ID: 1167389773

View in Genome Browser
Species Human (GRCh38)
Location 19:49187150-49187172
Sequence ACCCTCTTACTGAAATTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167389768_1167389773 30 Left 1167389768 19:49187097-49187119 CCACTGAACTGGGGAGCTGGGGG 0: 1
1: 0
2: 4
3: 56
4: 490
Right 1167389773 19:49187150-49187172 ACCCTCTTACTGAAATTTAGTGG 0: 1
1: 0
2: 1
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167389773 Original CRISPR ACCCTCTTACTGAAATTTAG TGG Intronic
908264990 1:62369493-62369515 TCCCCCTTACTCAAATCTAGTGG + Intergenic
909133606 1:71769369-71769391 ACTCTGTTCCTGAAATTAAGGGG - Intronic
912562080 1:110558098-110558120 ACCCTTTTATAGAAAGTTAGAGG + Intergenic
917989951 1:180364656-180364678 ACCATCTTTTGGAAATTTAGTGG + Intronic
919263163 1:195224491-195224513 ACCCTCCCACAGAAATGTAGAGG - Intergenic
920715266 1:208334743-208334765 ACCTTCTCACTGCAATCTAGAGG + Intergenic
921454250 1:215348700-215348722 ACCTTCTGACTGCAATATAGAGG + Intergenic
921805750 1:219452546-219452568 ACACTGGTACTGCAATTTAGTGG - Intergenic
923270870 1:232353993-232354015 AACCTTTTCCTGATATTTAGTGG - Intergenic
924289303 1:242522491-242522513 ATTCTCTTACTGAAAATCAGTGG - Intronic
1063867865 10:10386415-10386437 ACCTTCTTACTTAAATAAAGAGG + Intergenic
1065265025 10:23965884-23965906 CCACTCTTGCTGAAAGTTAGTGG - Intronic
1067677352 10:48394229-48394251 ACACTCTTTCTGAAAATAAGAGG + Intronic
1068561646 10:58521451-58521473 ACCTTATTAGTGAAATTTTGGGG + Intronic
1080867974 11:36212461-36212483 ACCCTCTCACTGAGTTTTAGTGG + Intronic
1085347709 11:75778983-75779005 GCCCTCTTTCTCAGATTTAGGGG + Intronic
1086202071 11:84215973-84215995 AACACCTTACTGCAATTTAGTGG + Intronic
1086984327 11:93232081-93232103 AAACTCTTACTGAAGGTTAGGGG - Intergenic
1088916000 11:114228432-114228454 AACCTCCAACTGAAATTCAGTGG - Intronic
1095992758 12:48048412-48048434 ACCATCTTTCTGAAACTTTGTGG - Intronic
1098147587 12:67513374-67513396 ACTCTCTTTCTGAAAATCAGTGG - Intergenic
1109528866 13:63613964-63613986 AACCTCTTTCTGGAAATTAGAGG + Intergenic
1116756407 14:48954019-48954041 AACCTCTAAATGAAAGTTAGTGG - Intergenic
1117664135 14:58038838-58038860 AACTTCTAACTGAATTTTAGTGG - Intronic
1118525066 14:66630950-66630972 CCCCTCTTACTTAACTTTAGTGG + Intronic
1119484533 14:74979122-74979144 AGCCTCTGACTGCAATTTATTGG + Intergenic
1128747497 15:70124877-70124899 TCCCTGGTACTGAAATTTAGAGG - Intergenic
1128805826 15:70530598-70530620 ACACACTTCCTCAAATTTAGAGG + Intergenic
1130431206 15:83848972-83848994 ACTGTCTTATTGAAATTTGGTGG - Intronic
1131948856 15:97658113-97658135 AAGCTCTTGCTGACATTTAGAGG - Intergenic
1132022206 15:98372343-98372365 AGCCTCTACATGAAATTTAGAGG - Intergenic
1133575986 16:7090583-7090605 ACCTTCTTAAAGAAATTTAAGGG - Intronic
1142319566 16:89372260-89372282 AGCCTCTCACTGAGATTAAGAGG + Intronic
1143198583 17:5096686-5096708 ACCTTATTACTGAAATTTCAGGG + Intergenic
1146542968 17:33713345-33713367 ACCCTCTTTCTGAAGGCTAGAGG + Intronic
1150524724 17:65910252-65910274 GCCTTCATACTGAAATTCAGAGG + Intronic
1154984010 18:21531094-21531116 AACCTAAAACTGAAATTTAGGGG + Intronic
1155588518 18:27397415-27397437 AACTTCTTGCTGAAATTTAAAGG - Intergenic
1155603926 18:27581917-27581939 ACACTCTTACTCAAATTACGTGG + Intergenic
1167389773 19:49187150-49187172 ACCCTCTTACTGAAATTTAGTGG + Intronic
929985941 2:46732505-46732527 ACACTGTTAATGAAACTTAGTGG + Intronic
930758183 2:55000879-55000901 AATCTCTTAATGAAATTTATTGG - Intronic
930967205 2:57343799-57343821 ACTGTCTCACTGAAATGTAGTGG - Intergenic
936111951 2:109671766-109671788 TCACTCTTAATGAAATTTAAGGG + Intergenic
941522382 2:166562252-166562274 AATCTATTACTGAAATTCAGAGG - Intergenic
941622937 2:167798863-167798885 ACAATCTGACTGTAATTTAGTGG - Intergenic
941699076 2:168584697-168584719 ATCCTTTCACTGAAATTGAGAGG + Intronic
943671586 2:190667318-190667340 AACATCTTACTGAAAATCAGAGG + Intronic
945749129 2:213758241-213758263 TCCCTCTTACTGAGAGTTTGCGG - Intronic
947457397 2:230267721-230267743 ACACTTATACTGAAATATAGTGG - Intronic
947870839 2:233437062-233437084 ACCCTCGTCCTGAAAGTTTGAGG + Intronic
1173080576 20:39863202-39863224 ACTCTCAGACTGAAATTGAGTGG - Intergenic
1175583728 20:60120934-60120956 ACCCTCCTGCTGAAATCTTGGGG + Intergenic
1176891095 21:14320390-14320412 ACACTTTTGCTGAGATTTAGGGG + Intergenic
1182410953 22:30185731-30185753 AACCTATAACTGAAATTTATAGG + Intergenic
949939179 3:9141237-9141259 ACCCTCTCAATGAAGATTAGTGG - Intronic
960789557 3:121413265-121413287 TCTCTCCTACTGAAATTCAGCGG + Exonic
971103184 4:23492627-23492649 ACCCTCTTTCAGAAAATTATTGG - Intergenic
975215632 4:71750998-71751020 ACTCTATTTCTGAAATATAGAGG - Intronic
980266377 4:130522444-130522466 ACCCTCTCACTGAAAGTCATTGG + Intergenic
981763915 4:148226124-148226146 AAGATCTTACTGAAATTTTGAGG - Intronic
989022761 5:37029006-37029028 AAACTCTTAGTGAAATCTAGAGG + Intronic
1005715386 6:28542616-28542638 GCCCCCTTTCTAAAATTTAGAGG - Intergenic
1008152511 6:47971574-47971596 AACTTCTTTCTGAAATTTGGAGG - Intronic
1009590396 6:65662234-65662256 AACCTCTTCCAGAAATTAAGTGG - Intronic
1010131756 6:72502393-72502415 ATCCTCTTACTCAAACTCAGAGG + Intergenic
1010186064 6:73144614-73144636 ACCCTCTCCCTCAGATTTAGTGG + Intronic
1019845883 7:3500394-3500416 ACCCTCTTTCTTAGATTTACTGG + Intronic
1021802542 7:24321788-24321810 ATCCATTTACTGTAATTTAGTGG - Intergenic
1022270311 7:28800697-28800719 GCACTCTTTCTGAAATTTAGTGG - Intronic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1033080596 7:138293605-138293627 ACCCTTTTACTGACATTTTCCGG + Intergenic
1033577876 7:142703623-142703645 ATCCTATTACTGCAAATTAGTGG - Intergenic
1040689688 8:49921057-49921079 ACCCTCTTTCTAAAATTAATGGG - Intronic
1042281147 8:67057582-67057604 ACCCTCTTACTGAACTTTTATGG - Intronic
1042418246 8:68552638-68552660 ATCCTTGTACTGTAATTTAGGGG + Intronic
1042497933 8:69476530-69476552 GCCCTGTTACTGAAAATTTGTGG + Intronic
1043481460 8:80656975-80656997 ACCCTATTACACCAATTTAGAGG + Intronic
1043994481 8:86796114-86796136 AACCTGTTACTGACAATTAGAGG - Intergenic
1044006381 8:86942032-86942054 ACTCTCCTACTGTAATTTGGTGG - Intronic
1047802820 8:128327417-128327439 ATCCTCATAGTGAAATTTAGTGG - Intergenic
1051551319 9:18332788-18332810 ACACTCTTACTGAACTCTGGCGG - Intergenic
1052062808 9:23981999-23982021 ACCCTCAAATTGATATTTAGAGG - Intergenic
1052412490 9:28140269-28140291 ACCATTTTACGGAAATTTGGGGG - Intronic
1059138061 9:111826255-111826277 GTCTTCTTACTGTAATTTAGAGG - Intergenic
1060873581 9:127062760-127062782 AAACTGTAACTGAAATTTAGTGG - Intronic
1189579384 X:42389619-42389641 ACCCTCTCCATGAAGTTTAGTGG + Intergenic
1192844292 X:74889406-74889428 ACACTATTACTGAAATTTAGAGG - Intronic
1194183647 X:90744238-90744260 AACCTCTTACTTTAATTTAAAGG + Intergenic
1196320176 X:114277989-114278011 TCTCTGTTTCTGAAATTTAGAGG - Intergenic
1197695304 X:129543236-129543258 ACTCTTTTATTGTAATTTAGTGG + Intronic