ID: 1167412642

View in Genome Browser
Species Human (GRCh38)
Location 19:49354124-49354146
Sequence CGGTGAGGCAGGAGTGTTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167412642_1167412648 14 Left 1167412642 19:49354124-49354146 CCGTCAACACTCCTGCCTCACCG 0: 1
1: 0
2: 4
3: 37
4: 280
Right 1167412648 19:49354161-49354183 TACCCAACCAATGCCTAGCCTGG 0: 1
1: 0
2: 1
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167412642 Original CRISPR CGGTGAGGCAGGAGTGTTGA CGG (reversed) Intronic
900282490 1:1880030-1880052 GGCTGAGGCAGGAGGATTGATGG - Intronic
900324670 1:2102757-2102779 CCGTGACGCAGGAGAGTTGGGGG - Intronic
901144055 1:7053415-7053437 CGCAGAGGCAGGAGTGATGCAGG - Intronic
901357458 1:8663761-8663783 AGGTGAGGCTGGAGAGGTGAAGG - Intronic
902670832 1:17972321-17972343 CGGTGAAGCAGCGGGGTTGAGGG + Intergenic
903261927 1:22136209-22136231 CCCTGAGGCAGGTGTGTTGTTGG + Intronic
904194175 1:28772250-28772272 GGCTGAGGCAGGAGAGTTGCTGG + Intergenic
904676814 1:32203942-32203964 CGGTCAGGAAGGAGTGCTGCAGG - Exonic
905242480 1:36589821-36589843 GGGTGAGCCAGGAGTGGTAAAGG - Intergenic
905383550 1:37582059-37582081 CGCTGAGGCAGGAGGATTGCTGG - Intronic
905519437 1:38586789-38586811 CGGGGAGGTGGGAGTGTCGATGG + Intergenic
905689061 1:39929267-39929289 CTGTGAGGGAGGAGAGTTTAGGG + Intergenic
905822261 1:41002743-41002765 GGCTGAGGCAGGAGGGTTGCTGG + Intronic
906084851 1:43122750-43122772 CGCTGAGGCAGGAGAATTGCTGG + Intergenic
906098737 1:43242067-43242089 CAGTGATGCAGGACTGTTGCAGG + Intronic
906661981 1:47589546-47589568 CGGTGAGGAAGGAGGGATGATGG - Intergenic
907104280 1:51867073-51867095 GGCTGAGGCAGGAGTATTGCAGG - Intronic
907237835 1:53063493-53063515 CGGCGAGGCAGGAGGGCTCATGG + Intronic
907717291 1:56938974-56938996 AGAGGAGGCAAGAGTGTTGACGG - Intronic
908423620 1:63983581-63983603 CGGTAAGGCAGGAGTGTGGCTGG + Intronic
910323049 1:85971106-85971128 GGGTGAGGCAGGAGGATTGCTGG + Intronic
910401694 1:86843716-86843738 CGGTGTGGCAGGGGTGGTGGGGG + Intergenic
911702135 1:100966125-100966147 GGCTGAGGCAGGAGGGTTGCTGG + Intronic
912432447 1:109636089-109636111 TAGGGAGGCAGGAGAGTTGAAGG - Intergenic
913089164 1:115465031-115465053 TGGGGAGGCAGGGGTGATGAGGG - Intergenic
914428747 1:147600655-147600677 CTGGGATGCAGGAGTGTTGGAGG + Intronic
916919002 1:169441440-169441462 AGGTGAGGAAGGAATGATGAGGG + Intronic
918594186 1:186273887-186273909 GGCTGAGGCAGGAGAGTTGCTGG + Intergenic
919684967 1:200475637-200475659 ACGTGAGGCATGAGTGGTGATGG + Intergenic
920094463 1:203477121-203477143 TGGAGAGGGAGGAGTGTGGAGGG + Intronic
920603867 1:207360146-207360168 TGGTGAACCAGGGGTGTTGATGG + Exonic
922247401 1:223813808-223813830 CTCTGAGGTAGGAGTGATGATGG - Intronic
923494981 1:234516535-234516557 AGCTGAGGCAGGAGAGTTGCTGG - Intergenic
1062795715 10:343644-343666 CAGGGAGGCAGGAGTCTGGATGG - Intronic
1062810300 10:458457-458479 CGGTGAGGCAGGAATGTAGAGGG - Intronic
1062810310 10:458523-458545 CGGTGACGCAGGAATGTAGAGGG - Intronic
1062810354 10:458801-458823 CGGTGAGTCAGGAATGTAGAGGG - Intronic
1063276573 10:4574909-4574931 TGTTGAGAGAGGAGTGTTGAAGG - Intergenic
1063399398 10:5727756-5727778 AGGTGAGCAAAGAGTGTTGACGG - Intronic
1063952545 10:11237404-11237426 GGGTGAGGCAGGAGTGTGGCTGG + Intronic
1064890929 10:20172394-20172416 CGGTGAGGCAGGTGGGCTGCGGG - Intronic
1064959715 10:20950358-20950380 GGTTGAGGCAGGATTGTTGAAGG - Intronic
1065822301 10:29536808-29536830 AGCTGAGGCAGGAGAGTTGCTGG + Intronic
1067328028 10:45288194-45288216 CGCTAAGGCAGGAGTGTTCCTGG - Intergenic
1067452146 10:46388354-46388376 AGGTGAGGCAGGATTGTTGATGG + Intronic
1067585091 10:47471401-47471423 AGGTGAGGCAGGATTGTTGATGG - Intronic
1068090288 10:52425049-52425071 CAGTGAGCCAGGAGTGCTGATGG + Intergenic
1069364507 10:67683462-67683484 CTGAGAGGCAGGATTGCTGAAGG - Intronic
1069902522 10:71714268-71714290 CTCTGAGGCAGGAGTCTTGGTGG - Exonic
1069975284 10:72207910-72207932 GGTTGAGGCAGGAGTATTGCTGG - Intronic
1070119322 10:73560284-73560306 GGGTGAGGCTAGAGTGATGATGG - Intronic
1070776341 10:79112047-79112069 TGGTGTGGCTGGAGTGTAGAGGG + Intronic
1071319294 10:84436670-84436692 GCGGGAGGCAGGTGTGTTGAGGG + Intronic
1071440430 10:85687527-85687549 GGCTGAGGCAGGAGGGTTGCTGG + Intronic
1071560088 10:86639169-86639191 AGGTGAGGGAGGAGAGTTGTAGG + Intergenic
1072815368 10:98503109-98503131 GGCTGAGGCAGGAGAGTTGCTGG + Intronic
1072826937 10:98616335-98616357 CGGTGTGCCAGGAATGGTGATGG - Intronic
1073300078 10:102465842-102465864 AGCTGAGGCAGGAGTGTGCAGGG - Intronic
1075356715 10:121784756-121784778 GGCTGAGGCAGGAGTATTGCTGG + Intronic
1076719784 10:132388054-132388076 CGGTGTCCCAGGAGTGCTGATGG + Intergenic
1077092821 11:787460-787482 CGGGGAGGCAGGGATGTCGAGGG - Exonic
1077290586 11:1788931-1788953 GGCTGAGGCAGGAGAGTTGCTGG + Intergenic
1078153829 11:8781138-8781160 CTGTGAGGCCGGAGCATTGATGG + Intronic
1080875241 11:36268934-36268956 TGGTAAGGCAGGACTGATGACGG + Intergenic
1083222370 11:61261117-61261139 GGCTGAGGCAGGAGAGTTGCTGG + Intronic
1083455319 11:62774846-62774868 GGCTGAGGCAGGAGAGTTGGGGG + Intronic
1083506017 11:63157985-63158007 CAGTGAGCCAGGAGTGCTGATGG - Intronic
1084118745 11:67056810-67056832 CGGCGGGGCAGGAATGTGGAAGG - Exonic
1087015199 11:93548010-93548032 CAGTCAGGCAGCAGTTTTGAGGG - Intergenic
1087247368 11:95854907-95854929 GGTTGAGGCAGGAGGATTGATGG - Intronic
1088463932 11:110112938-110112960 CAGTGGGGCAGGAGAGATGACGG - Intronic
1089109888 11:116047006-116047028 GGCTGAGGCAGGAGAGTTGCTGG + Intergenic
1089216250 11:116836417-116836439 GGGTGAGACAGAAGGGTTGAGGG + Intronic
1090584252 11:128193111-128193133 AGGTGGGGCTGGAGTGTTGAGGG - Intergenic
1090642197 11:128739420-128739442 GGGTGGGGCAGGGGGGTTGAGGG - Intronic
1091441854 12:517204-517226 CAGCAAGGCAGCAGTGTTGATGG + Intronic
1093144210 12:15544946-15544968 AGGTTAGGCAGAAGAGTTGAAGG - Intronic
1093149715 12:15606430-15606452 CGATGAGCCAGGACTGCTGAGGG - Intergenic
1095328124 12:40922868-40922890 GGCTGAGGCAGGAGAATTGATGG + Intronic
1097089739 12:56495390-56495412 GGTTGAGGCAGGAGAGTTGCTGG - Intergenic
1101301709 12:103489672-103489694 CTGTGAGGCTGCAGTGTGGATGG - Intronic
1102122705 12:110454921-110454943 GGCTGAGGCAGGAGAGTTGCTGG - Intronic
1103061576 12:117862828-117862850 GGGTGAGGCAGGAGAATGGAGGG - Intronic
1103092545 12:118107598-118107620 GGCTGAGGCAGGAGGGTTGCTGG + Intronic
1104349420 12:128031882-128031904 TAGTGAGCCAGGAGTGCTGATGG - Intergenic
1106051486 13:26194261-26194283 GGGAGAGGCAAGAGAGTTGAGGG + Intronic
1110523227 13:76505422-76505444 TGGTGAGGGAGGAGTGTTCCAGG - Intergenic
1111866363 13:93773724-93773746 GGGTGAGGCAGGAGTGGTAACGG - Intronic
1112247650 13:97749107-97749129 CGGTCAGGCAGGTGACTTGAGGG - Intergenic
1112592540 13:100776833-100776855 CAGTGAGCCAGGAGTGCTGATGG - Intergenic
1113373332 13:109741950-109741972 CTCTGAGGCTGGAGTGCTGAGGG - Intergenic
1113882446 13:113635284-113635306 CGGTGTGGCAGCCGTGGTGATGG + Intronic
1115142561 14:30190018-30190040 CAGTGAGGCAGGGGAATTGAAGG - Intronic
1115704109 14:35980842-35980864 CGGGGTGGCAGGAGTGGGGAGGG - Intergenic
1117181175 14:53193431-53193453 CAGTGAGCCAGGAGTGCTGACGG - Intergenic
1119803468 14:77465925-77465947 CGCTGAGGCAGGAGAATTGCTGG - Intronic
1120802840 14:88711842-88711864 AGCTGAGGCAGGAGGGTTGATGG + Intronic
1121686236 14:95837303-95837325 GGCTGAGGCAGGAGAGTTGAGGG + Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122048442 14:99039518-99039540 AGTTGAGGCAGGAGGGTAGAGGG - Intergenic
1122352346 14:101103455-101103477 CAGAGAGGCTGGAGTGCTGAGGG - Intergenic
1124552036 15:30690432-30690454 AAGTGAGGCAGGACAGTTGAAGG + Intronic
1125404116 15:39335232-39335254 CGGCGAGGTGGGAGTGGTGAGGG - Intergenic
1127522091 15:59753278-59753300 CAGTGAAGCAGCAGTGATGAGGG - Intergenic
1127618399 15:60709839-60709861 GAGTGGGGCAGGAGTGTTGGGGG - Intronic
1128998621 15:72315590-72315612 AGGAGAGGCATCAGTGTTGAGGG - Intronic
1130965389 15:88693885-88693907 CCGTGAGGCAGAAGAGATGAGGG + Intergenic
1132019222 15:98346101-98346123 CCGTGAGGCGGGATTGTTGTTGG - Intergenic
1132368565 15:101277007-101277029 CGGGGAGTCAGGAGTGTGTATGG + Intronic
1133410847 16:5567509-5567531 GGGTGAGGCAGCAGTGGTGCAGG + Intergenic
1134275486 16:12772162-12772184 TAGTGAGGAAGGAGTGTTGATGG + Intronic
1136088388 16:27901848-27901870 CCATGAGGCTGGAGTGTGGAGGG - Intronic
1137705920 16:50535809-50535831 AGGAGAGGCAGGAGTGGGGAGGG - Intergenic
1138506366 16:57480262-57480284 GGGTGGGGCAGGAGGGTAGAGGG - Intronic
1141551371 16:84808845-84808867 AGGAGAGGCAGGTGTGTTGAAGG - Intergenic
1142283073 16:89159625-89159647 CGCTGAGGCAGGCGAGTTGAGGG + Intergenic
1142988515 17:3712840-3712862 GGGTGAGGCAGGAGAATTGCTGG + Intergenic
1143650076 17:8257937-8257959 TGGTGAGGCTGGGGTGTGGAGGG + Exonic
1144758453 17:17694196-17694218 CGGGGAGGCAGCCGTGCTGAGGG + Intronic
1145392074 17:22462810-22462832 GAGTGAGGCAGGAGGGTTCAGGG + Intergenic
1145875583 17:28316742-28316764 CAGGGAGGCAGGGGTGTTCAGGG - Intergenic
1146159173 17:30550715-30550737 TGGTGAGGCAGGGGTGTGGCTGG - Intergenic
1147602361 17:41754456-41754478 TGGGGAGCCAGGAGTGTTGGGGG - Intergenic
1147818826 17:43229611-43229633 GGCTGAGGCAGGAGGGTGGATGG + Intergenic
1147832109 17:43304313-43304335 GGCTGAGGCAGGAGGGTGGATGG + Intergenic
1147888037 17:43697718-43697740 CTGTGAGGAAGGCGTGTGGAAGG + Intergenic
1148072206 17:44915016-44915038 CTGTGAGGCAGAAGTGAGGAGGG - Exonic
1148497170 17:48059884-48059906 CTGTGAGGCAGGGGTGGTGGTGG + Exonic
1148741904 17:49897821-49897843 AGGTGGGACAGGAGTGCTGATGG - Intergenic
1148761403 17:50003594-50003616 CGGTGAGGCAAGAGGGTAGATGG + Intergenic
1148874906 17:50681298-50681320 CTGAGAGGCAGGAAGGTTGAGGG - Intronic
1149498821 17:57136104-57136126 GGGCGAGGCAGGAGTCCTGAGGG + Intergenic
1149681913 17:58513279-58513301 GGGTAAGGCAGGAGTGGGGATGG + Intronic
1150655266 17:67035009-67035031 GAGGGAGGCAGGAGTGTTGGAGG + Intergenic
1151094412 17:71479680-71479702 CCAGGAGGCAGGGGTGTTGAAGG - Intergenic
1151409431 17:73912043-73912065 GGGTGGGGCAGGACTGTTTATGG - Intergenic
1151461994 17:74259972-74259994 CTGGGAGGCAGAAGTCTTGATGG + Intronic
1151784775 17:76270204-76270226 CGGCGTGGCAGGGGTGTTGCTGG - Exonic
1152194393 17:78908618-78908640 AGGTGAGGCAGGTGTTTGGATGG - Intronic
1152210436 17:79000426-79000448 CGGAGAGGCAGGAGGGGTGGAGG - Intronic
1152828468 17:82482314-82482336 TGATGTGGCAGGGGTGTTGAAGG + Intronic
1152959573 18:71128-71150 GGCTGAGGCAGGAGTATTGCTGG + Intronic
1153544816 18:6194703-6194725 CAGTGAGGAAGGAGTGCTGGGGG - Intronic
1154950747 18:21206992-21207014 CGGTGAGGCAGGAGGATTGCTGG + Intergenic
1155317189 18:24583798-24583820 CGGTGAGGCAGAATAGTTAATGG - Intergenic
1155551667 18:26972021-26972043 AGGTGTGGCAGGGGTGTGGAGGG + Intronic
1157395469 18:47337503-47337525 GTGTGAGGCAGGAGTGGTGAGGG - Intergenic
1158119236 18:54030037-54030059 GGGTATGGGAGGAGTGTTGATGG - Intergenic
1159095266 18:63894581-63894603 CGGGCAGGCAGCAGTGTTGTGGG + Intronic
1160829067 19:1094442-1094464 GGCTGAGGCAGGAGGGTTGCTGG + Intronic
1161025969 19:2037365-2037387 TGCTGAGTCAGGAGTTTTGAGGG - Intergenic
1161405787 19:4090486-4090508 GGGTGAGGCAGGAGGGTGGGTGG + Exonic
1162426324 19:10598584-10598606 AGCTGAGGCAGGAGAGTTGCTGG - Intergenic
1162510088 19:11112805-11112827 GGGTGAGGCAGGAGAATTGCTGG - Intronic
1165829038 19:38721475-38721497 CTGTGGGGCAGGAGTCTGGAGGG - Intronic
1166179306 19:41095731-41095753 AGGAGAGGCAGGAGGGGTGAAGG - Intronic
1167132426 19:47595802-47595824 GGGTGAGGCAGGAGAATTGCTGG - Intergenic
1167412642 19:49354124-49354146 CGGTGAGGCAGGAGTGTTGACGG - Intronic
1167595380 19:50424856-50424878 GGCTGAGGCAGGAGAGTTGCTGG + Intronic
1167611743 19:50511110-50511132 CGGAGAGGCAGGCGGGGTGAGGG - Exonic
1168179576 19:54652045-54652067 CGGTGAGGTAGGGGAGATGAGGG - Intronic
926938100 2:18106384-18106406 AGGTGAGGAAGGAGTGTTAAGGG + Intronic
927178492 2:20427112-20427134 GGGTGAGGGGGGAGTGTAGAGGG + Intergenic
929159948 2:38822013-38822035 TGGTGGAGCAGGAGTGTTGGTGG - Intronic
933792421 2:85893727-85893749 CTGTGAGGCAGGAGGGGTGAGGG + Intergenic
937938699 2:127268052-127268074 GGCTGAGGCAGGAGTATTGCTGG - Intronic
937972970 2:127564548-127564570 GGGTGAGGAAGGTGTGTGGAGGG + Intronic
937973790 2:127568794-127568816 GGGTGAGGCAGGAGAATTGCTGG + Intronic
937988203 2:127648051-127648073 CGGTGAGGGCGGAGAGCTGAGGG - Exonic
938450211 2:131411673-131411695 CGGACAGGCTGGAGTGTTAAGGG - Intergenic
938946964 2:136221494-136221516 AGGTGAAGCAGCAGTGTTGATGG + Intergenic
939166662 2:138648110-138648132 CGGTGAGGCTGGAATTGTGATGG - Intergenic
940612470 2:156007470-156007492 CGGTGAGGCAGCAGTGCGGTCGG - Intergenic
941283918 2:163585391-163585413 TGGTGAGCCAGGCGTGTTTAAGG + Intergenic
941733037 2:168940184-168940206 CAGTGAGGAAGGTGTGTTGAAGG + Intronic
942110343 2:172675682-172675704 AGGTGAAGCAGCAGTGCTGAGGG + Intergenic
942827972 2:180203692-180203714 CTGTGAGTTAGGAGTGTTGGAGG + Intergenic
944959429 2:204854324-204854346 AGGTGAGGTAGAAGTGATGAGGG + Intronic
945947107 2:216004997-216005019 CGCTGAGGCAGGGGTGTGGGTGG + Intronic
946570026 2:221014270-221014292 CAGTGAGTCAGGAGTGCTGATGG - Intergenic
948114442 2:235483834-235483856 GGCTGAGGCAGGAGAATTGAAGG + Intergenic
948259168 2:236590280-236590302 GGGTGAGGCAGGAGAGGGGAGGG - Intergenic
948484706 2:238272964-238272986 CTGTAAGGCAGGAGTGTTTGGGG - Intronic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
1169494518 20:6102126-6102148 GGCTGAGGCAGGAGTATTGCTGG - Intronic
1172777856 20:37417660-37417682 CGGTGCGGCAGGAGTGCTCCTGG - Intergenic
1173747229 20:45447317-45447339 GGCTGAGGCAGGAGAATTGAAGG - Intergenic
1173796710 20:45865890-45865912 GGGTGAGGCAGGAGAATTGCTGG + Intronic
1174644364 20:52072734-52072756 AGGTGAGGCACACGTGTTGATGG + Intronic
1175046715 20:56113262-56113284 AGGTGAGGCAGGAGGATTGGAGG - Intergenic
1175299327 20:57931903-57931925 AGCTGAGGCAGGAGAGTTGCTGG - Intergenic
1175392627 20:58636698-58636720 CCGTGAGGCTGGAGTGTGGCAGG - Intergenic
1175780227 20:61677405-61677427 CTGTGAGGCAGGAGTCTGGAGGG - Intronic
1175955172 20:62605411-62605433 GGGTGAGGCAGGAGGGTTGGGGG - Intergenic
1176409618 21:6441401-6441423 GGCTGAGGCAGGAGGATTGATGG - Intergenic
1177433795 21:21024784-21024806 AGCTGAGGCAGGAGAGTTGCTGG + Intronic
1179685111 21:43049723-43049745 GGCTGAGGCAGGAGGATTGATGG - Intergenic
1180847784 22:18993813-18993835 CAGTGAGGCAGGAGTCATAATGG + Intergenic
1180889871 22:19279234-19279256 GGGTGAGGCAGGAGAATTGCTGG - Intronic
1182454499 22:30441243-30441265 CAGTGAGTCAGGAGTGCTGATGG + Intergenic
1182650824 22:31849678-31849700 GGCTGAGGCAGGAGTATTGCTGG + Intronic
1183063522 22:35349238-35349260 AGGTGAGGCAGCAGTGAGGAAGG - Intergenic
1184155421 22:42663587-42663609 GGGTGAGGAAGGGGTGTTGGGGG + Intergenic
1184236357 22:43185347-43185369 AGGTGAGGCAGGAGGGCTGATGG + Intronic
1185299569 22:50072407-50072429 CGCTGAGGCATGCGTGGTGAGGG - Intronic
1185392099 22:50567904-50567926 GGGTGAGGCAGGTGTGGTCAGGG - Intergenic
950055030 3:10017611-10017633 CTGTGAGGCCGGACTGCTGAGGG + Intergenic
952822649 3:37498487-37498509 CGGCGGGGCAGGAGTGTGGAGGG + Intronic
953244417 3:41177638-41177660 AGGAGAGGCTGGAGTGTAGATGG - Intergenic
955633234 3:60997487-60997509 CTGTGGGGTGGGAGTGTTGAGGG + Intronic
956293047 3:67681868-67681890 TTGTGAGACAGGAGTGTAGATGG - Intergenic
956490598 3:69767482-69767504 GGCTGAGGCAGGAGAGTTGCTGG + Intronic
957593104 3:82225663-82225685 GGGTAAGGCAGCTGTGTTGAGGG + Intergenic
958436976 3:94108764-94108786 GGCTGAGGCAGGAGAATTGATGG - Intronic
960519154 3:118635564-118635586 CACTGAGGCAGGAGTCGTGAAGG - Intergenic
961168000 3:124776894-124776916 GGGTGAGGCATGTGTGTTAAGGG + Intronic
961491089 3:127257303-127257325 TGGGGAGGTAGGGGTGTTGAGGG - Intergenic
963191043 3:142473644-142473666 GGTTGAGGCAGGAGAGTTGCTGG - Intronic
964694165 3:159488196-159488218 TGGTGGGGCAGGAGTGGGGATGG + Intronic
964739447 3:159950237-159950259 GGGTGAGGCAGGACTGTAGCTGG - Intergenic
965240367 3:166189208-166189230 ATGTTAGGCAGGAGTTTTGATGG - Intergenic
966740789 3:183231553-183231575 GGCTGAGGCAGGAGGGTTGCTGG - Intronic
968655885 4:1778305-1778327 CGGGGAGGCAGGAATGTGGCGGG - Intergenic
969059990 4:4426710-4426732 CGGTGAGGGTGGAATGTGGACGG - Intronic
969423706 4:7111726-7111748 CAGTGTGGCAGCAGTGGTGAAGG + Intergenic
974972951 4:68853663-68853685 GGCTGAGGCAGGAGGATTGATGG - Intergenic
975018554 4:69457580-69457602 GGCTGAGGCAGGAGGATTGATGG - Intergenic
977341332 4:95762563-95762585 GGCTGAGGCAGGAGAGTTGCAGG - Intergenic
977612086 4:99046311-99046333 GGCTGAGGCAGGAGAGTTGCTGG + Intronic
977864710 4:102010491-102010513 GGCTGAGGCAGGAGAGTTGCTGG - Intronic
978371444 4:108033394-108033416 TGGTGAGGCAGGATTTTGGAAGG - Intronic
978557540 4:109997106-109997128 CAGTGAGCCAGGAGTGCTGATGG + Intronic
979468986 4:121072588-121072610 CGGTGAGGCGGGAGGGGTTAGGG - Intronic
982454983 4:155598837-155598859 GGCTGAGGCAGGAGAGTTGCTGG - Intergenic
983306032 4:165988372-165988394 GGCTGAGGCAGGAGTATTGCTGG + Intronic
983793348 4:171826731-171826753 TGGTGAGGTAGGAGATTTGAGGG + Intronic
984605948 4:181786479-181786501 AGGTGAGGGATGAGGGTTGAGGG + Intergenic
985478032 5:90874-90896 GGGTGTGGCAGGGGTGTTGGGGG + Intergenic
986249810 5:6045525-6045547 CGATGAGGCATGAGTTCTGATGG + Intergenic
987219812 5:15779196-15779218 AGGTGAGGAAGGAGGGATGAAGG + Intronic
987728603 5:21737164-21737186 GGCTGAGGCAGGAGAATTGATGG - Intergenic
990394996 5:55368348-55368370 GGCTGAGGCAGGAGAGTTGCTGG + Intronic
990867419 5:60395789-60395811 CGGGGAGGGAGGAGTTCTGAAGG - Intronic
993323608 5:86506318-86506340 GGCTGAGGCAGGAGAGTTGCGGG + Intergenic
995755081 5:115494591-115494613 AGGTGAGAAAGGAGTGCTGATGG + Intergenic
995798005 5:115962125-115962147 CGGTGGAGCAGGTGTGTTGCTGG + Intergenic
996261845 5:121481042-121481064 CGCTGAGGCAGGAGGATTGCTGG + Intergenic
996402010 5:123072960-123072982 CGGTGGGGCAGGGCTGTTTAAGG - Intergenic
997843658 5:137265789-137265811 CTGTGATGCAGGTGTGTTCAGGG - Intronic
1002644476 5:180646408-180646430 CGGTGAGGCTGGAGTCTGGGAGG - Intronic
1003337284 6:5185923-5185945 AGGGGAGGCAGGAGTGAGGAGGG + Intronic
1007452885 6:41953599-41953621 CAGAGAGGCTGGAGTGGTGAAGG - Intronic
1007469477 6:42079169-42079191 GGGTGAGGGTGGGGTGTTGAGGG + Exonic
1008192246 6:48474755-48474777 GGGTGAGGGAGGAGTGGTGTTGG - Intergenic
1012518988 6:100097435-100097457 CCATGAGGCAGGAATCTTGAGGG + Intergenic
1013406162 6:109845939-109845961 AGGTGACCCAGGAGAGTTGATGG + Intergenic
1013634458 6:112016057-112016079 CGATGAGGCCGGAGAGGTGATGG + Intergenic
1013761065 6:113518475-113518497 CAGTGAGCCAGGACTGCTGATGG - Intergenic
1014258376 6:119186851-119186873 TGGTGAGCCAGGAGTGCTGTAGG - Intronic
1015654298 6:135499174-135499196 CTGTGATGCAGGAGTGTAAAAGG - Intergenic
1016209429 6:141510387-141510409 AGCTGAAGCAGGAGGGTTGAGGG - Intergenic
1017075584 6:150614660-150614682 GGGAGAGCCAGGAGTGTGGACGG - Intronic
1018046877 6:159973089-159973111 GGGGCAGGAAGGAGTGTTGAAGG + Intronic
1019521615 7:1463209-1463231 GGCTGAGGCAGGAGGATTGATGG + Intergenic
1020554568 7:9654959-9654981 CTGTCAGACAGGAGTGTAGAGGG + Intergenic
1022037875 7:26551004-26551026 GGGTGAAGCAGGAGTGTGAACGG + Intergenic
1022880761 7:34584773-34584795 CAGTGAGCCAGGAGTGTTGACGG - Intergenic
1023682460 7:42701537-42701559 CTGAGAAGCAGGAGAGTTGATGG + Intergenic
1026760935 7:73125194-73125216 CAGTGAGGCAGCAGCGTGGATGG - Intergenic
1026873162 7:73865435-73865457 GGGTGAGGCTGGGGTGTGGAGGG + Intronic
1027037277 7:74933990-74934012 CAGTGAGGCAGCAGCGTGGATGG - Intergenic
1027086285 7:75267462-75267484 CAGTGAGGCAGCAGCGTGGATGG + Intergenic
1028155900 7:87429154-87429176 TGGTGAGGCTGGAGAGATGAGGG - Intronic
1029303731 7:99603589-99603611 GGCTGAGGCAGGAGTATTGCTGG + Intronic
1029392588 7:100285489-100285511 CAGTGAGGCAGCAGCGTGGATGG + Intergenic
1029502587 7:100941977-100941999 GGCTGAGGCAGGAGAATTGATGG + Intergenic
1029713470 7:102312783-102312805 TGGTGAGGCAGGAGGGTCAATGG - Intronic
1030944769 7:115704422-115704444 CCATGAGGCAGGAGTGTGGCTGG - Intergenic
1031083789 7:117282632-117282654 AGATGAGGCTGGAGTGGTGAGGG + Intronic
1032117332 7:129127807-129127829 GGGTGAGGCAGGAGGGTGGGTGG - Intergenic
1032268978 7:130386880-130386902 AGGTGGGGCAGGTGGGTTGAAGG + Intronic
1033573218 7:142654907-142654929 AGGAGAGGCAGAAGTGGTGAAGG + Intergenic
1033611113 7:142963946-142963968 TGGTGTTGCAGGAGTGATGAAGG + Intergenic
1034004616 7:147456758-147456780 AGGTGAAGCAGCAGTGTTAATGG + Intronic
1034010054 7:147519762-147519784 GGATGAGGCAGGAGAGTTGCTGG + Intronic
1034271259 7:149804343-149804365 AGGTGAGGCTGGTGGGTTGAGGG + Intergenic
1035254647 7:157618583-157618605 AGGTGAGGCAGGAGTGAAGATGG + Exonic
1035358473 7:158294649-158294671 CGGGGAGGGAGGAGTGTTCCCGG + Intronic
1035460517 7:159035766-159035788 CTGTGAGGTTGGAGTGTTGGAGG - Intronic
1035656814 8:1314565-1314587 CGGTGACACAGGAGTGATGCTGG - Intergenic
1035686643 8:1528307-1528329 CAGTGAGCCAGGAGTGTTCGTGG - Intronic
1037909131 8:22733401-22733423 AGGTGAGGGAGGAGTGTCGCTGG - Intronic
1039699333 8:39946265-39946287 CAGCGAGCCAGGAGTGCTGACGG - Intronic
1040915258 8:52562482-52562504 CGGTGAATCAGGAGTGTTCCTGG + Intronic
1041712363 8:60906161-60906183 CGTTGAGGGAGGAGGGTTGTAGG - Intergenic
1042151564 8:65791451-65791473 AGGTGAAGCTGGAGTGTTTAGGG - Intronic
1043212475 8:77540358-77540380 CGGTGTGGCAGGAGGGCTGGAGG + Intergenic
1045515210 8:102853399-102853421 CGCTGAGGCAGGAGAATTGATGG + Intronic
1045827666 8:106419286-106419308 TGGTGAGGCAGGTGCGTTGCAGG + Intronic
1049038415 8:140094597-140094619 CGGAGAGGCAGCAGAGTAGAGGG + Intronic
1049294556 8:141824856-141824878 CGGGGAGGCAGGAGGATGGAAGG - Intergenic
1049702046 8:144019826-144019848 GGGTGAGGGAGGGGTGGTGAGGG - Intronic
1050526274 9:6549422-6549444 GGGCCAGGCAGGGGTGTTGAGGG + Intronic
1052227190 9:26104022-26104044 CGGTGAATCAGGAGTGTTAAAGG + Intronic
1052678702 9:31660162-31660184 GGCTGAGGCAGGAGAGTTGCCGG - Intergenic
1054806778 9:69403310-69403332 CCCTGAGGCAGGAGTGTTCTCGG + Intergenic
1054850567 9:69842924-69842946 TGGGGAGGCAGGAGTGTTAATGG + Intronic
1056553045 9:87666772-87666794 CTGTGAGGAAGTATTGTTGATGG + Intronic
1057196078 9:93116070-93116092 GGGTGAGGGAGGGGTGTTGGGGG + Intergenic
1060513564 9:124251406-124251428 CCATGAAGCAGGAGTGTTGATGG - Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1186672226 X:11779670-11779692 CCCTGAGGCAGGAGTGTTCTTGG + Intergenic
1187858929 X:23663818-23663840 GGCTGAGGCAGGAGAATTGATGG - Intergenic
1189079169 X:37951697-37951719 TTGTAAGGCAGGAGTGGTGAGGG + Intronic
1192754475 X:74032660-74032682 TAGTGAGGAAGGAATGTTGAAGG + Intergenic
1195460093 X:105114788-105114810 CAGTTAGGCAGGAGTGGTGAGGG + Intronic
1196433101 X:115648635-115648657 CGGTAATGCAGGACTGTGGATGG - Intronic
1198343202 X:135734635-135734657 GGCTGAGGCAGGAGTATTGCTGG + Intergenic
1198344787 X:135748660-135748682 GGCTGAGGCAGGAGTATTGCTGG - Intergenic
1200057044 X:153467155-153467177 AGGTGAGGCAGGACTGGAGATGG - Intronic
1202371471 Y:24199670-24199692 GGCTGAGGCAGGAGGATTGACGG + Intergenic
1202499314 Y:25470445-25470467 GGCTGAGGCAGGAGGATTGACGG - Intergenic