ID: 1167398172

View in Genome Browser
Species Human (GRCh38)
Location 19:49245372-49245394
Sequence CTGCTCCTCTAGGGCTGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167398163_1167398172 30 Left 1167398163 19:49245319-49245341 CCCCATTGCAGTTTGAGAGGCTT No data
Right 1167398172 19:49245372-49245394 CTGCTCCTCTAGGGCTGCAATGG No data
1167398165_1167398172 28 Left 1167398165 19:49245321-49245343 CCATTGCAGTTTGAGAGGCTTTA No data
Right 1167398172 19:49245372-49245394 CTGCTCCTCTAGGGCTGCAATGG No data
1167398164_1167398172 29 Left 1167398164 19:49245320-49245342 CCCATTGCAGTTTGAGAGGCTTT No data
Right 1167398172 19:49245372-49245394 CTGCTCCTCTAGGGCTGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167398172 Original CRISPR CTGCTCCTCTAGGGCTGCAA TGG Intergenic
No off target data available for this crispr