ID: 1167401882

View in Genome Browser
Species Human (GRCh38)
Location 19:49278259-49278281
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167401880_1167401882 -10 Left 1167401880 19:49278246-49278268 CCACTAAATGCTAAAAAGCCATT No data
Right 1167401882 19:49278259-49278281 AAAAGCCATTTGGCAAAATGCGG No data
1167401879_1167401882 30 Left 1167401879 19:49278206-49278228 CCACAAGGAGAGTTCAATATTTA No data
Right 1167401882 19:49278259-49278281 AAAAGCCATTTGGCAAAATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167401882 Original CRISPR AAAAGCCATTTGGCAAAATG CGG Intergenic
No off target data available for this crispr