ID: 1167399524

View in Genome Browser
Species Human (GRCh38)
Location 19:49255632-49255654
Sequence CCACAGAGGGAGATCGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167399510_1167399524 24 Left 1167399510 19:49255585-49255607 CCGAGGCGCACACCTGGGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 174
Right 1167399524 19:49255632-49255654 CCACAGAGGGAGATCGGGGATGG No data
1167399515_1167399524 12 Left 1167399515 19:49255597-49255619 CCTGGGGGTGGACACGGTGGGCA No data
Right 1167399524 19:49255632-49255654 CCACAGAGGGAGATCGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167399524 Original CRISPR CCACAGAGGGAGATCGGGGA TGG Intergenic
No off target data available for this crispr