intergenic
969694201 4:8725570-8725592 AGGGGCCAGGGGCGGGGCAGAGG + Intergenic
969953595 4:10865504-10865526 AGGGTCCCAGGGTTGGCCAGGGG + Intergenic
970997197 4:22280888-22280910 AATGTGCAGTGGTGGGGCAGGGG + Intergenic
971390900 4:26184371-26184393 AGGGAGCAGGGTGGGGGCAGTGG + Intronic
972913654 4:43849314-43849336 AGGGTGAAGGGTTGGGGTAGGGG - Intergenic
976355310 4:84110356-84110378 AGGGTGGAGGAGTGGGCAAAAGG - Intergenic
976390332 4:84499087-84499109 AGGGAGCGGGGGTGGGGCGGGGG - Intergenic
977059069 4:92233782-92233804 AGGGTGGAGGGGAGGGACAGGGG + Intergenic
977938224 4:102829321-102829343 AGGGAGGAGGGAGGGGCCAGAGG - Intronic
979858853 4:125668144-125668166 AGTGAGCGGGGGTGGGGCAGGGG - Intergenic
979899783 4:126201738-126201760 AGGGTGCAGCGGTGGGCTGAAGG + Intergenic
982070779 4:151692655-151692677 AGGGGGCAGGAGAGGGGCAGAGG - Intronic
982126200 4:152185991-152186013 GGTGTGCTGGGGTGGGGCAGAGG - Intergenic
982131487 4:152232932-152232954 AGGGTTCTGGGGAGGGACAGAGG + Intergenic
982241958 4:153308845-153308867 AGTTTGCAGAGGTGGGGCAGGGG - Intronic
983469753 4:168141920-168141942 AGTGCGCATGCGTGGGCCAGGGG + Intronic
983548702 4:168992346-168992368 AGGGTGAGAGGGTGGGACAGAGG + Intronic
985541686 5:490340-490362 GAGGGGCAGGGGAGGGCCAGGGG + Intronic
985566395 5:620477-620499 AGGGCGCAGGGCTGGGGCCGTGG + Intronic
985577147 5:678713-678735 AGTGTGCAGGGCTGAGGCAGTGG + Intronic
985881263 5:2640788-2640810 AGGGTGCATGGGGAGGCCATGGG - Intergenic
985988770 5:3538469-3538491 AGGATGCAGGGGTGGGGCTGTGG - Intergenic
986094420 5:4540839-4540861 AGGGAGCAGGGGTGGGTAAAGGG - Intergenic
986471534 5:8081310-8081332 AGTGTGCAGGGGAGGGCATGGGG + Intergenic
986717494 5:10534449-10534471 GGGGTGCGGGGGTTGGCGAGGGG + Intergenic
987629698 5:20453113-20453135 AGGGTGCAGGTTTGAGCAAGGGG - Intronic
989178875 5:38556708-38556730 CGGGGGCAGGGGCGGGTCAGGGG - Intronic
990128372 5:52548123-52548145 TGGGGGAAGGGGTGGGCCATGGG - Intergenic
990178610 5:53135518-53135540 AGGAGGCAGGGATGGGCCTGAGG - Intergenic
990320737 5:54627766-54627788 AGGGAGCATGGCTTGGCCAGTGG - Intergenic
991353820 5:65747580-65747602 ATGGTACAGGAGGGGGCCAGGGG - Intronic
991475180 5:67011224-67011246 AGGCTGCAGGGGAGGGGCTGGGG - Intronic
991686106 5:69183906-69183928 AGGGTGGGGGCGGGGGCCAGGGG - Intergenic
993476859 5:88376965-88376987 ATGGTGCAGGGGTGAGGCAGAGG - Intergenic
994141011 5:96341334-96341356 AGGGTGGAGGGGTGGGGTGGAGG - Intergenic
995349312 5:111156789-111156811 AGAGAGCAGGTGTGGGCCTGTGG - Intergenic
995410186 5:111848540-111848562 ACAGTGCAGTGTTGGGCCAGTGG + Intronic
997296220 5:132770574-132770596 AGGGGGCTGGTGTGGGCCAAAGG + Intronic
997476674 5:134146450-134146472 AGGGTGCTGCGGGGGGCCTGTGG - Exonic
997691674 5:135831595-135831617 AGGGGGCAGGGATTAGCCAGGGG + Intergenic
997693341 5:135842860-135842882 CGGGTGCAGGGGTGGGGATGGGG - Intronic
998181896 5:139951807-139951829 AGGCTGCCTGGGTGAGCCAGGGG - Intronic
998370224 5:141656016-141656038 AGGGTGCAGAGGTGGGCCAGAGG + Intronic
999200614 5:149813622-149813644 AAGGTGCAGCGGATGGCCAGTGG - Intronic
999448943 5:151664245-151664267 AGGAGGCAGGGGAGGGCCTGAGG + Intronic
1001647800 5:173295187-173295209 AGGATGTCGGGGTGGGCAAGTGG + Intergenic
1001809570 5:174617743-174617765 AGGGATCAGGGATGGGCTAGGGG - Intergenic
1001892241 5:175349366-175349388 AGGGAGCAGGTGAGGGCCAAGGG - Intergenic
1001984132 5:176059809-176059831 ATGGTGCAGGTGTGGGCCTCAGG - Intronic
1002098897 5:176847812-176847834 CGGGGGGAGGGGAGGGCCAGGGG - Intronic
1002196770 5:177505299-177505321 AGAGTGCTGGGCTGGGCAAGAGG + Intronic
1002233345 5:177784256-177784278 ATGGTGCAGGTGTGGGCCTCAGG + Intronic
1002262638 5:178005517-178005539 ATGGTGCAGGTGTGGGCCTCAGG - Intergenic
1002300145 5:178253244-178253266 CCGGGGCAGGGGTGGGGCAGGGG - Intronic
1002432759 5:179212733-179212755 AGTGGGCAGGTGTGGGCCTGAGG + Intronic
1002587143 5:180256386-180256408 TGTGGGCAGGGGTGGGGCAGGGG + Intronic
1002854188 6:1022977-1022999 AGGTTGGAGGGGTGGCCAAGGGG - Intergenic
1002877810 6:1226767-1226789 AGGCTGCCGGGGTGGGCCATGGG + Intergenic
1002936067 6:1673694-1673716 AGGGTCCAGGGGAGGGATAGAGG - Intronic
1003770224 6:9290883-9290905 AGGGTGCAGCGGTGGGCTGAAGG + Intergenic
1004235605 6:13872369-13872391 AGGGTGCAGTGGTGGGCTGAAGG + Intergenic
1004342359 6:14818848-14818870 AGGGTGCTGGGGGTGGGCAGGGG - Intergenic
1005243512 6:23856202-23856224 ATGGTGCAGGGGCTGGGCAGAGG - Intergenic
1005520583 6:26597388-26597410 AGGATGCTGGGGTGGGCGGGCGG + Intronic
1005943324 6:30577718-30577740 AGGGTGGAGTGGAGGGCCAGTGG + Intronic
1005979666 6:30827294-30827316 AGGGTGGAAGTGTGGGCAAGAGG + Intergenic
1006249036 6:32765123-32765145 AGGAAGAAGGGGTGGGCCAGAGG - Intergenic
1006470568 6:34226502-34226524 AGGGAGCAGGGGTGGAGGAGAGG + Intergenic
1006986454 6:38178747-38178769 GGGGGGGAGGGGTGGGGCAGAGG + Intronic
1007283906 6:40733841-40733863 AGGCTGCAGAGGTGGGCAGGAGG - Intergenic
1007362853 6:41371358-41371380 AGGGAGCAGGGCTGGGGAAGAGG - Intergenic
1007372073 6:41432530-41432552 AGGAGGCTGGGGTGGGCCAGGGG - Intergenic
1007391372 6:41551391-41551413 AAGGTGCAGGGCTGTGCCAGAGG - Intronic
1007558004 6:42782764-42782786 AGGGAGCAGGGCTCGGCGAGGGG + Intronic
1007716876 6:43861848-43861870 AGGGAGCAGGGATAGGGCAGGGG + Intergenic
1007775726 6:44223474-44223496 GGGTGGCAGGGGTGGGCCGGGGG + Intronic
1007787534 6:44289770-44289792 AGGGTGCAGGAATGGGCAAATGG - Intronic
1008678455 6:53845924-53845946 AGGGTGCAGGGGTGCCTGAGGGG - Intronic
1008796215 6:55306250-55306272 AGGGTGTATTGGTGGGCCAAGGG - Intergenic
1009407161 6:63326901-63326923 ATAGTGCAGCGGTGGGCCAAAGG + Intergenic
1009892052 6:69696726-69696748 AAGGTACAGGGATAGGCCAGAGG - Intronic
1010736564 6:79450471-79450493 ATGGGGCAGGGCAGGGCCAGGGG - Intergenic
1011568506 6:88707397-88707419 GGGGTGGAGGGGTGGGGCGGGGG + Intronic
1012306815 6:97669108-97669130 GGAGGGTAGGGGTGGGCCAGAGG - Intergenic
1012476699 6:99621515-99621537 AGGGGGCAGAGGTGGGGCTGGGG + Intergenic
1013138753 6:107309624-107309646 AGGATGCTGGGGTGTGCCACAGG + Intronic
1014243610 6:119043624-119043646 AAGGTGCCGAGGTGGGGCAGGGG - Intronic
1016898308 6:149075567-149075589 AGGTGGCAGGGGAGGGGCAGTGG - Exonic
1017751652 6:157494320-157494342 AGGGTGCAGGGGAAGGTCGGAGG - Intronic
1018917088 6:168140219-168140241 AGGGTGGGGTGGTGGGGCAGGGG - Intergenic
1019015226 6:168875388-168875410 GAGGTGCTGGGGTGGACCAGGGG + Intergenic
1019015321 6:168875891-168875913 GAGGTGCTGGGGTGGGCCAGGGG + Intergenic
1019075545 6:169384596-169384618 AGAGGGCAGGTGTGTGCCAGAGG + Intergenic
1019312941 7:371620-371642 AGGATGCAGAGGTGGGGCCGTGG + Intergenic
1019322219 7:420933-420955 AGGTTGGAGGGGTGGGACGGGGG - Intergenic
1019487195 7:1294763-1294785 TGGGTGCATGGGTGGGTCTGTGG + Intergenic
1019487294 7:1295245-1295267 TGGGTGCAGGGGTGGGTCTATGG + Intergenic
1019487360 7:1295555-1295577 TGGGTGCAGGGGTGGGTCTATGG + Intergenic
1019664662 7:2245807-2245829 AGATTGCAGGTGTGGGCCACTGG + Intronic
1019725914 7:2602655-2602677 AGGGGACATGGGTGGGGCAGGGG - Intronic
1020137765 7:5596140-5596162 AGTCTGCAGGGGTGGGCGTGGGG + Intronic
1020332909 7:7038443-7038465 TAGGGGCAGGGGTGGGCCATTGG - Intergenic
1021320503 7:19204363-19204385 TGGTTGCAGGGGTAGGCCAGTGG + Intergenic
1021537670 7:21723736-21723758 GGGGTGGAGGGGTGGGGGAGTGG - Intronic
1021918106 7:25455691-25455713 AGGGGGCAGAGGTGGGCAGGAGG - Intergenic
1022203141 7:28137312-28137334 AAGGGGCAGGGGTGGACCAGAGG + Intronic
1022833758 7:34094362-34094384 AGTGTGATGGGGTGGGCCTGGGG + Intronic
1023177438 7:37448112-37448134 AGGGGGCGGTGATGGGCCAGAGG - Intronic
1023583297 7:41704550-41704572 AGGGTTCATGTGTGGGTCAGGGG - Intergenic
1024042128 7:45564006-45564028 AGGCAGCAGCGGTGGGCAAGGGG + Intergenic
1024270585 7:47638559-47638581 AGGTAGCAGGGGTGGGTGAGGGG - Intergenic
1025777107 7:64569453-64569475 AGGGCGGAGAGGAGGGCCAGGGG + Intergenic
1025845408 7:65192306-65192328 TGGGTGCAGGGGTGGGAGTGAGG + Intergenic
1025895684 7:65698338-65698360 TGGGTGCAGGGGTGGGAGTGAGG + Intergenic
1027270371 7:76515426-76515448 AGGGTTTAGGGGAGGGCCATGGG + Exonic
1027512110 7:79096015-79096037 AGGGGGCAGGGCTGTGCCTGAGG + Intronic
1030657712 7:112186034-112186056 AGAGTGCTGGGCTAGGCCAGGGG + Intronic
1032078234 7:128846186-128846208 AGTGGGCAGGGCTGGGCAAGTGG + Intronic
1032090991 7:128911483-128911505 AGGGGGCAGGGCTGGGCCCTGGG + Intergenic
1032252944 7:130273331-130273353 AGGGGGCGGGGGTGGGGGAGTGG - Intronic
1032265538 7:130367694-130367716 ATGGTGCGGGGGTGGGGTAGGGG + Intronic
1032429036 7:131846044-131846066 AGGGAGCCAGGCTGGGCCAGTGG + Intergenic
1034243187 7:149624902-149624924 AGGGGCGAGGGGTCGGCCAGGGG - Intergenic
1034422022 7:150995534-150995556 GGGGTGCAGGGGTGGGATGGGGG - Intronic
1034422034 7:150995560-150995582 AGGGTGCAGGGGTGGGAGGGGGG - Intronic
1034422135 7:150995814-150995836 GGGATGCAGGGGTGGGACGGGGG - Intronic
1034422178 7:150995913-150995935 AGGGTGCAGGGATGGGACAGGGG - Intronic
1034422228 7:150996045-150996067 GGGGTGCAGAGGTGGGGTAGGGG - Intronic
1034422254 7:150996111-150996133 GGGGTGCAGGGGTGGGGTAGGGG - Intronic
1034422280 7:150996176-150996198 AGGGTACAGGGGTGGGAGAGGGG - Intronic
1034422328 7:150996308-150996330 GGGGTGCAGGGGTGGAACAGGGG - Intronic
1034425792 7:151013488-151013510 AGTGTGCAGGGGTGGCTGAGTGG - Intronic
1034432028 7:151045883-151045905 TGGGTCCCGGGGTGAGCCAGGGG - Intronic
1034459527 7:151190902-151190924 AGGGTAAAGGGATGGGGCAGAGG - Exonic
1034526711 7:151668524-151668546 AGGTTGCAGGTGTGAGCCATCGG - Intronic
1034546641 7:151793887-151793909 AGGCAGCAGGGGAGGGCCAGTGG + Intronic
1034590140 7:152131642-152131664 AGGCTGCAGGGTCGTGCCAGGGG + Intergenic
1035044102 7:155952796-155952818 TGGGTGCAGGGGAAGCCCAGCGG + Intergenic
1035225495 7:157430182-157430204 TGGGTGGATGGGTGGGTCAGCGG - Intergenic
1035305490 7:157928855-157928877 AGGATGGGGGGGTGGGACAGGGG + Intronic
1035999179 8:4582740-4582762 ACAGTGCAGCGGTGGGCCAAAGG - Intronic
1038114306 8:24535564-24535586 AGAGTTCAGCAGTGGGCCAGAGG - Intergenic
1038348501 8:26754828-26754850 ATGGAGCAGAGGTGGGGCAGGGG - Intronic
1039098352 8:33911935-33911957 AGGGTGAGGGAGTGGGACAGGGG + Intergenic
1039231062 8:35448755-35448777 AGGGTGAAAGGGTGGGAGAGGGG - Intronic
1039637234 8:39180027-39180049 ACAGTGCAGCGGTGGGCCAAAGG - Intronic
1039793280 8:40892074-40892096 AGGGTGGAGTGGTGGCCCAGTGG - Intronic
1040286546 8:46103433-46103455 AGGTGGCACGGGTGGGCCAAAGG - Intergenic
1040342358 8:46447399-46447421 AGGGTGGCTGTGTGGGCCAGAGG - Intergenic
1040442157 8:47454478-47454500 GGGGTGCGGGGGTGGGGAAGCGG + Intronic
1040515746 8:48133348-48133370 ACGGTGAAGGGGTGGCACAGTGG - Intergenic
1042533344 8:69835538-69835560 AGATTGCAGGGATGGGGCAGAGG + Intergenic
1042866104 8:73357886-73357908 AGGCTGCAGGGGTGGGGAAATGG - Intergenic
1045259619 8:100560602-100560624 AGCCTGCAGGTGTGGGCCAGGGG - Intergenic
1046357031 8:113100901-113100923 ATGGAGCAGAGGTGGGGCAGAGG + Intronic
1048351997 8:133623922-133623944 AGGGTGCAGTGCTGGGAGAGGGG - Intergenic
1048550869 8:135432726-135432748 AGGCTGAAGGTGGGGGCCAGAGG + Intergenic
1049023032 8:139970741-139970763 AGGGAGCAGGGCTGTGGCAGGGG + Intronic
1049207521 8:141370420-141370442 AGAGTGCAGGAGAGGGCCTGTGG - Intergenic
1049308974 8:141923415-141923437 AGGGTACTGGGGTTGGCCACAGG - Intergenic
1049351736 8:142168148-142168170 GGGGTGCAGGGGTGGGCCCTGGG - Intergenic
1049366339 8:142238664-142238686 AGTGTGCAGGGGAGGGGCTGGGG - Intronic
1049379586 8:142305339-142305361 AGGGCGCAGGGGTGGGAGGGGGG + Intronic
1049431593 8:142567699-142567721 GGGGTGCAAGGGAGGGCCAGAGG + Intergenic
1049477088 8:142801834-142801856 AGGGTGAATGGGTGGGTGAGTGG + Intergenic
1049610523 8:143552917-143552939 AGGGGGCAGGGGTAGGGGAGTGG + Intergenic
1049611269 8:143556718-143556740 CGTGTGCAGGGGTGGGCCCATGG + Intronic
1049758216 8:144320221-144320243 AGGCTTCAGGGCTGGGCCAAAGG + Intronic
1049773821 8:144395653-144395675 TGGGAGCAGGGGTGGGTGAGGGG + Intronic
1049784011 8:144441980-144442002 TGTGTGCAGGGGTGAGCCTGGGG - Intronic
1049884298 9:17323-17345 AGGTGGGAGGGGTGGGACAGAGG - Intergenic
1050819201 9:9856274-9856296 ATGGTGCAGGGCTGGGCCATGGG + Intronic
1050821925 9:9889862-9889884 AGGGTGCACGGGTTCTCCAGTGG + Intronic
1051202207 9:14639357-14639379 AGGGTGCATGGGTGGAGCGGGGG + Intronic
1051392791 9:16584190-16584212 GGGGTGGAGGGGTGGGCATGGGG + Intronic
1051419771 9:16877501-16877523 ACGGTGCAGCGGTGGGCCGAAGG + Intergenic
1051743226 9:20271147-20271169 AGGGTGCTGAGGTGGGTGAGTGG - Intergenic
1052251099 9:26398163-26398185 TGGGTGCGTGAGTGGGCCAGGGG - Intergenic
1052413680 9:28150177-28150199 ACGGTGCAGGGGCTGGGCAGAGG - Intronic
1052505241 9:29344996-29345018 GGGGTGGAGGGGTGGGGTAGTGG - Intergenic
1054448246 9:65388537-65388559 AGGGTGGAGGGCTGGTCCTGGGG + Intergenic
1056139412 9:83660655-83660677 GGGGTGGGGGGGTGGGGCAGCGG - Exonic
1056807602 9:89740982-89741004 AGGGGGCAGGGGTGGGGACGGGG - Intergenic
1056888636 9:90468598-90468620 AGGGTGATGGGGTGGGCCTTGGG - Intergenic
1056954493 9:91071427-91071449 AGGGTGCCGGCCAGGGCCAGAGG - Intergenic
1056965141 9:91159245-91159267 AAGGGGAAGGGGTGGGGCAGGGG + Intergenic
1057071901 9:92106068-92106090 ACGGTGCAGGGGCTGGGCAGAGG - Intronic
1057457524 9:95227963-95227985 AGGTTGCAGGGGTGGTTAAGAGG - Intronic
1057928112 9:99170749-99170771 GGGGAGCAGGGGTGGGGCTGGGG + Intergenic
1059197035 9:112380053-112380075 GGGGGGCAGGGGCGGGGCAGGGG + Exonic
1059696233 9:116732749-116732771 TGGTTGCAGGGGTGGGGGAGCGG + Intronic
1060229896 9:121818784-121818806 TGGGAGCAGGGGTCGGACAGGGG + Intergenic
1060431203 9:123552607-123552629 AGGGAGCACAGGTGAGCCAGAGG + Intronic
1060486637 9:124051881-124051903 TGGGTGCAGGGGTGGGATAATGG + Intergenic
1060811668 9:126614060-126614082 GGGGTGCAGGGGCGGCCCCGCGG - Intergenic
1060982918 9:127803791-127803813 AGGGAGGAGGGGTGTGCCAGGGG - Intronic
1061231672 9:129319236-129319258 GGGGGCCAGGGGAGGGCCAGAGG - Intergenic
1061297508 9:129684992-129685014 ATGGTGGAAGGGTGGCCCAGTGG - Intronic
1061507409 9:131039240-131039262 AGGCTGCAGGTGAGGGCGAGGGG + Exonic
1061744886 9:132732449-132732471 GGGCTGCAGGGCTGGGCCTGAGG + Intronic
1061865415 9:133489557-133489579 AGGGTGACAGGGTGGGCCTGGGG + Intergenic
1061896618 9:133651796-133651818 AGGGTGTGGGGGCGGGGCAGGGG - Intronic
1061899620 9:133666247-133666269 GGGGTGCAGGGGTGGCCCCCAGG - Intronic
1061918932 9:133771707-133771729 ACAGTGCAGGGGTGGGGTAGGGG - Intronic
1062088825 9:134663356-134663378 AGGGTGAAGGGCTGGGGCTGGGG + Intronic
1062097397 9:134710450-134710472 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097418 9:134710512-134710534 TGGGTGCAGTGGTGGGGCAGGGG + Intronic
1062097454 9:134710604-134710626 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097478 9:134710671-134710693 TGGGTGCAGTGGTGGGGAAGGGG + Intronic
1062097499 9:134710733-134710755 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097513 9:134710766-134710788 GGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097526 9:134710799-134710821 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097539 9:134710833-134710855 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097560 9:134710895-134710917 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097573 9:134710928-134710950 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097586 9:134710961-134710983 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097606 9:134711023-134711045 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062216487 9:135392351-135392373 AGGGGCCAGGAGTGGGCCACAGG + Intergenic
1062292948 9:135805550-135805572 AGAGAGCAGCGGTGGGCCAGTGG - Intergenic
1062359094 9:136178976-136178998 AGGGCTCAGGGCTGGGCCACAGG + Intergenic
1062360583 9:136186187-136186209 GGGGAGGAGGGGTGGGCAAGAGG - Intergenic
1062360588 9:136186200-136186222 AGGGTGGAGGGGTGGGGAGGAGG - Intergenic
1062512936 9:136917406-136917428 AGTCTGCAGGGGTGGAGCAGGGG - Intronic
1062546210 9:137064823-137064845 GGGGTGCAGGGGTGGGGGTGAGG - Intronic
1062591805 9:137277796-137277818 AGGGCGAGGGGGTGGGCCAGGGG - Exonic
1203520010 Un_GL000213v1:35906-35928 TTGGAGCAGGGGTGGGCCATTGG + Intergenic
1203470582 Un_GL000220v1:113949-113971 CGGGTGCGGGGGTGGGCGGGCGG + Intergenic
1203478403 Un_GL000220v1:157921-157943 CGGGTGCGGGGGTGGGCGGGCGG + Intergenic
1185546986 X:953804-953826 AGGGTGAATGGGTGGGTGAGTGG - Intergenic
1185839575 X:3376231-3376253 GGGGTGCAGGGGTGGGGAGGGGG - Intergenic
1186011481 X:5138977-5138999 AGGGTGGAGGGGGGGAACAGAGG + Intergenic
1186356884 X:8799782-8799804 AGTGGGGAGGGGTGGGGCAGGGG - Intronic
1186357210 X:8800897-8800919 AGTGGGTAGGGGTGGGGCAGGGG - Intronic
1186514186 X:10153973-10153995 AGGGTGGAGGGGATGGTCAGAGG + Intergenic
1188910363 X:35839818-35839840 AGGGTACTTGGGTGGGCAAGGGG + Intergenic
1189121537 X:38400489-38400511 AGGCAGCAGGAGTGGGCAAGAGG + Intronic
1189242666 X:39537549-39537571 GGGGTGCAGGGGTGGGAAGGGGG + Intergenic
1189751978 X:44231517-44231539 AGGGGGCAGGAGTGGGCAGGGGG - Intronic
1191251995 X:58264170-58264192 AGGGTGCATGTGTCGCCCAGGGG + Intergenic
1192152428 X:68720454-68720476 ATGGTGCAGGGGTGGGGTGGTGG + Intronic
1192905303 X:75544725-75544747 GGGGTGGGGGGGTGGGGCAGGGG - Intergenic
1194981868 X:100449740-100449762 AGGGTGCGGGGGTGGTTCAGGGG - Intergenic
1196283496 X:113852389-113852411 AGGGTAGTGGGGAGGGCCAGGGG - Intergenic
1197862990 X:130989956-130989978 AGGGAGTAGGGGTGGGCAGGAGG - Intergenic
1198678292 X:139154246-139154268 TGTGTGCAGGAGTGGGCAAGGGG + Intronic
1200215603 X:154366893-154366915 AGGGTGGAGGGGTGAGGCTGTGG - Intronic
1200256664 X:154586041-154586063 AGGGGGGAGGGGTGGGGGAGTGG + Intronic
1200261105 X:154618362-154618384 AGGGGGGAGGGGTGGGGGAGTGG - Intronic
1200401507 X:156022833-156022855 AGGTGGGAGGGGTGGGACAGAGG + Intergenic
1201291245 Y:12421786-12421808 AGGGGGCCGCGGTGGGCGAGGGG - Intergenic
1202101266 Y:21310224-21310246 GGGGGGCAGCGGTGGGGCAGCGG + Intergenic
1202187144 Y:22197382-22197404 GGGGGGCAGTGGTGGGACAGCGG + Intergenic
1202204216 Y:22389014-22389036 GGGGGGCAGTGGTGGGACAGCGG - Intronic
1202241113 Y:22770837-22770859 GGGGGGCAGTGGTGGGACAGCGG - Intergenic
1202394099 Y:24404580-24404602 GGGGGGCAGTGGTGGGACAGCGG - Intergenic
1202476686 Y:25265512-25265534 GGGGGGCAGTGGTGGGACAGCGG + Intergenic