ID: 1167402604 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:49282893-49282915 |
Sequence | CTTGGTTAACAGAGGATGGG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1167402598_1167402604 | -5 | Left | 1167402598 | 19:49282875-49282897 | CCTCACCTTGCTGTCTCACTTGG | No data | ||
Right | 1167402604 | 19:49282893-49282915 | CTTGGTTAACAGAGGATGGGCGG | No data | ||||
1167402596_1167402604 | 21 | Left | 1167402596 | 19:49282849-49282871 | CCAGCTAACTTCTGAGTCTCTAT | No data | ||
Right | 1167402604 | 19:49282893-49282915 | CTTGGTTAACAGAGGATGGGCGG | No data | ||||
1167402597_1167402604 | -4 | Left | 1167402597 | 19:49282874-49282896 | CCCTCACCTTGCTGTCTCACTTG | No data | ||
Right | 1167402604 | 19:49282893-49282915 | CTTGGTTAACAGAGGATGGGCGG | No data | ||||
1167402600_1167402604 | -10 | Left | 1167402600 | 19:49282880-49282902 | CCTTGCTGTCTCACTTGGTTAAC | No data | ||
Right | 1167402604 | 19:49282893-49282915 | CTTGGTTAACAGAGGATGGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1167402604 | Original CRISPR | CTTGGTTAACAGAGGATGGG CGG | Intergenic | ||
No off target data available for this crispr |