ID: 1167402604

View in Genome Browser
Species Human (GRCh38)
Location 19:49282893-49282915
Sequence CTTGGTTAACAGAGGATGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167402598_1167402604 -5 Left 1167402598 19:49282875-49282897 CCTCACCTTGCTGTCTCACTTGG No data
Right 1167402604 19:49282893-49282915 CTTGGTTAACAGAGGATGGGCGG No data
1167402596_1167402604 21 Left 1167402596 19:49282849-49282871 CCAGCTAACTTCTGAGTCTCTAT No data
Right 1167402604 19:49282893-49282915 CTTGGTTAACAGAGGATGGGCGG No data
1167402597_1167402604 -4 Left 1167402597 19:49282874-49282896 CCCTCACCTTGCTGTCTCACTTG No data
Right 1167402604 19:49282893-49282915 CTTGGTTAACAGAGGATGGGCGG No data
1167402600_1167402604 -10 Left 1167402600 19:49282880-49282902 CCTTGCTGTCTCACTTGGTTAAC No data
Right 1167402604 19:49282893-49282915 CTTGGTTAACAGAGGATGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167402604 Original CRISPR CTTGGTTAACAGAGGATGGG CGG Intergenic
No off target data available for this crispr