ID: 1167409244

View in Genome Browser
Species Human (GRCh38)
Location 19:49335307-49335329
Sequence TGTCCCAGTGGAGCAGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 257}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167409237_1167409244 -2 Left 1167409237 19:49335286-49335308 CCCCTCAGGTACCAGAGCATGTG 0: 1
1: 0
2: 1
3: 8
4: 153
Right 1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG 0: 1
1: 0
2: 2
3: 29
4: 257
1167409231_1167409244 22 Left 1167409231 19:49335262-49335284 CCTTGGTGCCCACAAATTCCAAG 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG 0: 1
1: 0
2: 2
3: 29
4: 257
1167409230_1167409244 30 Left 1167409230 19:49335254-49335276 CCATGAGTCCTTGGTGCCCACAA 0: 1
1: 0
2: 0
3: 16
4: 163
Right 1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG 0: 1
1: 0
2: 2
3: 29
4: 257
1167409236_1167409244 4 Left 1167409236 19:49335280-49335302 CCAAGGCCCCTCAGGTACCAGAG 0: 1
1: 0
2: 2
3: 29
4: 253
Right 1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG 0: 1
1: 0
2: 2
3: 29
4: 257
1167409233_1167409244 14 Left 1167409233 19:49335270-49335292 CCCACAAATTCCAAGGCCCCTCA 0: 1
1: 0
2: 1
3: 16
4: 137
Right 1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG 0: 1
1: 0
2: 2
3: 29
4: 257
1167409239_1167409244 -4 Left 1167409239 19:49335288-49335310 CCTCAGGTACCAGAGCATGTGTC 0: 1
1: 0
2: 0
3: 10
4: 127
Right 1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG 0: 1
1: 0
2: 2
3: 29
4: 257
1167409234_1167409244 13 Left 1167409234 19:49335271-49335293 CCACAAATTCCAAGGCCCCTCAG 0: 1
1: 0
2: 1
3: 23
4: 191
Right 1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG 0: 1
1: 0
2: 2
3: 29
4: 257
1167409238_1167409244 -3 Left 1167409238 19:49335287-49335309 CCCTCAGGTACCAGAGCATGTGT 0: 1
1: 0
2: 1
3: 9
4: 124
Right 1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG 0: 1
1: 0
2: 2
3: 29
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167409244 Original CRISPR TGTCCCAGTGGAGCAGGTGA GGG Intronic
900090349 1:917602-917624 GGTCCCAGTGCTGCAGGTGTGGG + Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900787637 1:4658696-4658718 TGGCCAAGTGGAGGAGCTGATGG + Intronic
900856702 1:5191149-5191171 TGTCCTATTGGAACAGGTCAAGG + Intergenic
901023602 1:6267513-6267535 TCTCCCAGTGGAGTTGGGGAGGG - Intronic
901220288 1:7579909-7579931 TGTCCCAGTGACGCAGGAGAAGG - Intronic
906032453 1:42732528-42732550 GGTGCCAGTGGAGCAGGGGTGGG - Intergenic
907349198 1:53811860-53811882 TGTTCCAGTGGAGGTGGTGAGGG - Intronic
907412287 1:54291275-54291297 TGTCACAGCAGAGGAGGTGAGGG - Intronic
909238650 1:73183621-73183643 AGTCAGAGTGGAGCAGGTAATGG - Intergenic
910598465 1:89005246-89005268 TGTTCCAGTGGAGGTGGTGGAGG + Intergenic
910865990 1:91788379-91788401 CATTCCAGTGGAGCAGGGGAAGG + Intronic
913191114 1:116413689-116413711 TACCCCAGTGGAGCATGGGATGG - Intergenic
913972997 1:143430277-143430299 TGTTCCAGTGGAGGTGGTGAAGG + Intergenic
914067381 1:144255884-144255906 TGTTCCAGTGGAGGTGGTGAAGG + Intergenic
914111772 1:144710470-144710492 TGTTCCAGTGGAGGTGGTGAAGG - Intergenic
915080456 1:153348549-153348571 TGTCCCAGCCCAGCAGGTCAGGG + Intronic
915121579 1:153632783-153632805 CGTGCCAGTGGAGCAGAGGAAGG + Intronic
916745582 1:167682548-167682570 TGTCCCCTTGGAGCAAGGGAGGG - Intronic
918709275 1:187706625-187706647 TGTCCAGGTGGTGCAGGGGAAGG + Intergenic
920087071 1:203425192-203425214 TGGTGCAGTGGATCAGGTGATGG + Intergenic
920963280 1:210682536-210682558 TGTCCCAGAGGAGCAGGCTATGG + Exonic
922673341 1:227532085-227532107 TGTTCCAGTGGAGGTGGTGGAGG + Intergenic
922793336 1:228322994-228323016 AGTCCAGGAGGAGCAGGTGAGGG - Intronic
923167410 1:231379241-231379263 TGTGCCACTGCAGCAGGTGGTGG - Intronic
923318517 1:232805539-232805561 TGCCGCAGTGGAGCAGGAGGAGG + Exonic
923772367 1:236948704-236948726 AGTCCCTGTGGAGCAGGTGCTGG - Intergenic
1062760856 10:17536-17558 TGTTCCAGTGGAGGTGGTGAAGG - Intergenic
1062888610 10:1038691-1038713 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888627 10:1038754-1038776 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888644 10:1038817-1038839 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888661 10:1038880-1038902 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888677 10:1038943-1038965 TGTCCCCATGGAGCAGGTGGAGG + Intergenic
1062888695 10:1039006-1039028 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888712 10:1039069-1039091 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888729 10:1039132-1039154 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1062888746 10:1039195-1039217 TGTCCCCAGGGAGCAGGTGGAGG + Intergenic
1067242249 10:44506807-44506829 CATCCCAGGGGAGCATGTGAAGG + Intergenic
1069707396 10:70467394-70467416 GGTCCCAGTGGTGGAGGTGGGGG + Intergenic
1069794569 10:71043884-71043906 TGCCCCAGGGGAGAAGGGGAGGG - Intergenic
1070590147 10:77795404-77795426 TGCCCCAGTGGAGCATCTGGGGG - Intronic
1071431631 10:85611481-85611503 TGTGTCAGCGGAGCAGGGGAGGG - Intronic
1073190423 10:101646910-101646932 AGTCCCAGTGGAGCCGGAGTTGG + Intronic
1073529435 10:104217732-104217754 TGATACAGTGGAGCAGGTGCTGG - Intronic
1075158837 10:120004902-120004924 TTTCCCACTGGAGCTGGTGGGGG + Intergenic
1075534779 10:123261640-123261662 TGTCCCTGTGGCACAGCTGAGGG + Intergenic
1076305329 10:129462072-129462094 CATCCCAGTGGGGCAGGGGAGGG + Intergenic
1076346817 10:129785003-129785025 TGTCCCAGGGCAGTAGGTGCTGG - Intergenic
1076585760 10:131546435-131546457 TGTGCCTGTGGAGAAGGTGGAGG - Intergenic
1077615751 11:3672268-3672290 TGACCCAGTGGAGCAGAAGATGG + Intronic
1078339746 11:10490169-10490191 TGTCACACTACAGCAGGTGAAGG + Intronic
1080698037 11:34620125-34620147 TGACCCAGTGAAGCAGGTACAGG + Intergenic
1081770231 11:45645810-45645832 TGGCCCTGTGGAGAAGCTGAGGG - Intergenic
1081931837 11:46876861-46876883 TGTCCCATTGTAGGCGGTGAGGG - Intronic
1083205358 11:61145536-61145558 TGGCTCTGAGGAGCAGGTGATGG - Intronic
1083736600 11:64685200-64685222 TGGCCTGGTGGAGCAGATGAGGG - Intronic
1083814516 11:65125178-65125200 TGACCCAGTGGAGGAGGGCAAGG + Intronic
1084562026 11:69910625-69910647 TGGCCCAGTGGAGCTTGTGGTGG + Intergenic
1085530552 11:77189750-77189772 GGTCAGAGTGGAGCAGGTCATGG + Intronic
1089733110 11:120531946-120531968 TGTCCCTGTGGAGCAGCAGATGG + Intronic
1089751557 11:120655169-120655191 TGTCCCAGTGAGGCATGTTAGGG + Intronic
1093356327 12:18172867-18172889 AGTCAGAGTGGAGCAGGTAAGGG - Intronic
1094288835 12:28823070-28823092 TGTGGCAGTGGAGTGGGTGAGGG + Intergenic
1094606846 12:31956633-31956655 AGTCAGGGTGGAGCAGGTGATGG + Intergenic
1094808590 12:34115239-34115261 TGTTCCAGTGGAAGTGGTGAAGG - Intergenic
1095534013 12:43224607-43224629 GGGCGCAGTGGAGCAGGGGATGG - Intergenic
1095959714 12:47826646-47826668 GGGCCCAGTGGAGCAAGTAATGG - Intronic
1098982651 12:76974165-76974187 TCTCCCACTGGAGCAACTGAAGG - Intergenic
1100300796 12:93305725-93305747 CATCCCAGTGGAGAAGGGGAAGG - Intergenic
1100512878 12:95294357-95294379 AATCCCAGAGGAGCAGGTAAGGG + Exonic
1102770929 12:115475176-115475198 TGTCCCCTTCTAGCAGGTGAAGG + Intergenic
1102927760 12:116839623-116839645 TGTCCAAGTGGAGGAGTGGATGG + Intronic
1104614957 12:130259772-130259794 TGGCCTGGAGGAGCAGGTGATGG - Intergenic
1106387214 13:29299455-29299477 TGTCCCTGTGGAGCTGATGGGGG + Intronic
1106844481 13:33723430-33723452 TGTCCCAGCTAAGCAAGTGAGGG + Intergenic
1107299414 13:38949143-38949165 TTTTCCAGTGCTGCAGGTGAGGG - Intergenic
1107374680 13:39789560-39789582 AGTCAGGGTGGAGCAGGTGATGG - Intronic
1108817149 13:54305657-54305679 TGTTCCAGTGGAGGTGGTGGGGG - Intergenic
1110764638 13:79268694-79268716 TGTCCTGGTGGTGGAGGTGATGG + Intergenic
1110792351 13:79600191-79600213 GGGCGCAGTGGAGCAGGGGATGG + Intergenic
1111969380 13:94895105-94895127 TTTCCCAGTGGAGTAGGAGAGGG - Intergenic
1113722325 13:112568598-112568620 TGTCCAAGTGGAGTAGATGTTGG - Intronic
1114429205 14:22645907-22645929 TGTCACAGTGGGGCTGGAGAGGG - Intergenic
1118387863 14:65271675-65271697 TGTCCCCGTCAAGAAGGTGAAGG + Intergenic
1119550775 14:75512382-75512404 TTACCCTGTGGAGCAGGAGAGGG + Intergenic
1121413303 14:93762472-93762494 TGTCCCAGGGGAACAGGACAGGG - Intronic
1122064827 14:99165591-99165613 TGGCACAGTGGAGCAAGTGCTGG + Intergenic
1122289827 14:100674589-100674611 CGTCCCAGTGGAGAAGGAGTGGG + Intergenic
1122444343 14:101758352-101758374 TGTCCCAGAGGAGCAGGGGTTGG + Intergenic
1122540569 14:102495732-102495754 AGTCCCAGTGGATCAGGACATGG - Intronic
1122615720 14:103016461-103016483 AGTGCCGGTGAAGCAGGTGAGGG + Intronic
1122718385 14:103708447-103708469 GGTCCCAGTGGTGCAGGGCAGGG - Intronic
1202854832 14_GL000225v1_random:43709-43731 TGTCCCAGGGGAGCCTGTGGTGG + Intergenic
1124155735 15:27223983-27224005 TCTCCCACTGGAGCTGGAGAGGG + Intronic
1124380771 15:29162913-29162935 TGTTCCAGTGGAGGTGGTGGGGG - Intronic
1124952599 15:34337643-34337665 GGTCCCAGTAGAGGAGGAGACGG + Exonic
1125724526 15:41861561-41861583 TGTTCCAGTGGCACAGGTTAGGG + Intronic
1126835099 15:52654565-52654587 TGTTCCGGAGGAGCAGGGGAAGG - Intronic
1128874027 15:71187347-71187369 TGTCCCCGTGGACTTGGTGAAGG + Intronic
1130044377 15:80432199-80432221 TGCCCCAGAGACGCAGGTGAAGG - Intronic
1131742006 15:95403092-95403114 TGTCCAAGGGGAGCAGAAGAAGG - Intergenic
1134510413 16:14842189-14842211 TGTTTCAGTAGAGCAGGTGTGGG + Intronic
1134698055 16:16240677-16240699 TGTTTCAGTAGAGCAGGTGTGGG + Intronic
1134973781 16:18554000-18554022 TGTTTCAGTAGAGCAGGTGTGGG - Intronic
1136294722 16:29295068-29295090 TTTCCATGAGGAGCAGGTGAAGG + Intergenic
1136533818 16:30887576-30887598 CCTCCCAGAGGAGGAGGTGAAGG + Intronic
1136586610 16:31190334-31190356 TTTCCCAGTGGAGGTGGTGGCGG + Exonic
1136735922 16:32467619-32467641 TGTTCCAGTGGATGTGGTGAAGG + Intergenic
1138460047 16:57142691-57142713 TGTCCCAGTGGAGGGGGAGCTGG + Intronic
1139482217 16:67236838-67236860 AGGCCCAGTGGAGGAGGTGGGGG + Intronic
1141155280 16:81592932-81592954 TTTGCCATTGGAACAGGTGATGG - Intronic
1142100625 16:88269112-88269134 TTTCCATGAGGAGCAGGTGAAGG + Intergenic
1203017153 16_KI270728v1_random:361955-361977 TGTTCCAGTGGATGTGGTGAAGG - Intergenic
1203035488 16_KI270728v1_random:635113-635135 TGTTCCAGTGGATGTGGTGAAGG - Intergenic
1144139625 17:12336271-12336293 TGTTCCAGTGGAGGTGGTGGGGG + Intergenic
1144533153 17:16059785-16059807 AGTACCAGAGGAGCAGGTGGTGG - Intronic
1146404839 17:32528196-32528218 TGGCCCAGTGGGGCAGAAGAGGG - Intronic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147169006 17:38607272-38607294 TGTCCCACTGGAGCTGGGAAGGG - Intergenic
1147535021 17:41315271-41315293 TGTCCCCCTGGAGCAGATGGAGG + Exonic
1149410856 17:56405047-56405069 TGTTCCAGTGGAGGTGGTGGTGG + Intronic
1149655928 17:58309613-58309635 TGTCCCACAGGGGCTGGTGATGG - Intronic
1151398106 17:73838466-73838488 GGTCCCAGGGGAGCCAGTGAGGG - Intergenic
1152088863 17:78236203-78236225 TGACCCAGTAGAGCAGGTCCTGG - Intronic
1152953763 18:17890-17912 TGTTCCAGTGGAGGTGGTGAAGG - Intergenic
1157161283 18:45316406-45316428 TGACCCAGAGGGGAAGGTGAAGG + Intronic
1157326757 18:46674701-46674723 TGTCCTAATGGAGTCGGTGATGG + Intronic
1160228939 18:77032071-77032093 TGTCCCACTGGAGAAGGCGCCGG + Intronic
1160858013 19:1226104-1226126 TGCCCCAGGGGAGCACGGGAGGG + Intronic
1161310159 19:3589593-3589615 TGACTCAGTGGAGGAGCTGAAGG - Intronic
1161346123 19:3769660-3769682 TGGCCCAGTGCAGCAGGAGGGGG - Exonic
1162566611 19:11448343-11448365 ACTCCCAGGGGAGCTGGTGATGG + Intronic
1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG + Exonic
1163321364 19:16576871-16576893 TGTGCCAGTGGAAGCGGTGACGG + Exonic
1163818940 19:19485188-19485210 TGTCCCAGGGTAGCATCTGAGGG + Intronic
1164320126 19:24137140-24137162 TGTTCCAGTGGAGGTGGTGAAGG + Intergenic
1166294982 19:41884478-41884500 TTTCCACCTGGAGCAGGTGAGGG + Exonic
1166604205 19:44126427-44126449 TGTTCCAGTGGAGGTGGTGGGGG + Intronic
1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG + Intronic
1168516290 19:57012911-57012933 TGTCCCACGGGAGCAGTGGATGG + Intergenic
925173436 2:1766765-1766787 GCTCCCAGAGGAGCAGGTGCAGG + Intergenic
925387755 2:3474100-3474122 TGTGACAGAGAAGCAGGTGAAGG + Intronic
932641146 2:73448483-73448505 TGGCCCAGTGGAGCAGAAGACGG + Exonic
934177693 2:89591233-89591255 TGTTCCAGTGGAGGTGGTGAAGG + Intergenic
934187088 2:89756729-89756751 TGTTCCAGTGGATGTGGTGAAGG + Intergenic
934287992 2:91665534-91665556 TGTTCCAGTGGAGGTGGTGAAGG + Intergenic
936263276 2:110980156-110980178 GGTCCCAGTTTTGCAGGTGAGGG - Intronic
936759962 2:115765721-115765743 TATCCCACAGGAGCAGGTGATGG + Intronic
938497466 2:131807993-131808015 TGTTCCAGCGGAGGTGGTGAAGG - Intergenic
940831031 2:158466209-158466231 TATCCAAGAGTAGCAGGTGAAGG - Intronic
941757435 2:169202832-169202854 GCGCCCATTGGAGCAGGTGAAGG + Exonic
944965621 2:204928861-204928883 TGACAAAATGGAGCAGGTGAGGG + Intronic
945668934 2:212778925-212778947 GGTCTCAGTGGAGCACGTCAAGG - Intergenic
947691560 2:232141626-232141648 GGTTCCATTGGAGCAGATGACGG + Intronic
947816570 2:233041411-233041433 TGTCCCTGTGGGGCAGCTGGCGG - Intergenic
947969161 2:234307451-234307473 TGTGTCAGTGGATCAGCTGAGGG - Intergenic
948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG + Intergenic
948902242 2:240962691-240962713 TGTCCCAGAGGAGGAGGCGGAGG - Intronic
1168836545 20:881476-881498 TTGCCCAGTGGAGAAGGGGAAGG + Intronic
1170770738 20:19330277-19330299 TGTCCCAGAGGAGGTGGTCAGGG + Intronic
1171902223 20:30868481-30868503 TGAGCCACTGGTGCAGGTGAGGG - Intergenic
1172550021 20:35791792-35791814 TGTCCGAGTGTGGGAGGTGAGGG + Intronic
1172786046 20:37469563-37469585 GGTCCTAGGGGAGCAGGAGAAGG - Intergenic
1173087375 20:39936861-39936883 TGTTCCAGTGAAGAAGGTGTTGG + Intergenic
1173306829 20:41858488-41858510 TGTCCCAGGGAAGCAGGGAAGGG + Intergenic
1173836718 20:46130653-46130675 TATCCCAGTGGAGGCTGTGAGGG + Intergenic
1174080945 20:47970438-47970460 GGTCAAAGTGGAGGAGGTGAGGG - Intergenic
1174388361 20:50200638-50200660 GGCCTCAGTGGAGCAGGTGGTGG - Intergenic
1175341407 20:58232787-58232809 TGTCCCCGTGGACCAGTTCATGG - Intergenic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1176180071 20:63745637-63745659 TGTGCCAGAGGAGGGGGTGAAGG + Exonic
1176215625 20:63946373-63946395 AGTGCCTGTGGAGCAGGAGAAGG - Intronic
1176257145 20:64158533-64158555 GGGGCCAGTGGAGCAGGTGGGGG - Intronic
1178781169 21:35604454-35604476 TGGCCCAGTGGAGCCAGTGGTGG - Intronic
1178836661 21:36104374-36104396 AGTCCGGGTGGAGCAGGTAATGG - Intergenic
1179123328 21:38568991-38569013 TGAGCCAGTGGAGCAGGTGAAGG + Intronic
1180536641 22:16398333-16398355 TGTTCCAGTGGATGTGGTGAAGG - Intergenic
1181980224 22:26760828-26760850 TGTCCCAGTGGAAAGGGTGTGGG + Intergenic
1183333636 22:37234563-37234585 GGTCTCAGTGGACCAGGTCAGGG - Intronic
1184091386 22:42294797-42294819 TGTCCAACTGCAGCAGGTGCAGG + Intronic
1184761600 22:46547808-46547830 TGTCCCCCTGAAGCAGGTGGCGG - Intergenic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1185298762 22:50068196-50068218 GGTCCCTGTGAAGCAGGTGGTGG + Intronic
950579393 3:13852632-13852654 TGTCCCATGGCAGCAAGTGAGGG + Intronic
950742768 3:15063420-15063442 GGTCCCAGTGGGGCAGCTGAAGG + Intronic
953972851 3:47360468-47360490 AGTCAGGGTGGAGCAGGTGATGG + Intergenic
953992668 3:47496236-47496258 GTTCCCAGTGGAGCAGGTCCTGG - Intronic
954106112 3:48410618-48410640 TGTCCCTGTGGAGGAGGAGATGG - Intronic
954136374 3:48583931-48583953 GGTCCCCCTGGACCAGGTGAAGG - Exonic
954440471 3:50519082-50519104 AGTCCCAGTGGGGCAGGGCAGGG - Intergenic
954861593 3:53695168-53695190 GGTCCCCGTGGAGGAGGTGCTGG + Intronic
957292749 3:78297719-78297741 TGTTTCAGTGGAGAAGGTAAAGG + Intergenic
957931021 3:86878482-86878504 TGTCACAGCAGAGCAGGAGAAGG - Intergenic
960243584 3:115374506-115374528 AGTGCCAGTGGAGCTGGTGCAGG - Intergenic
961683085 3:128611901-128611923 TGGCCCAGTGGACCAGCTGCAGG + Intergenic
962065967 3:131981080-131981102 TGTTCCAGTGGAGGTGGTGGGGG + Intronic
963536747 3:146538991-146539013 TGGACCAGTGAAGCAGGGGATGG + Intronic
965353109 3:167640194-167640216 TGTCACAGGGGAGAAGGAGATGG - Intronic
965395974 3:168160798-168160820 GGTCCCAAGGGAGCAGATGAGGG + Intergenic
965635215 3:170773774-170773796 AGTCCCTGTGGAGCAGAAGATGG + Intronic
966678414 3:182614193-182614215 TTTCCCAGTTAAGCAGGTGATGG - Intergenic
967915935 3:194578207-194578229 TGTCCCAGCCGAGCAGGGGCTGG - Intergenic
970125218 4:12802058-12802080 TGTTCTAGAGGAGCAGTTGATGG - Intergenic
970848355 4:20570974-20570996 TGTTCAAGAGGAGCAGGTGTAGG - Intronic
975091580 4:70410380-70410402 TCTCCCAGTAGAGCTGGTCATGG + Intergenic
975680258 4:76868629-76868651 TGTTCCAGTGGAGGTGGTGGAGG - Intergenic
975726274 4:77294715-77294737 CAACCCAGTGGATCAGGTGATGG + Intronic
976699711 4:87956466-87956488 TGTCACACTTGAGCAGGTGAGGG + Intergenic
978269924 4:106876670-106876692 TACCACAGTGGAGCAGGAGAGGG - Intergenic
979428990 4:120603799-120603821 TGTCCCAGTGCAGAATGTCAGGG + Intergenic
981760739 4:148192368-148192390 TATTCCAGTGGAGGTGGTGAAGG + Intronic
981833289 4:149026863-149026885 TGATTCAGTGGAGCTGGTGATGG - Intergenic
984943326 4:184952676-184952698 TGTCACAGAGGAGGAGGGGAGGG + Intergenic
985693556 5:1326973-1326995 TGTCCCTGTGGAGGAGGAGCTGG - Intronic
985693655 5:1327553-1327575 TGTCCCTGTAGAGCAGGAGCTGG - Intronic
987058460 5:14218688-14218710 AAGCCCAGTGGGGCAGGTGAGGG + Intronic
987396194 5:17426439-17426461 TTTTACAGTGGAGCTGGTGAGGG - Intergenic
987554997 5:19435419-19435441 TGTCCCTGTGGGGAAGTTGATGG - Intergenic
990301866 5:54457268-54457290 TGTCCCAGAGCAGCTGTTGAAGG - Intergenic
990609261 5:57441265-57441287 TGCCCCAGTTGGGCAGGTGAGGG + Intergenic
992623536 5:78616599-78616621 TGTCCCAGAGGAGAAGGAAAAGG + Intronic
996713659 5:126568477-126568499 TGTCCCAGGGGAGCAAGGGAAGG + Intronic
997309865 5:132870773-132870795 TGTGCCAGAGTAGCAGGTAAGGG - Intergenic
997616174 5:135247639-135247661 TGGCCCAGAGGAGCAGGCCAAGG + Intronic
999257410 5:150217230-150217252 TGCCCCAGGGAAGCAGGTGTGGG + Intronic
1000041212 5:157486480-157486502 AGTCCCAGGGGTGCAGGTGCAGG + Intronic
1001606699 5:172965476-172965498 TGTACCAGGTGAGAAGGTGAAGG - Intronic
1001754015 5:174152489-174152511 GGTACGAGTGGAGGAGGTGAGGG - Intronic
1004601017 6:17150053-17150075 TGTCCCTGTGGAGTTGGTGGAGG + Intergenic
1006020623 6:31115673-31115695 TTTCCCAGTTGAGAAGCTGATGG + Exonic
1006474839 6:34247112-34247134 TGTACATGGGGAGCAGGTGATGG + Exonic
1009578250 6:65494923-65494945 AGTCCCAGTGGACAAGGTGATGG + Exonic
1010590147 6:77702779-77702801 TGTCTCAGTGCAGAATGTGAAGG - Intronic
1010800040 6:80164473-80164495 TGAACCAGGGGAGTAGGTGATGG - Intronic
1011893252 6:92193796-92193818 TGTTCCAGTGGAGGTGGTGGGGG + Intergenic
1012156008 6:95820254-95820276 TGTTCCAGTGGAGGTGATGAGGG - Intergenic
1017446034 6:154508779-154508801 TCTCCCAGAGGAGCAGGAAATGG + Intronic
1017824332 6:158070485-158070507 TGTCCTAGGTTAGCAGGTGAAGG + Intronic
1018103058 6:160458285-160458307 TTTCTCAGAGGTGCAGGTGAGGG - Intergenic
1021433259 7:20585226-20585248 TGTGGCAGTGGAGCTGGGGAGGG - Intergenic
1023152650 7:37216348-37216370 TCTCTCAGTGGGGCAGGTTAGGG - Intronic
1026901323 7:74038958-74038980 TGTCTTCCTGGAGCAGGTGAGGG + Intronic
1031930234 7:127678043-127678065 TGTGCCAGTAGAACAGGTGTTGG - Intronic
1033273020 7:139950013-139950035 TAGCCCAGTGTTGCAGGTGATGG + Intronic
1034327290 7:150248143-150248165 TGTCCCAGGGAAGCAGGCCATGG + Intronic
1034467779 7:151239884-151239906 AGTCCCAGGGGAGGAGGGGATGG + Intronic
1034765919 7:153721314-153721336 TGTCCCAGGGAAGCAGGCCATGG - Intergenic
1035340522 7:158157774-158157796 TCTCCCAGGGGAGCAGGCGCAGG - Intronic
1035372478 7:158388214-158388236 TGTGGCCGTGGATCAGGTGATGG - Intronic
1036823962 8:11961888-11961910 TATCCCAGTGGAGTAGGAGTTGG + Intergenic
1037980406 8:23249360-23249382 TGTCGCTGTGGAGCTGTTGAAGG + Exonic
1039469365 8:37803782-37803804 TGTCACAGAGGAGCAGGCAATGG + Intronic
1040444297 8:47477988-47478010 TGCCCAAGTGGAACATGTGAAGG + Intronic
1040466320 8:47698838-47698860 AGTCCCACTGTAGCATGTGAGGG + Intronic
1045478000 8:102569466-102569488 TGTCCCACTGGAGCTGGCCAAGG - Intergenic
1045779877 8:105850081-105850103 TGTTCCAGTGGAGGTGGTGGAGG - Intergenic
1049496642 8:142938792-142938814 TCTCCCAGGGCAGCCGGTGATGG - Intergenic
1049746422 8:144265131-144265153 CCGCCCAGGGGAGCAGGTGAGGG + Intronic
1053135987 9:35650528-35650550 TGTCCCAGTGGACCAGGGGCCGG - Exonic
1055346930 9:75349755-75349777 TGTTCCAGTGGAGGTGGCGAGGG + Intergenic
1055502701 9:76917477-76917499 TGACCCAGTGTAGCAGATGTTGG + Intergenic
1057076976 9:92142973-92142995 CTTCACAGTGCAGCAGGTGACGG + Intergenic
1057802590 9:98199223-98199245 TGTCCCAGTGGGGAAACTGAGGG + Exonic
1058512598 9:105736781-105736803 TGTACCAGTTGGGCAGGTTATGG + Intronic
1058720326 9:107758480-107758502 CGTCCAGGTGGAGCATGTGATGG + Intergenic
1059287880 9:113192351-113192373 TTTCCCAGTGCAATAGGTGAAGG + Intronic
1060910443 9:127345670-127345692 TGCTCCATTGAAGCAGGTGAAGG - Intronic
1061541785 9:131281414-131281436 TGTCCCAGTTAGGCAGGTCAGGG - Intergenic
1062191952 9:135252701-135252723 AGGCCCAGCGGAGCAGCTGATGG - Intergenic
1062375955 9:136262018-136262040 TGTCCCCATGGAGCAGGGGAGGG - Intergenic
1062463019 9:136669706-136669728 GGGGCCTGTGGAGCAGGTGAGGG + Exonic
1062667218 9:137681220-137681242 TGTCCTGCTGGGGCAGGTGATGG + Intronic
1185595094 X:1301493-1301515 TTTCCCAGTGGAGCAGAGGGAGG - Intronic
1185737353 X:2503638-2503660 GGTCCCAGTGTTGCAGGAGAGGG - Intergenic
1190362915 X:49666143-49666165 TGGCCTAGTGGAGCAGCTGCGGG - Intergenic
1192014570 X:67315675-67315697 TGTTCCAGTGGAGGTGGTGGAGG + Intergenic
1192881980 X:75295285-75295307 TGTCCCAGTGTTGGAGGGGATGG + Intronic
1192995084 X:76505154-76505176 TGTTCCAGTGGAGGTGGTGGTGG + Intergenic
1194278181 X:91913320-91913342 TTTCCCAGTGGAGTAGCTCATGG + Intronic
1195914770 X:109925298-109925320 TGTGCCACTGCAGCAGGTGGTGG + Intergenic
1196108996 X:111926112-111926134 TGGCTCAGTGGAGCAGGGGGAGG + Intronic
1196456318 X:115893778-115893800 TGTCACAGGGGAGCAGTAGATGG + Intergenic
1197407099 X:126066028-126066050 AGTGCCAGTGGAGCATGGGAGGG - Intergenic
1198730097 X:139719440-139719462 TGTCCAAGGGCAGCAGATGAAGG - Intergenic
1199003055 X:142663117-142663139 TGTCCCAGTGGAGAGTGTGTGGG - Intergenic
1200595518 Y:5135395-5135417 TTTCCCAGTGGAGTAGCTCATGG + Intronic
1200762509 Y:7053315-7053337 TGTCCCCTTTGAGCAGGTTAAGG + Intronic
1202415689 Y:24619868-24619890 TGTCCCAGTAGGGCAGGGCATGG - Intronic
1202455098 Y:25050218-25050240 TGTCCCAGTAGGGCAGGGCATGG + Intronic