ID: 1167385477

View in Genome Browser
Species Human (GRCh38)
Location 19:49160656-49160678
Sequence GTGTCAGAGGCCACCCTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167385473_1167385477 -9 Left 1167385473 19:49160642-49160664 CCAGAGCTTGCAGGGTGTCAGAG 0: 1
1: 1
2: 2
3: 18
4: 166
Right 1167385477 19:49160656-49160678 GTGTCAGAGGCCACCCTAAGGGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167385477 Original CRISPR GTGTCAGAGGCCACCCTAAG GGG Intronic
900747094 1:4367771-4367793 GTGTCTCAGGCCCCCCAAAGAGG - Intergenic
901529627 1:9844777-9844799 ATGACAGAGTCCACCCTGAGGGG + Intergenic
904002962 1:27349194-27349216 GGGTCAGAGGCAGCTCTAAGGGG + Intronic
908535816 1:65076039-65076061 GTTTCAGAGGCCAGCCAAAGAGG + Intergenic
910333103 1:86098212-86098234 GTGTCAGAGGTCAGAGTAAGGGG + Intronic
912459354 1:109820629-109820651 GTGTCAGAGCAGACCCTTAGTGG + Intergenic
913965151 1:143370681-143370703 GGGTCAGAGGCCACTGGAAGAGG + Intergenic
914059527 1:144196283-144196305 GGGTCAGAGGCCACTGGAAGAGG + Intergenic
914119623 1:144770088-144770110 GGGTCAGAGGCCACTGGAAGAGG - Intergenic
921812241 1:219528336-219528358 GTGTCTGAAGTCACTCTAAGTGG + Intergenic
923122080 1:231001416-231001438 GTGTCAGAGGCCATCCACGGTGG + Intergenic
924259943 1:242219473-242219495 GTGTCAGAGGCAATCCACAGAGG - Intronic
1064461827 10:15542062-15542084 GTGTCATTGGCCACCTTAAAAGG - Intronic
1064477729 10:15708831-15708853 GTGTCTGAGATCACCCTAATTGG - Intronic
1066443010 10:35456652-35456674 GTGTCTGAGGTGACCCTCAGAGG + Intronic
1067382454 10:45787487-45787509 GTGTCAGACACCAGCCAAAGTGG - Intronic
1067890152 10:50128035-50128057 GTGTCAGACACCAGCCAAAGTGG - Intronic
1073355461 10:102850363-102850385 GGGTCAAAGGCTACCCTGAGCGG + Intergenic
1074105069 10:110383198-110383220 GGGTGAGAGGCCACCCTCAGTGG + Intergenic
1076611144 10:131726638-131726660 GTGTCAGAGGTCACACGACGGGG - Intergenic
1077396399 11:2325432-2325454 GTGTCAGAGGTAATCCTCAGGGG + Intergenic
1077859239 11:6160397-6160419 GTGTCAGAGGCCCTACTTAGGGG - Intergenic
1081977064 11:47242444-47242466 GGTGGAGAGGCCACCCTAAGCGG + Intronic
1083492073 11:63020686-63020708 GTCTCAGCTGCCACCCTAAGTGG + Intergenic
1084026267 11:66452083-66452105 GGATCAGAGCCCACCCTAATTGG + Intronic
1087093908 11:94302497-94302519 ATGTCAGAGGCCAGCCGAAGGGG - Intergenic
1088994228 11:114982500-114982522 GTGTGAGGGGCCACCCAAAAAGG + Intergenic
1094672113 12:32580424-32580446 GTGTCAAGCGCCACGCTAAGAGG + Intronic
1094733453 12:33204957-33204979 GAGACAGAGGCCACCCCAAATGG - Intergenic
1095951531 12:47784338-47784360 GTGGGAGAGCCGACCCTAAGTGG - Intronic
1095982186 12:47979989-47980011 GTGTCAGAGGCCTCACTCACCGG + Exonic
1098594830 12:72259811-72259833 GTGTCAGGGTCCACACAAAGCGG - Intronic
1099437189 12:82658978-82659000 GTGTGAAAGGGCACCCAAAGGGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1106440843 13:29767964-29767986 ATATCAGAGGCCACCTTTAGAGG + Intronic
1112331827 13:98482825-98482847 GAGTCGGAGGCCACGCTAGGCGG - Intronic
1114055551 14:18964828-18964850 GTGTCCCAGGGCACCCTCAGTGG - Intergenic
1114106995 14:19436935-19436957 GTGTCCCAGGGCACCCTCAGTGG + Intergenic
1114244959 14:20904574-20904596 CTGTCAGAGCCCACCCACAGAGG + Intergenic
1116008820 14:39326944-39326966 GTGTCAGAGGGAGCCCTATGAGG - Exonic
1121100085 14:91244540-91244562 GTTTCAGAGTCCCCCCTCAGAGG - Intronic
1121996478 14:98607200-98607222 GAGTCAAAGGCCACCCGGAGAGG + Intergenic
1122021338 14:98840297-98840319 CTGTCACAGGCCCCTCTAAGAGG - Intergenic
1122780329 14:104140763-104140785 GTGTCAAAGGCCAAGCTCAGGGG - Intronic
1124632909 15:31347454-31347476 GCGTCAAAGGGCACCCTCAGGGG + Intronic
1126324261 15:47459237-47459259 GTCTTAGAGGCCACCAGAAGTGG - Intronic
1127988274 15:64092309-64092331 GGGTCAGAGGGCATACTAAGAGG - Intronic
1128577026 15:68783288-68783310 GTGTGAGAGGCCTCCAGAAGGGG - Intronic
1128607502 15:69047715-69047737 GTGGCAGAGCCCACTCTATGAGG - Intronic
1128768810 15:70266828-70266850 CTGTCAGAGGCCAGCCTCAGCGG - Intergenic
1129598837 15:76985482-76985504 GGAACAGAAGCCACCCTAAGGGG + Intergenic
1133110592 16:3545839-3545861 GTCCCAGAAGCCACCCTGAGGGG + Intronic
1134249041 16:12561658-12561680 GTGTGTGAGGGCACCCTCAGAGG - Intronic
1138556262 16:57772759-57772781 TTGCCAGAGACCACCCCAAGTGG - Intronic
1140016474 16:71191783-71191805 GTGCCTGTGGACACCCTAAGTGG - Intronic
1140701805 16:77588070-77588092 GTTTCAGAGGCCACCCAGATGGG + Intergenic
1141445822 16:84057503-84057525 GTGTCAGCGTCCTCCCTGAGAGG - Intronic
1145238873 17:21227981-21228003 GTTACAGAGGCCTTCCTAAGAGG + Intergenic
1151934513 17:77253845-77253867 ATGTAAGAGGCAACCCTAAGAGG - Intergenic
1152741186 17:82019171-82019193 GTGGCTGAGGCCACCCCCAGAGG - Exonic
1158348473 18:56540178-56540200 TTCTCAGAGGCCACCCTGGGAGG + Intergenic
1158543869 18:58379371-58379393 GTGACAGTGTCAACCCTAAGTGG - Intronic
1164272928 19:23689238-23689260 GTGTCAGAGGCCAGGCGCAGTGG + Intergenic
1164816670 19:31209471-31209493 GTCTCATAACCCACCCTAAGTGG + Intergenic
1166741636 19:45118147-45118169 GTGACACAGGCCAGCCTGAGGGG - Intronic
1167385477 19:49160656-49160678 GTGTCAGAGGCCACCCTAAGGGG + Intronic
1202698928 1_KI270712v1_random:148169-148191 GGGTCAGAGGCCACTGGAAGAGG + Intergenic
925292402 2:2756426-2756448 GTGTCAGAGGCGATCCTATTGGG - Intergenic
930962260 2:57276231-57276253 GTGTCAGTCGCCACCCTACTGGG + Intergenic
930995745 2:57715595-57715617 GTCTCAGAGGCCACCTGGAGTGG - Intergenic
934101029 2:88653096-88653118 TTATCAGAGGCAACCCTGAGTGG - Intergenic
934169878 2:89531650-89531672 GGGTCAGAGGCCACTGGAAGAGG + Intergenic
934280180 2:91605958-91605980 GGGTCAGAGGCCACTGGAAGAGG + Intergenic
934670616 2:96209968-96209990 GATCCAGAGGCCAGCCTAAGCGG + Intergenic
934715885 2:96543060-96543082 GGGTCAGAGGCTAGCCCAAGAGG + Intronic
939726452 2:145726931-145726953 GATTCAGAGGCCAGCCCAAGTGG + Intergenic
942378278 2:175359419-175359441 GTGATAGTGGCCACCCTAAGGGG - Intergenic
944928971 2:204496700-204496722 GTGTGAGAAGACACCCCAAGAGG - Intergenic
946491301 2:220151802-220151824 GTGTGAGAGGCCCCCATGAGTGG + Intergenic
948564898 2:238878524-238878546 TTGTCAGAGGCCAGCCTGTGGGG + Intronic
948949373 2:241239053-241239075 GAGTCAGAGGCTACCCCAGGAGG - Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1172728507 20:37066480-37066502 CTGTCAGAGGCAACCGTAGGAGG - Intronic
1173183384 20:40821057-40821079 GTTTCAGAGGTCTCCCTAACTGG + Intergenic
1176174005 20:63709178-63709200 TTGTCAGATGCCAACCTTAGGGG + Intronic
1180474028 22:15687380-15687402 GTGTCCCAGGGCACCCTCAGTGG - Intergenic
1181477865 22:23179980-23180002 GTGTCAGAGGCCACCATCGTGGG - Intronic
1183263118 22:36808909-36808931 TTCTCAAAGGCCACCCTAAAAGG - Intronic
1185288511 22:50012949-50012971 GGGTCCGAGGACACCCTAATGGG + Intergenic
949998995 3:9641944-9641966 GATCCAGAGGCCACCCAAAGGGG - Intergenic
961116784 3:124336560-124336582 GTGTGAAAGGCCTCCCCAAGGGG + Intronic
962932252 3:140049215-140049237 CAGTCAGAGGCCACCCAAAGGGG - Intronic
963642786 3:147879627-147879649 CTTTCAAAGGCCACCCAAAGGGG - Intergenic
968050999 3:195654904-195654926 GTGTCAGTGGCCACGCCAGGAGG - Intergenic
968104826 3:195993434-195993456 GTGTCAGTGGCCACACCAGGAGG + Intergenic
968303122 3:197631018-197631040 GTGTCAGTGGCCACGCCAGGAGG + Intergenic
968882155 4:3306720-3306742 GTGTCTGAGCCCACCCTCTGTGG + Intronic
973722097 4:53734709-53734731 GTGTCAAAGGCAACCCTAACTGG - Intronic
980651829 4:135726656-135726678 TTGTCAGATGCCACCCTGTGAGG + Intergenic
984490666 4:180430993-180431015 GTATCCGAGGCCTCCCTAAAAGG - Intergenic
985507626 5:292920-292942 GTGTCAGTGGCCACGCCAGGAGG - Intronic
992386439 5:76289186-76289208 GCTTCAGAGGACACCTTAAGAGG - Intronic
993060821 5:83036719-83036741 GTGTCAGTTGTCAGCCTAAGGGG + Intergenic
997358143 5:133277684-133277706 GCATCAGGGGCCACCCCAAGGGG - Intronic
1002232940 5:177782236-177782258 GCCTCAGAGGGCACCCTCAGAGG - Exonic
1003012132 6:2435953-2435975 GGGTCAGAGGACACCCACAGAGG + Intergenic
1004743781 6:18490189-18490211 TTGTCAGATTCCACCCTATGGGG + Intergenic
1009548697 6:65057816-65057838 GTTTCAGATGTCATCCTAAGTGG - Intronic
1011042715 6:83048237-83048259 GTGTTCCAGGCCACGCTAAGGGG + Intronic
1013603217 6:111724714-111724736 GTCTCAGAAGCCAACCTAGGTGG + Intronic
1017755572 6:157526401-157526423 GGGACAGAGGCCACCAGAAGAGG - Intronic
1019686426 7:2384489-2384511 AAGTCAGAGCCCACCCTGAGGGG + Intergenic
1023021445 7:36015211-36015233 GTGTCAGAGGAAACCCTACAGGG - Intergenic
1024169359 7:46768288-46768310 GATTCAGAGGCCAGCCCAAGAGG + Intergenic
1032422907 7:131797458-131797480 GAGGCAGAGGTCACCCCAAGAGG - Intergenic
1032840625 7:135710949-135710971 GTGGCAGAGTCCACTCTGAGAGG + Intronic
1035600048 8:892017-892039 TTGACAGTGGCCATCCTAAGGGG - Intergenic
1040290135 8:46119990-46120012 GTGTCAGCGGCCTCCCAAGGAGG - Intergenic
1042483535 8:69328616-69328638 GTGTCAGTGGCCACGCCAGGAGG - Intergenic
1056617415 9:88180444-88180466 GTGTCTGGGGCCGCCCTGAGCGG - Intergenic
1060583314 9:124770881-124770903 GGGTGAAGGGCCACCCTAAGGGG + Intronic
1187007391 X:15246117-15246139 CTGTCAGAGGCAACCGTAGGAGG + Intronic
1187510146 X:19910356-19910378 GTGTCATTGGCCACCCTCGGTGG - Intergenic
1189093184 X:38109402-38109424 GTGTCAGAGTCCACTTTAGGAGG + Intronic
1196886660 X:120251783-120251805 GTCTCTGGGGCCACCCTGAGTGG + Intronic
1198820397 X:140640951-140640973 TTGTCAATGGCCTCCCTAAGAGG - Intergenic