ID: 1167409487 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:49336663-49336685 |
| Sequence | GAGGAGGAGCTGAAGGAGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4266 | |||
| Summary | {0: 1, 1: 2, 2: 74, 3: 788, 4: 3401} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1167409477_1167409487 | 20 | Left | 1167409477 | 19:49336620-49336642 | CCAATGTCACAGAACAAGTGATA | 0: 1 1: 0 2: 2 3: 28 4: 260 |
||
| Right | 1167409487 | 19:49336663-49336685 | GAGGAGGAGCTGAAGGAGGAAGG | 0: 1 1: 2 2: 74 3: 788 4: 3401 |
||||
| 1167409476_1167409487 | 25 | Left | 1167409476 | 19:49336615-49336637 | CCAAGCCAATGTCACAGAACAAG | 0: 1 1: 0 2: 1 3: 47 4: 365 |
||
| Right | 1167409487 | 19:49336663-49336685 | GAGGAGGAGCTGAAGGAGGAAGG | 0: 1 1: 2 2: 74 3: 788 4: 3401 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1167409487 | Original CRISPR | GAGGAGGAGCTGAAGGAGGA AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||