ID: 1167406134

View in Genome Browser
Species Human (GRCh38)
Location 19:49309982-49310004
Sequence ATGGAGAAGTAGAAGTAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 971
Summary {0: 1, 1: 0, 2: 3, 3: 97, 4: 870}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167406134 Original CRISPR ATGGAGAAGTAGAAGTAGAA GGG (reversed) Intronic
901336828 1:8456669-8456691 ATGGAGAAGATGAAGTCGGAAGG - Intronic
902130372 1:14255139-14255161 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
902778575 1:18690356-18690378 ATAGAGAAGAGGAAGCAGAAAGG - Intronic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903080863 1:20811252-20811274 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
903108466 1:21106534-21106556 AAGTTGAAATAGAAGTAGAAAGG + Intronic
903467421 1:23561496-23561518 AAGAAGAAGAAGAAGAAGAATGG - Intergenic
903729609 1:25482553-25482575 TTGGAGAAGTAGAAGAGGAGGGG - Intronic
903737024 1:25536396-25536418 ATGGAGAAGTAGGAGGACACAGG + Intergenic
904107472 1:28098006-28098028 AAGGAGAAGAAGAAGAAGACTGG - Intergenic
904671867 1:32171972-32171994 AGGAAGAAGAAGAAGAAGAAAGG - Exonic
904783160 1:32965516-32965538 ATGGGGAACTAGAAAAAGAAAGG - Intergenic
905411029 1:37768048-37768070 ATAGTGAGGTAGAAGTAGAGAGG - Intergenic
905452436 1:38065286-38065308 AGGGAGAAGTCGTAGTAGGAGGG + Intergenic
905674339 1:39815238-39815260 AGATAGAAGTAGAAGTAGCAGGG + Intergenic
906167490 1:43697718-43697740 ATGGGAAAGTAAAAGTAAAAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906456503 1:46001778-46001800 AGGGAGAAGAAGAAGCAAAAAGG - Intronic
906477933 1:46182333-46182355 ATGGAGAAGGAGCAGTGGGAGGG + Intronic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
907133948 1:52121565-52121587 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
907640181 1:56181177-56181199 ATGGAGAAGATACAGTAGAAAGG + Intergenic
907730948 1:57065075-57065097 ATGGAGAAAAAGCAGTGGAATGG + Intronic
907911725 1:58833202-58833224 ATAGAGAACTAGGGGTAGAAGGG + Intergenic
908051650 1:60239334-60239356 ATGGAAAAATAGAAATAAAAGGG + Intergenic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
908675994 1:66604900-66604922 ATGGAGAAGTAGAAAAATAGTGG - Intronic
908903666 1:68984216-68984238 AAGGAGAAATAGAGGAAGAAAGG - Intergenic
908943789 1:69469393-69469415 AGTGAGAAGTGAAAGTAGAAGGG - Intergenic
909344887 1:74573169-74573191 AGGGAGCAGCAGAAGCAGAAGGG - Exonic
909539269 1:76772474-76772496 ATAGAGAAGTAGCTGGAGAAGGG - Intergenic
909584453 1:77273968-77273990 GTGGGGAAGTAGAAGTAGCAAGG + Intergenic
909584467 1:77274153-77274175 ATGGAGTACTAGAATAAGAATGG - Intergenic
910275697 1:85446817-85446839 AGAGAGAAGGAGAAGAAGAAAGG - Intronic
911553426 1:99312731-99312753 AAGCAGAAGTAGGAGTAGGAGGG + Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
912114514 1:106388638-106388660 AAGGAGAAGGAGAAGTAGTAGGG + Intergenic
912456153 1:109798848-109798870 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
912585592 1:110762105-110762127 ATTAAGCAGTAGAAGTGGAAGGG + Intergenic
912883015 1:113437736-113437758 ATGAAGAAGAAGAAGAGGAAAGG - Intronic
913216145 1:116622125-116622147 CTGGAAAAGTAGATGTAAAATGG - Intronic
913238588 1:116807188-116807210 ATGGAGAAGAATAAGAATAAAGG - Intergenic
913239300 1:116815407-116815429 GTGCAGAAATAGAACTAGAAGGG - Intergenic
913540906 1:119819996-119820018 AGGGAGAAAGAGAAGAAGAAGGG - Intergenic
915206388 1:154273383-154273405 ATGAGGAAGAAGAAGAAGAAGGG + Exonic
916206206 1:162318641-162318663 ATCAAGAAGAAGAAGAAGAAAGG - Intronic
916229296 1:162523831-162523853 ATAATGAGGTAGAAGTAGAAAGG + Exonic
916340216 1:163725319-163725341 AGGGAGAAAAAGAAGTATAAGGG - Intergenic
916349440 1:163832329-163832351 ATGGAGAACTAGAAAGAGAAAGG + Intergenic
916616257 1:166444168-166444190 AGAGAGAAGGAGAAGGAGAAAGG + Intergenic
916616266 1:166444252-166444274 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
917332455 1:173895596-173895618 CTGGAGGTGTAGAGGTAGAATGG - Exonic
917624983 1:176836610-176836632 AAGAAGAAGAAGAAATAGAAGGG - Intronic
917779032 1:178371563-178371585 ATGGAGGAGGAGGAGAAGAAAGG + Intronic
917965688 1:180177108-180177130 ATTGAGAAATAGAAGCAGCAAGG - Intronic
917985736 1:180316596-180316618 ATGAAGAATTAGAAATTGAAAGG - Intronic
919016767 1:192048510-192048532 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919016798 1:192048676-192048698 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919207193 1:194432634-194432656 ATGTAGAAGTAAAAGTAAATAGG + Intergenic
919267303 1:195286342-195286364 AGGAAGAAGAAGAAGAAGAAGGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
920063264 1:203244057-203244079 AGGTAGAAGGAGAAGAAGAAGGG + Intronic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920106811 1:203559213-203559235 ATATAGAAGTAGAAGAAGGAGGG + Intergenic
920521254 1:206628700-206628722 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
920796262 1:209140118-209140140 TTGTAGAGGTGGAAGTAGAAGGG + Intergenic
921045424 1:211473455-211473477 ATGGAAAAAAAGAAGGAGAAGGG + Intergenic
921169138 1:212530328-212530350 ATGGAGATGTAGAAGGGGAGAGG - Intergenic
921219230 1:212961468-212961490 AGGGAGAAAGAGAAGCAGAAGGG - Intronic
921397055 1:214679620-214679642 AAGGAGAAGAAGAAGAAGAATGG - Intergenic
921405205 1:214771566-214771588 ATGTAGAAGTTGCAGGAGAATGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921805507 1:219449525-219449547 ATGGAGAAGTAGAAGTGCATTGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923912048 1:238459846-238459868 TGGGAGAAGTGGAAGTGGAAGGG + Intergenic
924355394 1:243169575-243169597 ATGGAGAAAGAGAAGAAAAAAGG + Intronic
924448775 1:244159018-244159040 GAGGAGAAGGAGAAGAAGAAGGG - Intergenic
924493041 1:244558762-244558784 AAGGAGAAGGAGAAGGAGAGGGG - Intronic
1062970504 10:1644458-1644480 AGGGAGAAGGAGAAGGACAAAGG + Intronic
1063057218 10:2518958-2518980 AGGAAGAAGAAGAAGAAGAAGGG + Intergenic
1063071373 10:2669810-2669832 AGGAAGAAGAAGAAGAAGAAGGG + Intergenic
1063105572 10:2988751-2988773 ATGGAGAGGCACAACTAGAAGGG + Intergenic
1063358543 10:5427419-5427441 ATGGAGAAGGAGAAGAAGTGGGG - Intronic
1063517713 10:6712907-6712929 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1064054219 10:12083827-12083849 ATGAAGCAGTAAAACTAGAAGGG - Intronic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1066017335 10:31260916-31260938 AAGGAGAAGGAGTAGTAGGAGGG - Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066473402 10:35721530-35721552 ATGTAGAAGTAGAAAATGAAAGG + Intergenic
1066527687 10:36298971-36298993 AAGGAGAAGGAGAAGAAGATAGG - Intergenic
1066626936 10:37416668-37416690 ATGGTGAAATAGAGGTATAATGG + Intergenic
1066648410 10:37634116-37634138 TTGGAGCAGAAGAAGTGGAAGGG + Intergenic
1067169045 10:43890827-43890849 GAGGAGAAGGAGAAATAGAAAGG - Intergenic
1067193100 10:44089097-44089119 ATGAAGAGGTAGAAGTAGCAGGG + Intergenic
1068067268 10:52147691-52147713 ATAAGGCAGTAGAAGTAGAAAGG + Intronic
1068211002 10:53920579-53920601 ATGGAAGACTAGAAGTAGAGCGG + Intronic
1068786278 10:60978727-60978749 AAGAAGAAGTAGAAGAAGAAAGG - Intronic
1069225953 10:65944371-65944393 GTGGAGAAGCAGATGTATAATGG + Intronic
1070227325 10:74523375-74523397 ATGGGGAAGTAGAGAAAGAAAGG - Intronic
1070267983 10:74923221-74923243 AAGGAGTAGGAGAAGTAGAAGGG + Intronic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071885324 10:89943558-89943580 TTGGAGAATAAGAAGTGGAAGGG - Intergenic
1071991685 10:91105754-91105776 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1072567554 10:96629940-96629962 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
1072785381 10:98276044-98276066 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1072961093 10:99929871-99929893 ATGGAGAATTTGGAGTATAATGG - Intronic
1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG + Intronic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1073594955 10:104790311-104790333 ATGGAGAAGTAAGAGAAGAGGGG + Intronic
1073963506 10:108961362-108961384 ATAGGGTAGTAAAAGTAGAAAGG - Intergenic
1074256327 10:111806273-111806295 ATGGAGAAGATGATGTGGAAAGG - Intergenic
1074261117 10:111854473-111854495 ATGGAGAAATAAAAGAAGAGGGG - Intergenic
1074700517 10:116088090-116088112 ATGGAGAACCAGAAGGACAAAGG + Intronic
1074717918 10:116236680-116236702 ATGGAGTTGAAGAAGGAGAATGG + Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1074874032 10:117600641-117600663 AGGGAGGAGGAGAAGGAGAAGGG - Intergenic
1075390821 10:122090244-122090266 ATGGAAAAGTAGATACAGAAGGG + Intronic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1077832277 11:5886412-5886434 ATTGAGAATTAGAATTAGACAGG - Intronic
1078282741 11:9919250-9919272 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1078294378 11:10052361-10052383 ATGGTGAAGTCAAGGTAGAAGGG - Intronic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078750963 11:14163449-14163471 CTGGAGAAATAAAAGGAGAATGG - Intronic
1079074493 11:17375548-17375570 ATGGGCAAGGAGAACTAGAAAGG - Exonic
1079427152 11:20354490-20354512 AAGGAAAAGTGGAAGGAGAATGG - Intergenic
1079567855 11:21904618-21904640 ATGGAGAAAGGGAAGGAGAATGG + Intergenic
1079636555 11:22749189-22749211 AAGGAGAAGGTGAAGGAGAAGGG - Exonic
1079796167 11:24805799-24805821 ATGGAGAAGTAAGACGAGAAAGG + Intronic
1079975731 11:27089673-27089695 ATGGAGTATTAGAAGTGGATGGG - Intronic
1080233110 11:30040128-30040150 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1080453690 11:32399687-32399709 ATGGAGCAGTAAAGGCAGAAAGG + Intronic
1080750938 11:35149600-35149622 ATGGAAAAATAGAAGTAAATGGG - Intronic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1082645791 11:55723077-55723099 ATGGCGAAACACAAGTAGAAAGG + Intergenic
1082758488 11:57102465-57102487 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1082939385 11:58687933-58687955 ATAGAGCAGTAGAAAGAGAAGGG + Intronic
1083841180 11:65305085-65305107 ATGGAGATGATGAAGTTGAAAGG - Intronic
1084884679 11:72195932-72195954 GTGGGGAAGTAGAAATGGAAAGG - Exonic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1087166315 11:95007321-95007343 ATAGAGAAGTAAAAGCAGAGAGG + Intergenic
1087356362 11:97098696-97098718 ATGGAGGAGTGGAAGTGAAAGGG + Intergenic
1087728948 11:101756967-101756989 ATGGAGAAGTGAATTTAGAAAGG + Intronic
1088028118 11:105211303-105211325 ATGAAGAAGAAGAAGCACAATGG - Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088047613 11:105472788-105472810 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1088095178 11:106091446-106091468 ATGGAGAGGAAGAAAAAGAATGG + Exonic
1089057625 11:115599386-115599408 AAGGGGAAGAGGAAGTAGAAGGG - Intergenic
1089484733 11:118836576-118836598 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1090009154 11:123030567-123030589 CTGGAGTCGTATAAGTAGAATGG + Intergenic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1091107305 11:132934684-132934706 TTCCAGAAGTAGAAGTTGAAAGG - Intronic
1091250292 11:134138599-134138621 ATTTTGAAGGAGAAGTAGAAGGG + Intronic
1091860798 12:3781224-3781246 ATGGAAAGGAAGAAGTAAAATGG - Intergenic
1092944734 12:13442176-13442198 AGGGAGAAGTGGAAAGAGAAGGG - Intergenic
1093084554 12:14852403-14852425 TGGGAGAAGGAGAAGGAGAAGGG - Intronic
1093389930 12:18606047-18606069 ATGTAGCAGTAGGAGTAGAGAGG - Intronic
1093725424 12:22502939-22502961 AATAAGAAGTAGAAATAGAAAGG + Intronic
1093945701 12:25106966-25106988 CTGGAGAAGAAACAGTAGAAAGG + Exonic
1094203499 12:27816793-27816815 AGGCAGCAGTAGAATTAGAAAGG + Intergenic
1094480212 12:30875473-30875495 ATGGAGGAGGAGGAGTGGAAAGG + Intergenic
1095315656 12:40757934-40757956 ATAGAAAAGTAGAAATAGCATGG + Intronic
1095342991 12:41114207-41114229 AGGGAGAAGGATAAGAAGAAAGG + Intergenic
1095578536 12:43767418-43767440 ATGGAGTAGCAGAAGTAAAGGGG + Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1097000028 12:55868632-55868654 AGGGAGAAGTAGAAGTAAACGGG + Intergenic
1097098261 12:56567465-56567487 AGGAAGAAGAAGAAGAAGAAAGG + Intronic
1097106848 12:56630689-56630711 ATGGAAACGTGGAAATAGAAAGG + Intronic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1097548038 12:61029303-61029325 AAGGAGAAGGAGAAGAAGACAGG - Intergenic
1097614064 12:61862681-61862703 ATAGAGAATTAGAAATAGCAAGG - Intronic
1097789121 12:63795292-63795314 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
1098463569 12:70760841-70760863 ATGGAGTAATAGAATTGGAAAGG + Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099081066 12:78181843-78181865 ATACAGAAGGAGAAGGAGAAGGG + Intronic
1099224208 12:79949566-79949588 ATGGAGAAATAGAAAAAGAAAGG - Intergenic
1099378266 12:81921114-81921136 TTGGAGTATTAGAACTAGAAAGG + Intergenic
1099473296 12:83076773-83076795 AGGGAGAATTAGAAGCAGGAGGG - Intronic
1099480849 12:83164469-83164491 ATGGAGATGTACAAGGTGAATGG - Intergenic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1099616432 12:84941522-84941544 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1099938399 12:89155684-89155706 AGAGAGAAGAAGAAATAGAAAGG + Intergenic
1099988200 12:89693942-89693964 AAGCAGAAATAGAAGAAGAATGG - Intronic
1100176207 12:92033881-92033903 ATGAAGAAAGAGAAGAAGAAAGG + Intronic
1100182688 12:92102448-92102470 ATGGAGCAGCAGAAGTGCAAGGG + Intronic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1100779397 12:98008009-98008031 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1101193775 12:102361807-102361829 AAGGAGAAGAAGGAGAAGAAAGG + Intergenic
1101299429 12:103463238-103463260 AAGGAGAACTAGAAGAGGAAGGG - Intronic
1101360529 12:104022036-104022058 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
1101608460 12:106268438-106268460 ATGGAGAAATAGGAACAGAAAGG + Intronic
1101755464 12:107617784-107617806 ATTCAGAAGGAGATGTAGAAGGG - Intronic
1101794126 12:107957118-107957140 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1102166747 12:110813000-110813022 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102194433 12:111014531-111014553 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1102408767 12:112698837-112698859 AAGGAGAAGGAGAAGGAAAAGGG - Intronic
1102544100 12:113642312-113642334 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1102656660 12:114487690-114487712 CTGAAGAAGAAGATGTAGAATGG + Intergenic
1103371575 12:120423329-120423351 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1104082709 12:125444983-125445005 CTGGAGATGTAGAACTAGTAGGG - Intronic
1105219879 13:18315602-18315624 CTGGAAAAGTAGATGTAAAATGG - Intergenic
1105240650 13:18606814-18606836 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1105722462 13:23130576-23130598 ATAGGAAAGTAGAAGTAGAGGGG + Intergenic
1106631961 13:31483569-31483591 CTGCAGAGATAGAAGTAGAAGGG + Intergenic
1106771514 13:32965284-32965306 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1106909387 13:34446918-34446940 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1107059376 13:36140083-36140105 GGGGAGAGGAAGAAGTAGAAGGG + Intergenic
1107249533 13:38341666-38341688 TAAGAGAAGTAGAAATAGAAAGG + Intergenic
1107288034 13:38818547-38818569 AAGGAGAGGTAGATGGAGAAAGG + Intronic
1107795463 13:44046927-44046949 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1107887741 13:44888360-44888382 ATGGAAAAGTAGATTTAGAAAGG + Intergenic
1108206024 13:48091540-48091562 ATGGGGAAGTAGTAGTGGGAAGG - Intronic
1108420610 13:50245311-50245333 ATGAAGAAGCAGAATTAGAGAGG - Intronic
1108769653 13:53683908-53683930 TTGGAGAAGTAGAAATGAAATGG + Intergenic
1109151093 13:58848129-58848151 AAGGAGAAGAAGAGGTAGTATGG - Intergenic
1109173320 13:59123536-59123558 ATGGAAAACTAGAACTAGAATGG + Intergenic
1109399010 13:61800055-61800077 ATGGAGAATGAGAAGGAGAATGG + Intergenic
1110365562 13:74681061-74681083 AGGTACAAGTAGAAGTGGAAAGG - Intergenic
1110660578 13:78055869-78055891 ATGGTGAAGTTCAAGTATAAGGG - Intergenic
1110747234 13:79068568-79068590 ATGGAGGAGTAGCATTACAAGGG + Intergenic
1110764468 13:79266983-79267005 AGGGATAAGAAGAATTAGAAAGG - Intergenic
1110852730 13:80263159-80263181 ATGTAGAAGAAGCAGCAGAAAGG - Intergenic
1111231588 13:85351046-85351068 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1111381241 13:87455684-87455706 ATGCAGATGTAGAAGTAAATAGG + Intergenic
1111661856 13:91221637-91221659 ATGGAGAAATAGAGGTGAAAGGG + Intergenic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112133129 13:96546024-96546046 AGGGTGAAGTAGAAATGGAATGG + Intronic
1112619582 13:101040928-101040950 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1113214911 13:108028862-108028884 ATGCAGAGGTAGAAGTGGGAGGG + Intergenic
1113498708 13:110755718-110755740 AGGAAGAAGTAGGAGAAGAAAGG - Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1114552995 14:23544846-23544868 TGGGAGAAGGAGAAGTGGAATGG - Intronic
1115018528 14:28646373-28646395 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115293728 14:31802265-31802287 AAGAAGAAGAAGAAGAAGAAGGG - Intronic
1115529362 14:34312802-34312824 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1116075835 14:40109400-40109422 ATGGAGAACTAATTGTAGAAAGG - Intergenic
1117029038 14:51651220-51651242 CTGGAGAGGTAGAATTAGAGGGG + Intronic
1117091395 14:52254376-52254398 ATGAAGAATTAGGAGAAGAATGG - Intergenic
1117134652 14:52722289-52722311 AGGGGGCAGAAGAAGTAGAAGGG + Intronic
1117334126 14:54742321-54742343 ATAGAGGAGGAGAAATAGAATGG + Intronic
1117506725 14:56411757-56411779 AAGGAGAAGAAGAAGAAGAACGG + Intergenic
1118177741 14:63458904-63458926 TTGGAGAAATAGAAGTAAAAGGG - Intronic
1118338384 14:64874480-64874502 ATAGAGAGTTAGAGGTAGAAAGG - Intronic
1119572956 14:75692633-75692655 ATGGATAGGTATGAGTAGAAAGG + Intronic
1119887694 14:78157171-78157193 ATGGAGAGGAGGAAGTAGGAGGG + Intergenic
1119904273 14:78287222-78287244 ATTGTGAAGAGGAAGTAGAAGGG + Intronic
1120007795 14:79379774-79379796 AAGGAGAAGGAGAATTAGAGTGG - Intronic
1120281456 14:82443669-82443691 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120436317 14:84487396-84487418 AAGGAGAAGAAGATGAAGAAGGG + Intergenic
1121080438 14:91103515-91103537 ATGCAGAAGTAGATGTAGGAAGG - Intronic
1121146232 14:91584987-91585009 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121873713 14:97432088-97432110 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1123688748 15:22819582-22819604 TTGCAGTAGTAGAAGTAGTATGG - Intronic
1123875898 15:24623528-24623550 ATAAAGAAGAAGAAGAAGAAAGG - Intergenic
1123986762 15:25653153-25653175 ATGGAGAAGAACGAGGAGAACGG - Intergenic
1124213686 15:27786749-27786771 ATGGAAAGGAAGAAGTAAAACGG - Intronic
1124989006 15:34652165-34652187 ATGAGGAAGTGGAAGTGGAATGG + Intergenic
1125087872 15:35752330-35752352 AGGGAGAAGGAGAGGGAGAAAGG - Intergenic
1125261774 15:37834143-37834165 AGGGAGAGGTAGTAATAGAAGGG + Intergenic
1125612849 15:40983914-40983936 ATGGAGATCTAGAAGAGGAAGGG + Exonic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1127122100 15:55780570-55780592 AAGCAGAAGAAGAAGAAGAAAGG + Intergenic
1127647075 15:60969574-60969596 ATGGAGAAGGAGATGAAGACAGG + Intronic
1128127221 15:65202039-65202061 ATGGAGAGGTAGAACCTGAATGG + Intronic
1128310466 15:66628766-66628788 ATGGAAAAGAAGAAGTTGCAAGG + Intronic
1128522896 15:68387119-68387141 ATGGAAAAGTAGAAGAAGGTAGG + Intronic
1129611426 15:77061688-77061710 ATGGAGATTTAGAAATACAAAGG + Intronic
1130128709 15:81117789-81117811 ATGAAGACGAAGATGTAGAAGGG - Intronic
1130866244 15:87935563-87935585 ATGCAGAAGAAGAAGAAGAAGGG + Intronic
1131014138 15:89043466-89043488 AAGGAGAAGGAGAGGAAGAAGGG + Intergenic
1131253193 15:90844300-90844322 ATGGACAAGGAGAAGTAATAAGG - Intergenic
1131291520 15:91110961-91110983 ATGGAGAAGTAGATGAGAAAGGG + Intronic
1131875145 15:96798019-96798041 ATGGAGGAGGAGAAGGAAAAGGG + Intergenic
1131913149 15:97231469-97231491 ATGAAGAAATAAAAGAAGAAAGG + Intergenic
1132042745 15:98538652-98538674 TTGGAGAACTAGAAGGAGCAAGG - Intergenic
1133485421 16:6214732-6214754 AAGGAGAGGGAGAAGGAGAAGGG + Intronic
1133838681 16:9388942-9388964 ATGGGGAAGTAGAAGTTGCTGGG + Intergenic
1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG + Intronic
1134915918 16:18070879-18070901 ATGGATAGGTGGAAGTAAAATGG - Intergenic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1136168233 16:28470711-28470733 GTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136309489 16:29397839-29397861 CTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136539128 16:30918976-30918998 GAGGAGAAGGAGAAGAAGAAAGG - Intergenic
1136726498 16:32361704-32361726 ATGAAGAAGTACAAGAAAAATGG + Intergenic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137413858 16:48254000-48254022 AAGTAGAAGTAGATGCAGAAGGG - Intronic
1137699448 16:50486183-50486205 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138494728 16:57401042-57401064 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1139004105 16:62550369-62550391 AGGGAGAAGGGGATGTAGAAAGG - Intergenic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1139123395 16:64047755-64047777 AGGGAGAGGGAGAGGTAGAAGGG - Intergenic
1140025115 16:71281501-71281523 ATGGAAAAGTAGAAGAAGACAGG - Exonic
1141263073 16:82471333-82471355 AAGGAGAAGGAGAAACAGAAGGG - Intergenic
1141275545 16:82584645-82584667 ATGGAGAAGAAGAAGAAGTAGGG + Intergenic
1141883403 16:86874794-86874816 CTGGAGAACTGGACGTAGAAAGG + Intergenic
1141908304 16:87041853-87041875 AAGGAGAAGTGGAATTAGGAGGG - Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1142339651 16:89512992-89513014 AAGGAGAAGGATAAGTCGAAGGG + Exonic
1202999936 16_KI270728v1_random:156053-156075 ATGAAGAAGTACAAGAAAAATGG - Intergenic
1203139535 16_KI270728v1_random:1752046-1752068 AAGAAGAAGAAGAAGAAGAATGG - Intergenic
1142858339 17:2745961-2745983 AAGGAGAAGGAGAAGGACAAGGG - Intergenic
1143055442 17:4158685-4158707 TTGGAGAACTAGAAGCAGCATGG - Intronic
1143273189 17:5690605-5690627 AGGGAGAGGGAGAAGGAGAAGGG - Intergenic
1144071693 17:11679706-11679728 TTCGAGAAGTAGAACGAGAATGG + Intronic
1144188296 17:12817410-12817432 ATTAAGAAGTAAAAGAAGAATGG + Intronic
1144235665 17:13258067-13258089 AAGGAGAAGGGGAAGAAGAAGGG - Intergenic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144244743 17:13351947-13351969 AAGGAGAAGTAAAAGGAAAAGGG - Intergenic
1144346328 17:14353267-14353289 ATGGGGAAGTTGAAGGACAAGGG + Intergenic
1144360239 17:14485220-14485242 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1144387709 17:14765116-14765138 ATAGAGAAGTAAAAAGAGAAAGG + Intergenic
1145058957 17:19720467-19720489 ATGGAGAGGGAGGAATAGAAAGG - Intergenic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1146031867 17:29373112-29373134 ATAGAGAAGTAGGAATAAAAAGG - Intergenic
1146233505 17:31134749-31134771 ATGGAGAAGCCCAAGTAGAAAGG - Intronic
1146335234 17:31963965-31963987 ATGGAAGAGTAGAACTATAAGGG - Intronic
1146536341 17:33656011-33656033 ATGGCATAGTGGAAGTAGAAAGG + Intronic
1146714047 17:35068789-35068811 ATGGAGGAGGAGGAGGAGAAAGG + Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146946226 17:36875581-36875603 AGAGAGAAGCAGAAGTGGAAAGG + Intergenic
1147256108 17:39183347-39183369 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
1147368876 17:39977696-39977718 TTGGGGAAGTATAAGTAGGAGGG - Exonic
1147834003 17:43317153-43317175 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1148111478 17:45147047-45147069 GTGGCGAAGGAGAAGTGGAAAGG + Intergenic
1148271450 17:46265244-46265266 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1148641382 17:49190310-49190332 AGGGAGAAGTGGAAGTAGGAAGG + Intergenic
1148686722 17:49505244-49505266 ATGTGGAAGCAGAAGCAGAAAGG - Intronic
1148734266 17:49855915-49855937 ACCGAGAAGGAGAATTAGAAGGG + Intergenic
1148885399 17:50768518-50768540 ATGGAGAGGCGGAAGTAGCAGGG + Intergenic
1149000472 17:51752364-51752386 ATGGAGAAGTTGAAGCTGCAGGG + Intronic
1149195154 17:54110747-54110769 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1149408526 17:56379812-56379834 ATGGTTAACTAGAAGCAGAAGGG + Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150511592 17:65758148-65758170 TTGCAGAAGTAGCAGAAGAAAGG - Intronic
1151038743 17:70832878-70832900 ATGCAGAAGCAGCAGTAGCAGGG + Intergenic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1151271551 17:73000234-73000256 AGGGAGAAGGAGAAGAAGAGGGG - Intronic
1151354265 17:73549208-73549230 AGGGAGGAGTAGAAGGAGAGAGG + Intronic
1151660379 17:75515484-75515506 TTGGAAAAGGAGAAGGAGAAAGG - Exonic
1203170238 17_GL000205v2_random:141719-141741 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1153100641 18:1465182-1465204 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1153550800 18:6259583-6259605 AAGGAGATGGAGAAGGAGAAAGG - Intronic
1153606335 18:6837197-6837219 AAGGAGAACTTGAAGCAGAATGG + Exonic
1153650230 18:7232833-7232855 ATGGAGAAGTGAAATTAAAATGG - Intergenic
1153979102 18:10294285-10294307 AAGGAGAAGTGGAGGTAGAGAGG + Intergenic
1154059990 18:11050746-11050768 TTGGAGAGGCAGAATTAGAAAGG - Intronic
1154110891 18:11567581-11567603 AGGGAGAAGGAGAAGGAGAGGGG + Intergenic
1154448226 18:14452245-14452267 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1154946232 18:21164135-21164157 ACAGAGAAGCAGAAGTAAAATGG + Intergenic
1155503151 18:26506685-26506707 CTGGAGAAGAGGAGGTAGAAAGG + Intronic
1155729235 18:29131457-29131479 ATGGAGAAGTAAAACTATTAGGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156862752 18:41857237-41857259 AGGAAGAAGTAGAAGGAGACGGG + Intergenic
1157237598 18:45979151-45979173 AGGGAGAAGAAGAAGAAGAGAGG - Intergenic
1157237607 18:45979194-45979216 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1157357741 18:46951060-46951082 AGGGACAGGGAGAAGTAGAAGGG - Intronic
1157467345 18:47958604-47958626 AGTGAGAGGTAGGAGTAGAATGG - Intergenic
1158032674 18:52985848-52985870 AGGGAGAAGTCCAAGAAGAAAGG - Intronic
1158040408 18:53086228-53086250 AGGAAGAAGAAGAAGAAGAACGG - Intronic
1158040409 18:53086248-53086270 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040410 18:53086274-53086296 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040411 18:53086297-53086319 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040412 18:53086323-53086345 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040413 18:53086352-53086374 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040414 18:53086378-53086400 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040415 18:53086401-53086423 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040416 18:53086427-53086449 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040417 18:53086450-53086472 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158157136 18:54438720-54438742 ATGCAAAGGCAGAAGTAGAAAGG - Intergenic
1158248193 18:55455219-55455241 AAGGAGAAGTAGAAGAAGAAAGG + Intronic
1158506075 18:58046296-58046318 ATGGAGAAGTAGAGGATGCAAGG - Intronic
1158684303 18:59599079-59599101 AAGTAGTAGTAGAAGAAGAAAGG - Intronic
1158840744 18:61383872-61383894 AGGGAGAAGCTGAAGTAGTAGGG + Intronic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1159104406 18:63989413-63989435 ATAGATACATAGAAGTAGAATGG + Intronic
1159115221 18:64105908-64105930 ATGGAGAGATATAATTAGAAAGG + Intergenic
1159491498 18:69140743-69140765 ATGGAGCAAGAGAAGAAGAAGGG + Intergenic
1159971304 18:74657899-74657921 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1159994713 18:74952937-74952959 ATGGAGCAGTGGGAGTGGAATGG + Intronic
1160039274 18:75331234-75331256 AAGAAGATGAAGAAGTAGAAGGG - Intergenic
1160057656 18:75499541-75499563 AAGGAGTAGGAGAAGGAGAAGGG + Intergenic
1160965695 19:1746096-1746118 AGGGAGAAGGGGGAGTAGAAGGG + Intergenic
1161254463 19:3299672-3299694 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1161329116 19:3678061-3678083 ATGGAGAGATGGAAGGAGAATGG + Intronic
1161647589 19:5463381-5463403 AAGGAGAAGGAAAAGAAGAAAGG - Intergenic
1161701163 19:5796352-5796374 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1161994230 19:7702646-7702668 AGGGAGAAGGAGGAGTAGGAGGG + Intergenic
1162548468 19:11345331-11345353 ATGGAGATGTGGAAGTAGAAGGG + Exonic
1163235657 19:16029087-16029109 AGGAAGAAGAAGAAGAAGAAGGG + Intergenic
1164211927 19:23106145-23106167 AAGCAGAAGGAGAAGGAGAAGGG + Intronic
1164292167 19:23878712-23878734 AAGGAAAAGTAGAAGAAAAAAGG + Intergenic
1164511862 19:28904109-28904131 ATGGGGAAGTGGAAGAAGAAAGG - Intergenic
1165799048 19:38536474-38536496 ATGAAGACATAGAGGTAGAAAGG - Intronic
1165817074 19:38648747-38648769 ATGGAGAAGCCGAAGTAGAGGGG + Intronic
1165912358 19:39237130-39237152 AGGGAGAAGGAGAAGATGAAGGG + Intergenic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1166652133 19:44582654-44582676 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1166674947 19:44734657-44734679 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166774946 19:45306787-45306809 ATGGAGAAGAAGTTGGAGAAAGG - Exonic
1167406134 19:49309982-49310004 ATGGAGAAGTAGAAGTAGAAGGG - Intronic
1167608258 19:50493209-50493231 GAGGAGAGGTAGAAGGAGAATGG + Intergenic
1167627624 19:50603179-50603201 AAGGAGAAGGAGAAGGAGAGGGG - Intergenic
1167702107 19:51054956-51054978 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168251571 19:55145308-55145330 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1168251574 19:55145314-55145336 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
925231456 2:2236755-2236777 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
925259148 2:2515094-2515116 ATTAAGAAGAAGAAGAAGAAAGG - Intergenic
925508013 2:4590976-4590998 CAAGAGAAGTAGAATTAGAAAGG + Intergenic
925536041 2:4917777-4917799 AGGGAGAAGGAGAAACAGAAAGG - Intergenic
925594463 2:5541594-5541616 ATGGAGTAGAAGAAATAAAAAGG + Intergenic
925666931 2:6267703-6267725 ATGGAGAATTAAAAGTAGAATGG + Intergenic
926557357 2:14374582-14374604 AAGGGGAAGTAGAAGAGGAAAGG + Intergenic
926858221 2:17280589-17280611 AGGGGGAAGTAGAATAAGAAGGG - Intergenic
926964990 2:18400041-18400063 ATGAGGAAGTGGAAGTAGATGGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927302410 2:21530724-21530746 AAGGAGAAGGAGAAGGCGAAGGG - Intergenic
927358938 2:22208863-22208885 ATGTAGACCTGGAAGTAGAATGG + Intergenic
927638896 2:24834554-24834576 GTGGAGAAGGAGAAGCAGAGTGG - Exonic
927866177 2:26589153-26589175 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
927866180 2:26589159-26589181 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
927866198 2:26589228-26589250 AAGGAGAAGTAGAAGAAGAGGGG - Intronic
927923756 2:26994804-26994826 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
928268248 2:29830992-29831014 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
928268281 2:29831105-29831127 GAGGAGAAGAAGAAGAAGAAGGG + Intronic
928320566 2:30279978-30280000 GAGGAGAAGAAGAAGAAGAATGG - Intronic
928656132 2:33453500-33453522 ATGGAGAAGTCCACGAAGAAAGG - Intronic
928781949 2:34833876-34833898 GTGGAGAAGGGGAAGAAGAAGGG + Intergenic
928859384 2:35838324-35838346 ATGAATAAGTAGAAGAATAAAGG - Intergenic
930078968 2:47432325-47432347 ATGGAGAAATAGAGGCACAAGGG - Intronic
930140908 2:47950575-47950597 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
930743907 2:54861355-54861377 ATGAAGAGGTAGAGGTACAATGG + Intronic
931322808 2:61188317-61188339 CTGCAGAGATAGAAGTAGAAGGG + Exonic
931380230 2:61746059-61746081 AAGAAGAAGGAGAAGAAGAAAGG + Intergenic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931826301 2:66004196-66004218 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
931992793 2:67807873-67807895 AAGGGGAAGAAGAAGAAGAAGGG - Intergenic
932078023 2:68684342-68684364 TTGGAAAAGAAGAAGTAAAAAGG + Intronic
932745296 2:74329142-74329164 TTGTAGAAGTAGCAGTAAAACGG + Intronic
932767345 2:74479404-74479426 ATGGGGAAGAAAAAGTATAATGG + Intronic
932800927 2:74741759-74741781 ATGAAGAAGTGGAAGCAGCAAGG - Intergenic
933063744 2:77769224-77769246 AGGGAGAATTAGATGTGGAATGG - Intergenic
933367280 2:81368673-81368695 ATGGAGAAGAACAAATAGAGTGG + Intergenic
933502874 2:83138874-83138896 AAGGAGCAGGAGAAGGAGAAGGG + Intergenic
933813405 2:86047542-86047564 AAGGAAAAGGAGAAGTAGAGGGG + Intronic
934155131 2:89192157-89192179 ATAAAGAAGAAGAATTAGAAAGG - Intergenic
934184168 2:89656914-89656936 CTGGAAAAGTAGATGTAAAATGG + Intergenic
934212183 2:89990570-89990592 ATAAAGAAGAAGAATTAGAAAGG + Intergenic
934294456 2:91731052-91731074 CTGGAAAAGTAGATGTAAAATGG + Intergenic
934543988 2:95199540-95199562 CTGGTGAAGTAGAAGTCGACAGG - Intergenic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
936381056 2:111986499-111986521 AGCCAGAAGTAGAAGGAGAAAGG - Intronic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936502494 2:113077416-113077438 AGGAAGAAGAAGAAGAAGAAGGG - Intergenic
936768091 2:115877985-115878007 AGGGAGAAGGAGAAGGAGAAAGG - Intergenic
936929218 2:117769880-117769902 ATAAAGAAGAAGAAGAAGAAGGG + Intergenic
937130905 2:119512334-119512356 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937502736 2:122499288-122499310 AAAGATAAGTAGAAATAGAAGGG - Intergenic
937800863 2:126078759-126078781 ATCAAGAGGTAGAAGTAGAAGGG + Intergenic
938857328 2:135327007-135327029 ATGGAGTAGAAGAGGTAGATGGG + Intronic
939389849 2:141552986-141553008 ATGGAGAGGTAGTGGGAGAAGGG + Intronic
939663767 2:144923852-144923874 AAAGAGAACTAGAATTAGAAGGG + Intergenic
940124773 2:150311160-150311182 ATGGAGAACTAGCAGAAGCAGGG + Intergenic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941292183 2:163690672-163690694 CTAGAGAAGTAAAAGTTGAAAGG + Intronic
941310374 2:163921413-163921435 TGGGAGTAATAGAAGTAGAAAGG - Intergenic
941950827 2:171154677-171154699 ATGAAGTAGTAGAAGCAGTATGG - Intronic
942462187 2:176175919-176175941 ATGGGGAAGTGGCAGAAGAAAGG + Intergenic
942998051 2:182289041-182289063 ATGGACAACCAGAAGTAGCAAGG - Intronic
943172897 2:184426726-184426748 ATTTAGAAGTAAAATTAGAAAGG - Intergenic
943269667 2:185782950-185782972 ATAGATAAGGAGAAGGAGAAAGG - Intronic
943306502 2:186269140-186269162 ATGAAGAGAGAGAAGTAGAAAGG + Intergenic
943444680 2:187969739-187969761 ATGGAAAAAAAGAAGTAGAAGGG + Intergenic
943617919 2:190115210-190115232 AGAGAGAAGGAGAAGTAGAAAGG + Intronic
943839068 2:192554275-192554297 AAGGAGAAGAAGAGGAAGAAAGG + Intergenic
944074030 2:195706763-195706785 ATGGGGCAGTAGATGAAGAAGGG - Exonic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944707258 2:202303168-202303190 ATGGAGAGGTAAAAGTGAAATGG + Intronic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
945155162 2:206830426-206830448 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
945180729 2:207088433-207088455 AAAGAGAAGTAGAAGTTGATGGG - Intronic
945192280 2:207201362-207201384 ATGGTGCAGTAGAAAGAGAATGG - Intergenic
945786449 2:214245114-214245136 ATGCAGAAGTAGAAGTTTATAGG - Intronic
946066113 2:216988576-216988598 ATGGAAAAGTAGGAGGAGAGAGG + Intergenic
946346486 2:219115166-219115188 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
947224057 2:227823041-227823063 ATGGAGAAGTGGAAGATGGAAGG + Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947447687 2:230176981-230177003 AGGGAGAAATGGAAGGAGAAAGG - Intronic
948322520 2:237082062-237082084 ATGGAGAAGAAGACTTTGAAAGG + Intergenic
948538992 2:238672320-238672342 AAGGAGGAGAAGAAGGAGAAGGG - Intergenic
948539004 2:238672376-238672398 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558568 2:238835269-238835291 AGGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558571 2:238835275-238835297 AGGGAGAGGGAGAAGGAGAAGGG - Intergenic
948558594 2:238835350-238835372 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
949061433 2:241960520-241960542 ATGAAGAAGTAGCAGAGGAAGGG - Intergenic
1169178631 20:3542573-3542595 AGGGAGAAGGGGAAGGAGAAAGG - Intronic
1169411034 20:5370611-5370633 AGGGAGGTGTAGGAGTAGAAGGG - Intergenic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1169655242 20:7915353-7915375 AAGGGGAAGGAGAAGAAGAAGGG + Intronic
1169663461 20:8006684-8006706 ATAGAGAGGGAGAAGTAGGAGGG - Intronic
1169888017 20:10423045-10423067 ATGGAGAAGTAAATGGTGAATGG - Intronic
1169974280 20:11305964-11305986 GTTGGGAAGTAGAAGGAGAAAGG + Intergenic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170579238 20:17685244-17685266 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1171209047 20:23302904-23302926 ATGGAGAGGTTGAAGGAGAAGGG + Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172292089 20:33783981-33784003 ATGGAGAAGTGGAGGGAAAAGGG - Intronic
1172928641 20:38564911-38564933 AAGAAGAAGAAGAAGAAGAAGGG - Intronic
1173662878 20:44746151-44746173 ATGGCGAAGTAGAAGGAGCCGGG - Exonic
1173917890 20:46723138-46723160 ATGGAAATATAGAAGAAGAATGG - Intronic
1173963645 20:47094130-47094152 ATGGTGAGGTAGTAGGAGAAAGG + Intronic
1174709505 20:52690030-52690052 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1174709531 20:52690281-52690303 AAGGAGAAGAAAAAGGAGAAGGG - Intergenic
1175329236 20:58151227-58151249 AGGGAGAAGGAGACGGAGAAAGG - Intronic
1175503081 20:59464016-59464038 AAGGAGAAGTACAGGTTGAAGGG - Intergenic
1175558859 20:59899578-59899600 ATGTAGTAATAGAAGCAGAAAGG + Intronic
1175581008 20:60099712-60099734 ATGGACCAGTAGAAGTGGAAAGG + Intergenic
1176326229 21:5503515-5503537 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1176401528 21:6317436-6317458 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1176422044 21:6523931-6523953 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1176435629 21:6671668-6671690 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1176459891 21:6998738-6998760 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1176483452 21:7380516-7380538 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1177053704 21:16272610-16272632 ACTGTGAATTAGAAGTAGAATGG - Intergenic
1177057119 21:16319636-16319658 AGGAAGAAGAAGAAGAAGAAAGG - Intergenic
1177389869 21:20454124-20454146 GTGGTGAAGTATAATTAGAAAGG + Intergenic
1177958481 21:27630771-27630793 AAGTAGAAGTAGATGTACAAAGG + Intergenic
1178016125 21:28347596-28347618 AAGGAGAAGGAGAAGAAAAAGGG - Intergenic
1178158377 21:29881697-29881719 ATGGTGCAGTAGAAGAAGAAAGG - Intronic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1179173360 21:38990194-38990216 ACAAAGAAGTAGAAGGAGAAGGG + Intergenic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179258753 21:39740137-39740159 ATTCAGAAGAAGAAATAGAATGG - Intergenic
1179697534 21:43132246-43132268 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180817484 22:18800492-18800514 CTGGAAAAGTAGATGTAAAATGG - Intergenic
1181203673 22:21234814-21234836 CTGGAAAAGTAGATGTAAAATGG - Intergenic
1181615623 22:24052239-24052261 AGGGAGAAGTAGAAGCAAGAGGG + Intronic
1181741234 22:24923481-24923503 ATGGAGAAGGAAGAGGAGAAAGG - Intronic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1181787029 22:25234823-25234845 AAGGAGGAGTAGAAGTTGCAAGG + Intergenic
1181865781 22:25853782-25853804 ATGGAAAATTACAAGGAGAATGG + Intronic
1182048994 22:27298997-27299019 AAGGAGAAAGAGAAGAAGAAGGG + Intergenic
1182738376 22:32547443-32547465 AATGAGAAGGAGAAGAAGAATGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182886407 22:33777666-33777688 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1182886410 22:33777672-33777694 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
1184672550 22:46023020-46023042 ATGAAGAAGGAGGAGAAGAAAGG + Intergenic
1185329044 22:50243636-50243658 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
1203223247 22_KI270731v1_random:60602-60624 CTGGAAAAGTAGATGTAAAATGG + Intergenic
1203267582 22_KI270734v1_random:26218-26240 CTGGAAAAGTAGATGTAAAATGG - Intergenic
949119351 3:366911-366933 ATTGAAAAGTAGAAGGAAAATGG - Intronic
949366267 3:3284995-3285017 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
949366270 3:3285001-3285023 AGGAAGAAGGAGAAGGAGAAGGG - Intergenic
949700271 3:6748673-6748695 AAGGAGGAGGAGAAGGAGAAGGG - Intergenic
949921026 3:9000544-9000566 TTGGAGAAGTTCAAGTCGAAGGG + Intronic
951530763 3:23696051-23696073 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
951748110 3:26001979-26002001 ATGGAGAAATAGAGGAACAAAGG + Intergenic
952516944 3:34114011-34114033 ATGAAGAAGAAGAAAAAGAAAGG - Intergenic
952783867 3:37132663-37132685 ATGGATAAGCAGGAGTAGCAAGG + Intronic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954952064 3:54484270-54484292 ATGGAGAATAGGAAGGAGAATGG - Intronic
955086588 3:55708761-55708783 ATGGAGGAGTGGAAGAAGAAAGG + Intronic
955201271 3:56854327-56854349 ATGGAGAAGGAGCAGTGCAATGG + Intronic
955301671 3:57785967-57785989 CTAGAAAAGTAGTAGTAGAAGGG - Intronic
955621519 3:60869430-60869452 ATTGAGAAGCAGAGATAGAAGGG - Intronic
956530254 3:70211248-70211270 ATGGAGAAAGAAAAGCAGAAAGG - Intergenic
956923257 3:73953463-73953485 ATGGAAAAGTAAAAGCAGAAGGG + Intergenic
957290397 3:78271019-78271041 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic
957462875 3:80545119-80545141 ATAGGGAAGTAGAAAGAGAAGGG + Intergenic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957887619 3:86309312-86309334 ATGGAAAGTTAGAAGTAGAATGG - Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
958140155 3:89552040-89552062 AGGAAGAAGTAGAAATACAAGGG - Intergenic
958526846 3:95271944-95271966 ATGGATAAATAGAAAAAGAAAGG - Intergenic
958838092 3:99170898-99170920 ATGGAGAAGAACAAGTGGATTGG + Intergenic
958927078 3:100170706-100170728 ATGCCAAAGTAGAGGTAGAAAGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960052596 3:113252527-113252549 ATGGAGAAGCAGTAACAGAATGG + Intronic
960155577 3:114294381-114294403 AAGGAGCAGGAGAAGAAGAAGGG + Intronic
960320982 3:116235462-116235484 AGGGAGAAATGGAAGGAGAAAGG + Intronic
960680170 3:120239394-120239416 AGGAAGAAGAAGAAGAAGAAGGG - Intronic
960840039 3:121948402-121948424 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
961947921 3:130713464-130713486 AAGGAGCAGTAGTGGTAGAAGGG + Intronic
962492331 3:135906666-135906688 ATGGAGCAGAAAAGGTAGAAAGG - Intergenic
962660125 3:137593655-137593677 ATGGAAAAGTCCATGTAGAATGG + Intergenic
962998530 3:140654514-140654536 AGGGAGAAATAAGAGTAGAAAGG + Intergenic
963090477 3:141478985-141479007 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
963289487 3:143473383-143473405 ATGGAGAAGAGGAAGTAAACAGG - Intronic
963389224 3:144636389-144636411 AGGGAGAAGAAAATGTAGAATGG + Intergenic
963433390 3:145237610-145237632 CTGGAGAAGGAGAGGCAGAATGG - Intergenic
963584537 3:147168390-147168412 AAGGAGAAGGAGAAGAAGAGAGG + Intergenic
964117161 3:153148347-153148369 AAGGAGAAATAAAAGGAGAATGG - Intergenic
964703456 3:159593707-159593729 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
964925975 3:161958162-161958184 ATGAAGAAATGGAAGTACAATGG + Intergenic
965263071 3:166507850-166507872 AGAAAGAAGTAGAAGGAGAAAGG - Intergenic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
965909370 3:173752782-173752804 ACTGGGAAGTAGAAGGAGAATGG - Intronic
965985684 3:174750398-174750420 AAGAAGAAGAAGAAGAAGAATGG - Intronic
966522167 3:180885606-180885628 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
967332820 3:188308966-188308988 AGGGAGGAGGAGAAGGAGAAAGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967464514 3:189788366-189788388 ATGCAAAAGTAGAAGTAAAGGGG + Intronic
967479440 3:189956976-189956998 ATGTAGAGGTTGTAGTAGAATGG - Exonic
967495620 3:190142054-190142076 GTGGACAACTAGAAGGAGAAGGG - Intergenic
967795562 3:193594857-193594879 ATTGAGAAGTAGAAATGCAAGGG - Intronic
967997081 3:195174766-195174788 AAGGAGAAGGAGAAGAGGAAGGG - Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
969979526 4:11140470-11140492 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
969997900 4:11333371-11333393 ATGAGGAAATAGAAGTGGAAAGG + Intergenic
970010629 4:11454995-11455017 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
970350935 4:15201252-15201274 GTGGAGATATAGAAGTAGATGGG + Intergenic
970367412 4:15373785-15373807 ATGGAGAAGGAGGAGTATAGTGG - Intronic
970808063 4:20059446-20059468 ATGGGGAAGCAGACATAGAAAGG + Intergenic
971044590 4:22791223-22791245 GTGGAGAAGTCCAAGAAGAAAGG + Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971221080 4:24706475-24706497 AGAGAGAAGAAGAAGGAGAAGGG - Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971305117 4:25473295-25473317 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
971342448 4:25782948-25782970 TGGGAGAAGCAGAAGCAGAAGGG + Intronic
971873032 4:32269005-32269027 AAAGAAAAGTAGAAGTAGAGAGG - Intergenic
972591557 4:40492923-40492945 ATGGAGGAGGGGAAGCAGAAGGG - Intronic
972599841 4:40562438-40562460 AGGGAGAAGTGGGAGGAGAAGGG - Intronic
973306684 4:48659951-48659973 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
973666528 4:53164811-53164833 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
973923549 4:55713803-55713825 AAGGAAAAGTAGTAGTGGAAAGG - Intergenic
974202066 4:58655404-58655426 ATGGGGAAGTAGAGGTAGCCTGG - Intergenic
974413189 4:61568481-61568503 TTGAAGCAGTAGAAGAAGAAAGG + Intronic
974439590 4:61899088-61899110 ATGGAGCTGCAGAGGTAGAAAGG - Intronic
974533801 4:63148413-63148435 ACGGAGAAGGAGAAGGAAAAAGG - Intergenic
974639279 4:64608237-64608259 ATGGAGAAATAGTAGGTGAAGGG + Intergenic
974753773 4:66176784-66176806 AATGAGAAGGAGAAGGAGAAGGG + Intergenic
975375554 4:73640051-73640073 ATGGAGATGGAGTAGAAGAAGGG - Intergenic
975391464 4:73822884-73822906 AGGGAGAAGAAGAGGGAGAAAGG + Intergenic
975468502 4:74736670-74736692 ATTGAGAGGTAGAAATGGAAAGG - Intergenic
975535931 4:75450405-75450427 ATGGGGAAGCAGGGGTAGAACGG + Intergenic
976441574 4:85081965-85081987 ATGAAGATGTAGAAATAGCAAGG - Intergenic
976932187 4:90580971-90580993 ATGAGGAAGTATAAGTAAAAAGG - Intronic
977371415 4:96141829-96141851 ATATAGATGTAGAAGGAGAAAGG - Intergenic
977462665 4:97344281-97344303 AAGGAGAAGAAGAAAAAGAATGG + Intronic
977760381 4:100728740-100728762 ATAGATAAGTAGTTGTAGAAGGG + Intronic
978268527 4:106858860-106858882 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
979246410 4:118510061-118510083 ATGGAGAAAGAGAAGAAAAAAGG - Intergenic
980127883 4:128790839-128790861 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
980385936 4:132088152-132088174 AAGGAGAAGAAGGAGTAAAAAGG - Intergenic
980669683 4:135988022-135988044 ATGAAGTAGTAGTAGGAGAAAGG - Intergenic
980725875 4:136759967-136759989 ATGGAAAAGTAGAAGGGAAAAGG - Intergenic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981114772 4:140976753-140976775 ATGGAGAAATAGAAGTGCAGGGG - Intronic
981341935 4:143631661-143631683 ATGGAGCAAAACAAGTAGAAAGG + Intronic
982560307 4:156921478-156921500 AAGGAGGAGGAGAAGGAGAAAGG + Intronic
982666461 4:158270110-158270132 TTGGGGATGTAGGAGTAGAAAGG - Intergenic
983201448 4:164864492-164864514 AAGAAGAAGAAGAAGAAGAATGG + Intergenic
984483685 4:180337960-180337982 GTGGTGAAGTAGAAGGATAATGG - Intergenic
984725165 4:183013456-183013478 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
985993930 5:3585877-3585899 AGGAAGAAGTAGAAGTAGCTCGG + Intergenic
986056144 5:4138695-4138717 AAGGAGGAGGGGAAGTAGAACGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
988824835 5:34925846-34925868 ATGGTAAAGTAGGAGTAGACTGG + Exonic
988980957 5:36568733-36568755 TGGGTGAAGTAGAAGCAGAATGG + Intergenic
989180631 5:38573325-38573347 ATGGTGAAGTAGACATCGAAAGG - Intronic
989323129 5:40160016-40160038 ATTAAGCAGTAGAAGTGGAAGGG - Intergenic
989352988 5:40508997-40509019 ATGAAGAAGAAGAAGAAAAAAGG - Intergenic
989428437 5:41323785-41323807 ATGTAGAAGGAGAGGAAGAAAGG + Intronic
989437466 5:41431882-41431904 ATGGACAAGTTGCAGGAGAATGG - Intronic
989535311 5:42556896-42556918 ATGGAGGAGTGAAAGAAGAAGGG - Intronic
990262286 5:54036416-54036438 ATGTAGAAGTAGAAATTGGATGG - Intronic
990682933 5:58265881-58265903 ATGGAGTATTAGAATTGGAAGGG - Intergenic
990767274 5:59198737-59198759 ATACAGAAGTAGAAGAAGGATGG - Intronic
990836949 5:60032350-60032372 ATAGAGAAGTAGAAGTTGTATGG - Intronic
990895010 5:60689720-60689742 ATGTAGAAGCAGAAATATAACGG + Intronic
991930796 5:71750788-71750810 AAGGAGAAGGAGAAGAAGAGAGG - Intergenic
992095851 5:73361833-73361855 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
993002895 5:82400017-82400039 AGGGAGTAAGAGAAGTAGAATGG - Intergenic
993219520 5:85073060-85073082 GTGGAGCAGTAGATGTAGAAGGG - Intergenic
993379628 5:87191623-87191645 ATGGAGAAATAGAAGTTTCAGGG - Intergenic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
993869524 5:93235640-93235662 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
994572562 5:101532909-101532931 ATGGAGAACAAAAAGAAGAAAGG - Intergenic
994714665 5:103307098-103307120 GTGGAGAAGGAGAAGAAGAAGGG + Intergenic
995173036 5:109139453-109139475 AAGGAGAAGTAGCAGGAGAATGG - Intronic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
995997658 5:118320969-118320991 ATAGAGAAATGGAAGTATAATGG + Intergenic
996127536 5:119744002-119744024 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
996289832 5:121839689-121839711 ATGGAAAAGAAGAAGCAGCATGG + Intergenic
996598176 5:125229013-125229035 ATGGAGAGGCAGAAATATAATGG + Intergenic
996691558 5:126345856-126345878 CTGGGGAAGTTGAGGTAGAATGG - Intergenic
997462978 5:134067624-134067646 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
998765131 5:145478083-145478105 ATGGAAATGAACAAGTAGAAAGG - Intronic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
999869432 5:155733689-155733711 GTGGAGAAGTAAAAGTTGAAAGG + Intergenic
1000166740 5:158657163-158657185 AGGCAGAAGTAGAAGCAGTAGGG - Intergenic
1000447015 5:161334393-161334415 ATGGAGAAAAAAACGTAGAAGGG + Intronic
1000485407 5:161836150-161836172 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1000755759 5:165157562-165157584 GTGGAGACTGAGAAGTAGAAGGG - Intergenic
1000829940 5:166090243-166090265 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1001796511 5:174506606-174506628 ATGGAGAAATTGAATTGGAAAGG + Intergenic
1002382669 5:178841380-178841402 TTGGAGAAGGAGAGGAAGAAGGG - Intergenic
1002598250 5:180338303-180338325 ATGGAAAAATAGAAGAAGCAAGG - Intronic
1002818827 6:703431-703453 GGGGAGGTGTAGAAGTAGAAAGG - Intergenic
1003142005 6:3479564-3479586 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1003817626 6:9859942-9859964 ATGAAGAAGGAGGAGGAGAAGGG + Intronic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004462717 6:15853434-15853456 AAGAAGAAGGAGAAGCAGAAGGG - Intergenic
1004828793 6:19454212-19454234 ATGGAGGAAAAGAAGTAGAGAGG + Intergenic
1005384956 6:25277191-25277213 TTGCAGCAGTAGCAGTAGAAGGG + Intergenic
1005591914 6:27337474-27337496 ACAGAGAAGTTGAAGTGGAAGGG + Intergenic
1005979194 6:30823434-30823456 AAGGAGGAGAAGAAGAAGAAGGG - Intergenic
1006006131 6:31003185-31003207 ATGGAAGAGAAGAATTAGAAGGG + Intergenic
1006781231 6:36633749-36633771 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1007246449 6:40466647-40466669 ATGAAGAAGTGGAAGTGGATTGG - Intronic
1007510971 6:42374160-42374182 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
1007618232 6:43195162-43195184 ATTGAGAAGTAGAAGTTGCTTGG + Intronic
1007920660 6:45606719-45606741 ACAGAGAAGTAGAAGAAGAGAGG - Intronic
1007949096 6:45853889-45853911 ATAGAAAAGTACAAGCAGAAGGG + Intergenic
1008014003 6:46497457-46497479 ATGGAAAAGGAGAAGAAGTATGG - Intergenic
1008225014 6:48904446-48904468 GAGGAGAAGAAGAAGTAGAAGGG - Intergenic
1009640934 6:66335184-66335206 AAGGAGAATTAGAAGAAGAGAGG - Intergenic
1009722748 6:67495720-67495742 AAGGAGAAGGAGAAGTAGTATGG + Intergenic
1009730184 6:67592512-67592534 ATTGAGAAGTTCAAGTTGAAGGG - Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010900082 6:81416467-81416489 CATGAAAAGTAGAAGTAGAAAGG + Intergenic
1010908006 6:81516842-81516864 ATAGAGAAGGAAAAGGAGAATGG + Intronic
1011014923 6:82744037-82744059 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1011083683 6:83515803-83515825 AAAGAGAAGTAGTAGTAGTAGGG - Intronic
1011220643 6:85051315-85051337 ATGGAGGAGTGGAAGAACAAAGG + Intergenic
1011889033 6:92133746-92133768 ATGGTGAATTAGATGTGGAATGG - Intergenic
1011961779 6:93100058-93100080 AAGGAGAAGTAGAGGAAGATGGG - Intergenic
1012494383 6:99818522-99818544 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1012532284 6:100252172-100252194 ATAGAGAGGAAGAAGTAGATCGG + Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012931875 6:105325962-105325984 AAGGAGAAGTAGGAGTAGTCAGG + Intronic
1013075293 6:106765607-106765629 ATGGATAAGGAAAAGTAGAGTGG + Intergenic
1013918455 6:115369818-115369840 ATGGACCAATAGAAGTAGAGAGG - Intergenic
1014294200 6:119598407-119598429 AAGGAGAAGGAGAAGGGGAATGG + Intergenic
1014385106 6:120791189-120791211 ATAGATAGATAGAAGTAGAAGGG - Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015373684 6:132485522-132485544 GTGGATAAATAGAAGTAGAACGG + Intronic
1015437951 6:133211880-133211902 ATAGACAAGAAGAAATAGAATGG + Intergenic
1015996487 6:138999903-138999925 ATGTAGAATGAGAAGCAGAAAGG + Intergenic
1016161323 6:140884000-140884022 AAGGGGAAGGAGAAGGAGAACGG - Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016560667 6:145392419-145392441 AAGGAGCAGTAGAAGGAGAATGG - Intergenic
1016801470 6:148173501-148173523 AAGGAGAAGGAGAAGAAGAAGGG + Intergenic
1016919577 6:149278726-149278748 AAGGAGAAGTAGAGGAAGGAAGG + Intronic
1017339568 6:153305201-153305223 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017339582 6:153305249-153305271 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017339618 6:153305375-153305397 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic
1017645621 6:156537384-156537406 CTGGAGAAGGTGAAATAGAATGG - Intergenic
1017994888 6:159523365-159523387 GTGGAGGAGTAGGAGAAGAAGGG - Intergenic
1018012675 6:159685966-159685988 ATGGAGGCGTAGAAGAAGGAGGG - Intronic
1018722946 6:166587711-166587733 ATTCAGAAGTAGAAGATGAAGGG + Intronic
1019465901 7:1188775-1188797 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1019535282 7:1526141-1526163 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1019535306 7:1526228-1526250 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1019862059 7:3668383-3668405 ATGGAGAGGTCCATGTAGAAAGG - Intronic
1020652611 7:10893684-10893706 ATGGAAAAGTCTCAGTAGAAAGG - Intergenic
1021138451 7:16993944-16993966 TTGGAGAAGGAGAAGAACAATGG - Intergenic
1021289378 7:18823983-18824005 AAGAAGAAGAAGAAGGAGAAGGG + Intronic
1021562503 7:21982434-21982456 AAGGAGAATGAGATGTAGAAGGG + Intergenic
1021839600 7:24712118-24712140 ATGGAAAAGAAAAAGAAGAATGG + Intronic
1022214836 7:28248635-28248657 ATGGAGAAGTCCAACTTGAATGG + Intergenic
1022274416 7:28841799-28841821 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1022801288 7:33779805-33779827 CTGGGGAAGTAGAAGTGGATGGG - Intergenic
1022990710 7:35704522-35704544 ATGGAACAGTGGAAGGAGAAGGG - Intergenic
1023124781 7:36944858-36944880 ATGTAGAATTAGAGCTAGAAGGG + Intronic
1023622582 7:42088103-42088125 AAGGAGAAATAGAAGAAAAATGG - Intronic
1023750519 7:43367950-43367972 CTGGAGAGGTGGAAGCAGAAGGG - Intronic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1025636017 7:63319763-63319785 ATGGAGAAATTCATGTAGAATGG - Intergenic
1025646679 7:63428417-63428439 ATGGAGAAATTCATGTAGAATGG + Intergenic
1026606573 7:71821353-71821375 ATGAAGAAGAAGAAGTTTAAAGG + Intronic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1027572074 7:79882186-79882208 ATGGAGAAGGAGGGGAAGAAGGG - Intergenic
1027738341 7:81964661-81964683 ATGGAGAGGTATAAGTGGAAGGG + Intronic
1027900018 7:84100973-84100995 ATGGGGAAGTAGAAATAGCAGGG - Intronic
1028349099 7:89822024-89822046 ATGGAGAAATAAAAATAGATGGG - Intergenic
1029422096 7:100477178-100477200 ATGGAGAAGGAGGAGGAGAGGGG + Intronic
1030002729 7:105082631-105082653 AGGGAGAAGGGGTAGTAGAAGGG + Intronic
1030583071 7:111384152-111384174 ATGAAGAAGAAGGAGGAGAAAGG + Intronic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1030607415 7:111652456-111652478 ATAGAAAAGTATAAGTAAAATGG + Intergenic
1031110702 7:117605139-117605161 TTGGAAAAGAAGAAGTGGAATGG - Intronic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031377609 7:121047644-121047666 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1032133390 7:129250485-129250507 TTGGACAAGAAGAAGTAAAATGG - Intronic
1032640369 7:133759754-133759776 AGGGAAAAGAAGAAGGAGAAAGG + Intronic
1032736748 7:134699494-134699516 ATGGAGAAGGAAAGGCAGAAAGG + Intergenic
1033432340 7:141300569-141300591 AAGGAGAAGAAGCAGAAGAAGGG - Intronic
1033588145 7:142789379-142789401 ATGCAGAAGTGGAGTTAGAATGG - Intergenic
1033966698 7:146984034-146984056 ATGGAGAGGAAGAACAAGAAGGG - Intronic
1034354418 7:150441860-150441882 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1034354421 7:150441866-150441888 AAGCAGAAGGAGAAGGAGAAGGG - Intergenic
1034944915 7:155255640-155255662 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1035377931 7:158419032-158419054 ATGGTGAAGGAGAAGTGGCAAGG - Intronic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036563289 8:9916237-9916259 AAAGAGAAGGAGAAATAGAAAGG + Intergenic
1036912496 8:12768748-12768770 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1037208030 8:16348738-16348760 ATGGAAATGTAAAATTAGAAGGG - Intronic
1037218213 8:16484051-16484073 AAAGAGAAGGAGAAGAAGAAAGG + Intronic
1037369754 8:18163116-18163138 AAGGAGAGGAAAAAGTAGAAGGG + Intergenic
1037928402 8:22863192-22863214 ATGGAGAATGAGATGCAGAAAGG + Intronic
1038668021 8:29558119-29558141 AAGAAGAAGAAGAAGAAGAATGG + Intergenic
1038683899 8:29697593-29697615 ATTGAGAAGTATAATTATAAGGG - Intergenic
1039478412 8:37854020-37854042 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1039566625 8:38556575-38556597 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1039695350 8:39904755-39904777 AAGGTGAAGTAGAAGTAAATGGG - Intronic
1039789488 8:40863362-40863384 TTGGAGAAGTGGAGGTACAAAGG + Intronic
1039839549 8:41284198-41284220 ATGGAAGAGGAGAAGGAGAACGG + Intronic
1040044015 8:42943006-42943028 TTGAAGAAGTAGAACTAAAATGG - Intronic
1040670226 8:49680760-49680782 ATGGGGAAGTAGAATTAACAGGG + Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1041730285 8:61055636-61055658 GTGGAGACGTAGAAGCAGACAGG + Intergenic
1041884583 8:62793604-62793626 ATGGAGACGTAGTGGTAGGAGGG + Intronic
1042893653 8:73642178-73642200 ATAGAGAAGCAGTAGGAGAAAGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043385585 8:79744628-79744650 AAGGAGAAGTAAAAGGAGAAGGG + Intergenic
1044257897 8:90087251-90087273 ATGTAGAAGTAGAAGCTGAATGG + Intronic
1044402224 8:91786119-91786141 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402229 8:91786137-91786159 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044758666 8:95493601-95493623 ATCGAGAAGAAAAAGGAGAAAGG + Intergenic
1044928366 8:97228533-97228555 ATGGATAACTAGAAGTTGGAAGG - Intergenic
1045009234 8:97943382-97943404 ACAGAGAAGGAGAAGGAGAAAGG - Intronic
1045908532 8:107377573-107377595 TTGGAGAAGTGGAAGAAGAGAGG + Intronic
1046030119 8:108773705-108773727 ATGGAGAGGTCCAAGTAGTAAGG + Intronic
1046412653 8:113867375-113867397 AAGGAGGAGGAGAAGGAGAAAGG - Intergenic
1047731475 8:127732422-127732444 ATTGAGAAATAGAAAAAGAAAGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048072007 8:131030952-131030974 ATGGAAAAGTAGAAGACAAAGGG - Intronic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048417556 8:134243627-134243649 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1048430864 8:134369285-134369307 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1049887880 9:40399-40421 AGGAAGAAGGAGAAGAAGAAAGG - Intergenic
1050021280 9:1286972-1286994 AAGGAGAAGGGGAAGCAGAAGGG - Intergenic
1050255111 9:3785990-3786012 ATGGAGAAGGGAAACTAGAAAGG - Intergenic
1050679763 9:8097023-8097045 ATGAAAATATAGAAGTAGAAAGG - Intergenic
1050964848 9:11786628-11786650 CTGGAGAAGTAGAAATAATATGG - Intergenic
1051005699 9:12340748-12340770 ATGGGGAAGTAGAAATAGGCTGG - Intergenic
1051224408 9:14883873-14883895 AGCTAGAAGTGGAAGTAGAAAGG + Intronic
1051534966 9:18146946-18146968 AAGGAGAAAGAGAAATAGAAAGG - Intergenic
1051564322 9:18479819-18479841 AGGGAAAAGTACAAGTAGGAAGG + Intronic
1052141092 9:24984929-24984951 ATGGAGAAGGGAAAGGAGAAAGG + Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052232079 9:26165785-26165807 AGGGACAAGTAGAAGTATAGAGG + Intergenic
1052421085 9:28243710-28243732 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
1052593750 9:30532124-30532146 ATAGAAAAGTAAAGGTAGAATGG + Intergenic
1052721658 9:32178643-32178665 AGGGAGAAGCAGATGTGGAATGG + Intergenic
1053022802 9:34707704-34707726 GAGGAGAAGAAGAAGAAGAAAGG - Intergenic
1053190732 9:36064763-36064785 AGGGAGAACAAGAAGAAGAATGG - Intronic
1054848575 9:69822379-69822401 GTTGAGAAGTAAAAGCAGAAAGG - Intronic
1055080256 9:72261704-72261726 AGGAAGAAGAAGAAGAAGAAGGG - Intergenic
1055099129 9:72445191-72445213 ATGGAGAAGGAGGAGTGAAAAGG + Intergenic
1055211368 9:73798110-73798132 AAGAAGAAGTAGAAATTGAAAGG - Intergenic
1055526502 9:77139096-77139118 ATAGGAAAATAGAAGTAGAATGG + Intergenic
1055984563 9:82043932-82043954 TTGGAAAAGAAGAAGTAAAACGG - Intergenic
1056099540 9:83287578-83287600 ATGGTGAAGGTGAGGTAGAAAGG - Intronic
1056120101 9:83479308-83479330 AAGGAGAAGGAGGAGAAGAAGGG + Intronic
1056224274 9:84480208-84480230 GTGGTGAAGTAGAAGAATAAGGG + Intergenic
1056328014 9:85497160-85497182 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1056741856 9:89263516-89263538 ATACAGAAGAAGAAGAAGAAAGG - Intergenic
1057776127 9:98011337-98011359 ATGAAGATGAAGATGTAGAAGGG + Exonic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1059717354 9:116925677-116925699 ATGGAAAAATAGGAGTAGCAGGG - Intronic
1060127221 9:121059800-121059822 ATGGAGAAGCCCACGTAGAAAGG + Intergenic
1060206084 9:121683562-121683584 ATGGAGAAGGAGAAGTGTCAGGG + Intronic
1061656301 9:132093169-132093191 ATGGAGGAGCAGAGGTAGATGGG + Intergenic
1061732929 9:132630658-132630680 GTGGAGAAGTAAAATTAAAAAGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1203435896 Un_GL000195v1:136967-136989 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1185591635 X:1281152-1281174 AAGGAGGAGTAGGAGGAGAAGGG - Intronic
1185964344 X:4583565-4583587 TTGGACAACTGGAAGTAGAAAGG - Intergenic
1186077598 X:5897967-5897989 ATGGAGGAGGAGAGGAAGAAGGG - Intronic
1186445042 X:9620135-9620157 ATGGAGAAGTAGAAGCCACACGG - Intronic
1186471161 X:9823081-9823103 AGGGAGAAGGAGGAGGAGAAGGG - Intronic
1186471166 X:9823100-9823122 AGGGAGAAGGAGAAGGAGAAGGG - Intronic
1186471173 X:9823132-9823154 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
1186539557 X:10386610-10386632 ATGGACAAGAAGAAGAAGAAGGG + Intergenic
1186908744 X:14139037-14139059 AAGGAGGAGAAGAAGGAGAAGGG + Intergenic
1187579698 X:20594565-20594587 TAGGATATGTAGAAGTAGAAGGG - Intergenic
1187843793 X:23515444-23515466 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1187843796 X:23515450-23515472 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1187999078 X:24961591-24961613 TGGGAGAAGAGGAAGTAGAAAGG - Intronic
1188538835 X:31227045-31227067 GTGGAGAAGGAGGATTAGAAAGG - Intronic
1188980182 X:36720425-36720447 AAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1189110660 X:38286269-38286291 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189110675 X:38286320-38286342 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189400112 X:40659951-40659973 ATGAAGAAGGAGAACTAGATGGG + Intronic
1189589246 X:42494430-42494452 AGGGACTAGTAGAAGTGGAATGG - Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189684398 X:43548814-43548836 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1189947103 X:46190584-46190606 AAGGAGAAGAAGGAGAAGAAGGG - Intergenic
1190445627 X:50520967-50520989 ATGGCCAGGTAGAAGTAGGAAGG + Intergenic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190719023 X:53131595-53131617 TTGGCAAACTAGAAGTAGAAGGG + Intergenic
1191145082 X:57157132-57157154 AAGGAGAAATAAAAGTACAAGGG - Intergenic
1191170087 X:57436401-57436423 AAGGAAAGGTAGAAGTACAAAGG + Intronic
1192295163 X:69839764-69839786 ATGGTGAAGTAGTTGAAGAATGG + Intronic
1193047020 X:77064307-77064329 GTGGAGGAGGAGGAGTAGAATGG + Intergenic
1193118777 X:77801392-77801414 ACAGAGAAGTAGGAATAGAAGGG - Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1193688950 X:84615685-84615707 ATGGGAAATTAGAAGTAGAATGG - Intergenic
1193735866 X:85155494-85155516 ATTGAGAAGCAAAAGTAAAACGG + Intergenic
1193792705 X:85835086-85835108 ATAGAGAAGAAGAAGCAAAAAGG - Intergenic
1194247668 X:91536033-91536055 ATGCAGATCTAGAAGTAGACAGG - Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194728820 X:97430561-97430583 ATGGAGAAGTAAATGAAAAATGG + Intronic
1195309303 X:103615309-103615331 ATGGAGAAGTCCAAGTTCAAGGG + Intronic
1195415976 X:104619841-104619863 ATGGAGAAGTACAGGTGCAATGG + Intronic
1195681118 X:107547367-107547389 GTGGAGAAGGGGAAGTAGAAGGG - Intronic
1195921411 X:109987559-109987581 ATGGAGAAATGGAAGGAGACAGG + Intergenic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1196054161 X:111336968-111336990 AAGGAGGAGGAGAAGAAGAATGG + Intronic
1196654431 X:118202240-118202262 ATGGAGAGGTACATGTAGCAAGG - Intergenic
1196817771 X:119678596-119678618 AATGAGAAGGAGAAGCAGAAAGG - Intronic
1197165272 X:123370245-123370267 AGGGAGAAGGAAAAGTAGGATGG - Intronic
1197300557 X:124774918-124774940 ATGGAGAGGGAGCAGGAGAAGGG - Intronic
1197897922 X:131336352-131336374 ATGAAGAAGAACAAGTAGGAAGG - Intronic
1197941880 X:131798826-131798848 ATAGAGAAAAAGAAATAGAAAGG - Intergenic
1197985037 X:132257944-132257966 ATGGAGGAGAAAATGTAGAAAGG + Intergenic
1198005950 X:132492539-132492561 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1198133977 X:133728338-133728360 AATGAGAAGGAGAAGGAGAAAGG + Intronic
1198757405 X:139995856-139995878 AGGGAGAGGTAGATTTAGAATGG + Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1200269858 X:154672330-154672352 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1200379711 X:155822203-155822225 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200379716 X:155822221-155822243 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200379719 X:155822227-155822249 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200379724 X:155822245-155822267 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200566688 Y:4777563-4777585 ATGCAGATCTAGAAGTAGACAGG - Intergenic
1200757309 Y:7001935-7001957 ATGGAGAAGTAGAAGCCACATGG - Intronic
1201131954 Y:10959244-10959266 ATGGAGAGGAAGCAGTGGAATGG - Intergenic
1201452070 Y:14127767-14127789 ATGGAGAAAAAGAAGAGGAAAGG - Intergenic
1201453001 Y:14136300-14136322 AAGGAGAAGGAGGAGGAGAAGGG - Intergenic
1201517713 Y:14835726-14835748 ATGGAGGAGGAGAGGAAGAAAGG + Intronic