ID: 1167409487

View in Genome Browser
Species Human (GRCh38)
Location 19:49336663-49336685
Sequence GAGGAGGAGCTGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4266
Summary {0: 1, 1: 2, 2: 74, 3: 788, 4: 3401}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167409477_1167409487 20 Left 1167409477 19:49336620-49336642 CCAATGTCACAGAACAAGTGATA 0: 1
1: 0
2: 2
3: 28
4: 260
Right 1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG 0: 1
1: 2
2: 74
3: 788
4: 3401
1167409476_1167409487 25 Left 1167409476 19:49336615-49336637 CCAAGCCAATGTCACAGAACAAG 0: 1
1: 0
2: 1
3: 47
4: 365
Right 1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG 0: 1
1: 2
2: 74
3: 788
4: 3401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167409487 Original CRISPR GAGGAGGAGCTGAAGGAGGA AGG Intronic
Too many off-targets to display for this crispr