ID: 1167414537

View in Genome Browser
Species Human (GRCh38)
Location 19:49363144-49363166
Sequence CTTTGGTGCCTGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 1, 2: 4, 3: 38, 4: 408}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167414533_1167414537 -5 Left 1167414533 19:49363126-49363148 CCGGGACGGGGAAGAGAGCTTTG 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1167414537 19:49363144-49363166 CTTTGGTGCCTGAGGGAAGATGG 0: 1
1: 1
2: 4
3: 38
4: 408
1167414532_1167414537 -4 Left 1167414532 19:49363125-49363147 CCCGGGACGGGGAAGAGAGCTTT 0: 1
1: 0
2: 0
3: 16
4: 203
Right 1167414537 19:49363144-49363166 CTTTGGTGCCTGAGGGAAGATGG 0: 1
1: 1
2: 4
3: 38
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167414537 Original CRISPR CTTTGGTGCCTGAGGGAAGA TGG Intronic
900104480 1:976475-976497 TTTGGGTGCCTGGGGGCAGAGGG - Intronic
901254165 1:7806684-7806706 CTTAGGAGGCTGAGGCAAGAGGG + Intronic
902986662 1:20158665-20158687 GTCAGGTGCCTGAGGGAATAGGG - Intergenic
903560082 1:24220621-24220643 CTTTGGTGGCTCTGGGGAGAAGG - Intergenic
903928441 1:26848594-26848616 CTGTGTTGTCTGAGGGAAGGAGG - Exonic
904008781 1:27378274-27378296 CTTCGGTGCCTGGGGACAGAAGG + Intergenic
905316410 1:37084275-37084297 CCCTGGTGCCTGAGGAGAGAAGG + Intergenic
905763437 1:40580330-40580352 CTTGGGAGGCTGAGGCAAGAGGG + Intergenic
906676023 1:47694276-47694298 CTCTGCTACCTCAGGGAAGAGGG - Intergenic
907283036 1:53363179-53363201 CTTGGGTGCCTGAGGGATGAAGG - Intergenic
908197417 1:61758866-61758888 CTTTGGAGGCTGAGGCCAGAGGG - Intronic
908663203 1:66460937-66460959 CTTTTGTTCCTTAGGGTAGAAGG + Intergenic
911615302 1:100004407-100004429 CTTGGGAGGCTGAGGGAAGATGG - Intronic
912129087 1:106579248-106579270 CTTTGGAGACTGAGGGGAAAGGG - Intergenic
915249401 1:154577694-154577716 CTTGGTTTCCTCAGGGAAGAGGG - Exonic
915342690 1:155185063-155185085 ATCTGGTGCCTGAGAGAGGAAGG + Intronic
920099685 1:203509026-203509048 CTGTGGTGCCTGAGCACAGAAGG - Intergenic
920536313 1:206738943-206738965 TTTTAGTGGCAGAGGGAAGAGGG - Intergenic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
922193733 1:223341663-223341685 TTTTGGTGCCTGAGGCATGGGGG - Intronic
922195577 1:223357121-223357143 CTTTTGTGCCTGTTGGAAGAAGG - Intronic
922812828 1:228427206-228427228 CTTGGGAGGCTGAGGTAAGAGGG - Intergenic
922822739 1:228495120-228495142 CCTTGGGGCCTGGGGGGAGATGG + Exonic
924666839 1:246082142-246082164 CTCTGGTCCCTGAGCAAAGAGGG - Intronic
1062884926 10:1009203-1009225 CTCTTTGGCCTGAGGGAAGATGG + Intronic
1063544694 10:6969393-6969415 CTTTGGGGCCTCAGGGGATAGGG + Intergenic
1063990578 10:11557712-11557734 CTCTAGTGCATGAGGAAAGAGGG + Intronic
1064365741 10:14706333-14706355 CTTGGGGGGCTGAGGCAAGAGGG - Intronic
1065487698 10:26250490-26250512 CTTTGTGGGATGAGGGAAGAAGG + Intronic
1066069480 10:31792220-31792242 CACTGGGGCCTGAGGGTAGAGGG - Intergenic
1066596373 10:37054625-37054647 CTTGGGAGACTGAGGCAAGAAGG + Intergenic
1068067876 10:52154802-52154824 CTTTGGGGACTCAGGGGAGAAGG - Intronic
1068584410 10:58780628-58780650 TTTAGGGGCCTGAAGGAAGAAGG + Intronic
1069036594 10:63651899-63651921 CTTTGGCGGCTGAGGCACGAGGG + Intergenic
1069817383 10:71207036-71207058 ATTTGGTGCCTGAGGGAGGGTGG - Intergenic
1070399585 10:76041667-76041689 GTTTGGAGCATGAGGGAGGAGGG - Intronic
1070846810 10:79529608-79529630 CTCTGGGGCCTATGGGAAGATGG - Intergenic
1070926989 10:80230659-80230681 CTCTGGGGCCTATGGGAAGATGG + Intergenic
1072481239 10:95810619-95810641 ATTTTGTACCTGAGTGAAGAAGG - Intronic
1074271618 10:111959234-111959256 CTTTGGAGAATGAAGGAAGAGGG + Intergenic
1074387761 10:113030576-113030598 CTTTTCTGCCTGAAGGTAGATGG + Intronic
1074669633 10:115774912-115774934 CTTTGATGCCTGTGGGATGGGGG - Intronic
1074757456 10:116635101-116635123 CCCTGCTGCCTGGGGGAAGATGG - Intronic
1074874701 10:117604650-117604672 CTTTGGTGCCTCCGGGATGGAGG + Intergenic
1074898653 10:117798054-117798076 CTTTGGTGCCCGAGGGAAGAGGG - Intergenic
1075133414 10:119760329-119760351 CTTGGGAGGCTGAAGGAAGAAGG + Intronic
1076726612 10:132416893-132416915 CTGTGGGCCCTGAGGGAAGGAGG + Intronic
1077572994 11:3355334-3355356 CTTTGGTGTGTTAGGGAAGTGGG + Intronic
1077915824 11:6611003-6611025 CTTGCGGTCCTGAGGGAAGAGGG + Exonic
1080277729 11:30522068-30522090 CTTTGTTGCCTTAAGGAATAAGG - Intronic
1080760961 11:35248337-35248359 CATTTGAGCCTGAGGAAAGAAGG + Intergenic
1080828579 11:35869576-35869598 CTTGAGTGTCTGATGGAAGAGGG - Intergenic
1081071619 11:38616944-38616966 CTTTTGTGTCTCAGGGAATAAGG + Intergenic
1084915569 11:72426498-72426520 CTTAAGTGCCTCAGGGGAGAAGG + Intronic
1085893341 11:80607526-80607548 CTTGGGAGACTGAGGCAAGAAGG - Intergenic
1085926709 11:81032593-81032615 CTTTGGTGGTTGGGGGAAGGAGG + Intergenic
1086109273 11:83180803-83180825 CTTTGGTGACTTTTGGAAGATGG - Intronic
1086939538 11:92781188-92781210 CTCTGGAGCCTGAGGCAGGAGGG - Intronic
1087221283 11:95549201-95549223 CTTTGGTACCTGATGAAAGATGG + Intergenic
1087369311 11:97261629-97261651 CAGAGGTGCCCGAGGGAAGATGG - Intergenic
1087942437 11:104115054-104115076 CTTTGGGGTCTCAGGGAAGAGGG - Intronic
1088818976 11:113441050-113441072 CTTTGATGGCTGTGGCAAGAAGG + Intronic
1088848624 11:113687978-113688000 CTGTGGTTGCTGAGGGATGAGGG - Exonic
1089222836 11:116889457-116889479 CTTTGGAGCCTGAGGTAGGAGGG + Intronic
1089569245 11:119392148-119392170 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1090606859 11:128430717-128430739 TATTGGAGCCTGAGGGAAGTTGG - Intergenic
1090753207 11:129765420-129765442 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1091025035 11:132134483-132134505 TTTTGGGGCCTCAGGGAAAAAGG - Intronic
1091105598 11:132916622-132916644 CTTTGGCGGCTGAAGGAAGGTGG + Intronic
1092045272 12:5427897-5427919 TTTTGGTGCCTGAGAAAAGCAGG - Intergenic
1092618824 12:10240166-10240188 CTTGGGGGGCTGAGGTAAGAAGG - Intergenic
1092998536 12:13973882-13973904 CATTGGTGCCTAAGGGAAGATGG - Intronic
1093290640 12:17317013-17317035 CTTTGGGGCCTTAGGGGAAAGGG - Intergenic
1093543045 12:20310407-20310429 CTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1093800253 12:23363955-23363977 TTTTGGTCCCTGAGCAAAGATGG - Intergenic
1094682642 12:32679570-32679592 CTTTGGGGCCTGTGGGAGGAGGG + Intronic
1095203390 12:39411632-39411654 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
1096109519 12:49020649-49020671 GTTTGGTGACTGAGGGAAAGTGG + Exonic
1096238454 12:49945560-49945582 CTTTGGGGACTGAGGGAGAAGGG - Intergenic
1096546366 12:52342845-52342867 GTTTGGAGCCTGCAGGAAGAAGG - Intergenic
1097371733 12:58790559-58790581 CTTTGGTGTCAGGGTGAAGATGG - Intronic
1097627326 12:62016549-62016571 CCCTGGTGCCTGTGGGAAGAAGG - Intronic
1097889867 12:64767118-64767140 CTTTGGTGTCTTAAGGTAGAAGG - Intergenic
1098046844 12:66409155-66409177 CTTTGGTCCTTGAGTGAACATGG + Intronic
1098524584 12:71471984-71472006 CTTTGGGGACTCAGGGAAAAGGG + Intronic
1098905201 12:76154781-76154803 CTTTGGTGACTGATGGAAAAGGG + Intergenic
1099172383 12:79380500-79380522 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
1099667161 12:85646155-85646177 GGTTGATGCCTGAGGAAAGAGGG - Intergenic
1100635382 12:96430553-96430575 CTTGGGAGGCTGAGGGAGGAGGG + Intergenic
1100706778 12:97209389-97209411 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1101773971 12:107776942-107776964 CTTTGGTTTGTGGGGGAAGAAGG + Intergenic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1104160684 12:126177325-126177347 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1104373521 12:128244542-128244564 CTCTGGAGGCTGAAGGAAGATGG + Intergenic
1105280994 13:18962520-18962542 CTGCGGAGCCTGAGGGCAGACGG + Intergenic
1109945825 13:69430246-69430268 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1110182263 13:72631770-72631792 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1110465166 13:75792074-75792096 CTTGGGAGGCTGAGGGCAGAAGG - Intronic
1111115373 13:83769643-83769665 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
1111893169 13:94108364-94108386 CTTTGGGGACTCAGGGAAAAAGG + Intronic
1112597477 13:100821494-100821516 CTTTGATGCCTGAAGGCAGCTGG + Intergenic
1114417529 14:22554494-22554516 CTTTGCTGCCTGAGGGCACTGGG - Intergenic
1117913843 14:60657255-60657277 CGTCGGGGCTTGAGGGAAGAGGG + Intronic
1118452582 14:65917600-65917622 CTGTGGTTCCTGAGAAAAGAGGG - Intergenic
1120441543 14:84547064-84547086 CTTAGTTGCCTGAGAGAGGAAGG - Intergenic
1120776266 14:88440984-88441006 CTTTGGGGGCTGAGGGGAAAGGG - Intronic
1121510697 14:94510923-94510945 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1122919289 14:104873451-104873473 CTTTGGGGCCTGCGGGAAAGGGG + Intronic
1124161860 15:27277906-27277928 ATGTGGTCCCTGAGGGAAGTGGG - Intronic
1124448515 15:29762840-29762862 CTCTGGAGCCTGAGGCAGGAGGG - Intronic
1126285993 15:47011279-47011301 CTTTGGAGACTTGGGGAAGAGGG + Intergenic
1127184843 15:56467247-56467269 CTTGGGAGACTGAGGCAAGAAGG + Intergenic
1127226464 15:56935633-56935655 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1127968816 15:63943494-63943516 CTTTGGGGCCTGAGAGATAAAGG - Intronic
1128255645 15:66194649-66194671 CTTTGGGGACTCAGGGAAGAAGG + Intronic
1128313317 15:66645057-66645079 CATTGCTGCCTAAGGGGAGAGGG + Intronic
1129307723 15:74679817-74679839 CTTGGGAGCCTGAGGCAGGAAGG + Intronic
1129390922 15:75220594-75220616 CTGAGGTGCCTGAAGGAGGAAGG + Intergenic
1130969529 15:88721182-88721204 CTCTGGTTCCTGAGAGCAGAGGG + Intergenic
1131243156 15:90765999-90766021 CTTAGGAAGCTGAGGGAAGAGGG + Intronic
1131403268 15:92143583-92143605 CTTTAGTGTCAGGGGGAAGATGG + Intronic
1131765269 15:95668877-95668899 CTTTGGAGTATGAGGAAAGAGGG + Intergenic
1132240718 15:100255322-100255344 CTTTGGGCCCTGAGAGAAGATGG - Intronic
1132991074 16:2794487-2794509 TTTTGGTCCCTGAGCAAAGAGGG - Intergenic
1133090255 16:3398679-3398701 CCTAGGTGTGTGAGGGAAGAAGG - Intronic
1133211252 16:4264454-4264476 CTTTGGGTCCTGATGGAGGAGGG - Intronic
1134255742 16:12609980-12610002 CTTGGGAGGCTGAGGGAGGATGG - Intergenic
1134297940 16:12963119-12963141 CAGAGGTGCCTGAGGGAAGCAGG + Intronic
1134459920 16:14421976-14421998 CTTGGGAGGCTGAGTGAAGAGGG - Intergenic
1135815805 16:25632349-25632371 CTTTTGAGGCTGAGGAAAGAAGG + Intergenic
1137248961 16:46729358-46729380 CTGTGGGGCCTGGGGCAAGAAGG - Intronic
1137699666 16:50488376-50488398 CTTTGGTGGCTAAGGCAGGAGGG + Intergenic
1137712226 16:50574415-50574437 ATTTAGTCCCTGGGGGAAGACGG - Intronic
1137731183 16:50691750-50691772 CTCTGGTGCCAGAGGAAAGGGGG + Intergenic
1138631996 16:58303890-58303912 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1140532200 16:75676430-75676452 CTTGGGAGCCTGAGGCAGGAGGG - Intronic
1140808052 16:78551923-78551945 CTTTGCTGCCACAGGTAAGAGGG - Intronic
1141719828 16:85750190-85750212 CTTTGGAGCCCGGAGGAAGAGGG - Intronic
1142282633 16:89156572-89156594 CCCTGGTGCCTGAGAGAAGCTGG - Intergenic
1142345172 16:89549414-89549436 CTTTGGGGGCTGAGGCAGGAGGG + Intronic
1142764919 17:2059392-2059414 CCTTGGTGACTGAGGAAGGAAGG - Exonic
1142798304 17:2326742-2326764 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
1144161237 17:12560925-12560947 CTTTGGGGCCTCAGGGGAAATGG - Intergenic
1144215357 17:13050365-13050387 CTTTGGTGCCTGAAGAGGGATGG - Intergenic
1145073302 17:19830306-19830328 CTTGGGAGTCTGAGGTAAGAGGG - Intronic
1145107143 17:20127754-20127776 CTTTAGTGCCTGTTGGAAGGTGG + Intronic
1146608415 17:34283299-34283321 ATTTGGTGCCTGATGAATGAGGG - Intergenic
1147362931 17:39942964-39942986 CCTTGGGGAGTGAGGGAAGATGG + Intronic
1147460489 17:40565157-40565179 CTTTGGTGCCAGTGGGGACAAGG - Intronic
1147557350 17:41487814-41487836 AGCTGGTGACTGAGGGAAGAGGG - Intronic
1147658811 17:42106048-42106070 CTTGGGAGGCTGAGGGCAGAAGG + Intronic
1147960943 17:44167284-44167306 CTTGTGTGCCTCAGGGAGGAAGG + Intergenic
1148466206 17:47866682-47866704 CATGCGTGCCTGGGGGAAGATGG - Intergenic
1148525362 17:48327731-48327753 CTTGGGAGGCTGAGGGAGGACGG - Intronic
1149538633 17:57452104-57452126 CACTGGAGCCTGAGGGATGAGGG - Intronic
1149627383 17:58089457-58089479 TTTAGTTGCCTGGGGGAAGAAGG + Exonic
1151509609 17:74550200-74550222 CTCTGGGGTCTGGGGGAAGAGGG - Intergenic
1152077960 17:78170177-78170199 CTTAGGTACCTGATGGATGAAGG - Intronic
1152931293 17:83111520-83111542 TTCTGCTGCCTGAGAGAAGAGGG + Intergenic
1154190388 18:12226209-12226231 CTTTGGGGTCTGAGGGCAGTGGG - Intergenic
1154471769 18:14710090-14710112 CTTAGGAGGCTGAGGCAAGAGGG + Intergenic
1155008884 18:21755289-21755311 CTTTTGTTTCTGAGGGAAAATGG + Intronic
1158638157 18:59179363-59179385 CTTGGGAGGCTGAGGTAAGAGGG + Intergenic
1160030272 18:75250833-75250855 CTTCGGTGCCTGTGGGAGGGCGG + Intronic
1160850547 19:1189568-1189590 CACTGGTGCCTGGAGGAAGAGGG - Intronic
1161067378 19:2245393-2245415 CTTTGGTGCCTGTGTGTGGAGGG + Intronic
1161805590 19:6441429-6441451 ATCTGGTGCCTGAGGGAGGCAGG + Exonic
1162397766 19:10427327-10427349 CATGGGTGTCTGATGGAAGAGGG + Intronic
1163153614 19:15428558-15428580 CTTGGGGGCCTGAGGTAGGAGGG + Intronic
1164006748 19:21156880-21156902 CTTTGGGGGCTGAAGTAAGAGGG - Intronic
1164757417 19:30700493-30700515 CTTGGGAGCCTGAGGCAGGAGGG - Intronic
1165244024 19:34487647-34487669 CTTTGTTGACTGAGGAAAGGCGG + Intronic
1165462848 19:35954222-35954244 CTTCTGTGCCTGAGGAAGGAGGG - Intergenic
1165834086 19:38743883-38743905 CTCTGGGGTCTGAGGGAGGAGGG - Intronic
1165912205 19:39236586-39236608 CTTTGGGTCCTGGGGGAGGATGG - Intergenic
1166348367 19:42180834-42180856 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
1166915241 19:46190972-46190994 CTGAGGGGCCTGAGGGGAGATGG - Intergenic
1167248774 19:48390152-48390174 CTTTTGGGTCTGAGGGAGGAAGG - Intronic
1167248814 19:48390263-48390285 CTCTTGGGTCTGAGGGAAGAAGG - Intronic
1167314374 19:48755261-48755283 CTTCTGTGTCTGAGGGAGGAGGG - Intronic
1167414537 19:49363144-49363166 CTTTGGTGCCTGAGGGAAGATGG + Intronic
1167456519 19:49599197-49599219 TTTTGGGGGCTGAGGGAGGATGG + Intronic
1167560903 19:50226096-50226118 CTTTTGAGTCTGAGGGAGGAGGG + Intronic
1167560931 19:50226170-50226192 CTTTTGAGTCTGAGGGAGGAGGG + Intronic
1167561015 19:50226393-50226415 CTTTTGAGTCTGAGGGAGGAGGG + Intronic
1167561044 19:50226467-50226489 CTTTTGAGTCTGAGGGAGGAGGG + Intronic
1167743321 19:51337562-51337584 CTTGGGTGCCAGAGGGGAGAGGG + Intronic
1168291707 19:55360495-55360517 CTTCTGTGTCTGAGGGAGGAGGG - Intronic
925943362 2:8839751-8839773 CTTGGGTGGCTGGAGGAAGACGG - Intergenic
925975818 2:9141333-9141355 GTTAGGAGTCTGAGGGAAGAGGG - Intergenic
926678745 2:15648463-15648485 CTTGGGAGCCTGAGGCAGGAGGG + Intergenic
927244470 2:20945916-20945938 CTGAGGGGCCTGGGGGAAGAGGG - Intergenic
929830681 2:45344135-45344157 CTCTGGTGCCTGGGGGAGAAAGG - Intergenic
930313764 2:49772591-49772613 CTTCCGAGCCTGAGGGAGGAAGG + Intergenic
930804152 2:55473179-55473201 CTTGGGAGCCTGGGGCAAGAAGG + Intergenic
931733120 2:65170617-65170639 CTTTGTTTCCTCAGGGAGGAAGG + Intergenic
931818935 2:65932359-65932381 CTTTGGTGCCTGTGGCAGGATGG + Intergenic
931835197 2:66091791-66091813 CTTTGGGGCCTTGGGGAAAAGGG + Intergenic
931893311 2:66700100-66700122 CTGTGGTGACTGAGAAAAGAGGG + Intergenic
932198436 2:69804519-69804541 CATCGGTGCCTGGGGGAAGAAGG - Exonic
934050244 2:88204370-88204392 CTTTGGGGCCTCAGGGGAAAGGG - Intergenic
935384393 2:102485779-102485801 CTTGGGGGCTTGAGGAAAGAGGG - Intronic
936515178 2:113176828-113176850 CTTTGATCCCTGAGGTAGGATGG - Intronic
938103055 2:128511483-128511505 CTCTGGGGCCTGTGGGAAGTGGG + Intergenic
938961606 2:136348809-136348831 ATTTGGAGCCTGAGGGAGGCAGG + Intergenic
939789612 2:146555537-146555559 CTGTGGTGCCTATGGGAAGTGGG - Intergenic
939994324 2:148906125-148906147 CCTTGGGGCCAGAGGGAAAAAGG + Intronic
940281115 2:151990493-151990515 CATTGTTGCCTGAGTGAGGAGGG - Intronic
941726180 2:168863185-168863207 CGTTGGAGCCTTAGGGAAGCTGG + Intronic
942014179 2:171794272-171794294 CTTTGGTGCCTTAAGTCAGAAGG + Intronic
943333523 2:186588074-186588096 CTTTGGTGTATTAGGAAAGAAGG + Intergenic
943744923 2:191452265-191452287 CTGTGAGGCCTGAGGAAAGAAGG + Intergenic
945474320 2:210263587-210263609 CTTGGGGGGCTGAGGCAAGATGG + Intergenic
945723260 2:213445552-213445574 CTTTGGAGGCTGAGGCAGGAGGG + Intronic
947601233 2:231451731-231451753 CTTTGGCACCTGGGGGAAGGGGG + Intergenic
947612163 2:231531023-231531045 CGTTGGTGGCTGTGGGAGGATGG - Intergenic
947639163 2:231696642-231696664 CTGTGGTGCGTGAGGGGACAGGG + Intergenic
948083909 2:235230240-235230262 CTTTTGTGCCACAGGGAAAAGGG - Intergenic
948916942 2:241039245-241039267 CTTTGGTGGCTGATGGGACATGG - Intronic
1169181659 20:3574408-3574430 CTAGGGTGGCTGAGGCAAGAGGG + Intronic
1169182416 20:3581142-3581164 CTTGGGAGGCTGAGGCAAGAGGG + Intronic
1169557472 20:6766678-6766700 CTTGGGGGCCTGGTGGAAGAGGG + Intergenic
1170470254 20:16661528-16661550 CTTTCGGGACTGAAGGAAGAAGG - Intergenic
1171014914 20:21531316-21531338 CTATTTTCCCTGAGGGAAGATGG + Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1171348342 20:24483780-24483802 CTTTGGTCCCTCATGGAAGAAGG + Intronic
1172189032 20:33050427-33050449 CTTTGGTGCATGAGGGGATATGG + Intergenic
1172274086 20:33670413-33670435 CTCTGGTCCCTGTGGGAAGCGGG + Intronic
1172398876 20:34631945-34631967 CTTGGGTGGCTGAGGCAGGAGGG - Intronic
1172435210 20:34924057-34924079 CTTTGATGTATGAGGAAAGATGG + Intronic
1172444312 20:34985086-34985108 CTTTGGTCCCTCTGGGAAGCTGG + Exonic
1172547474 20:35772679-35772701 CTTTGGGGGCTGACGGAAGAGGG - Intronic
1172870205 20:38131050-38131072 CTTTGGGGCCTGGGGGAAGCGGG - Intronic
1172960335 20:38794616-38794638 CTTGGGAGGCTGAGGCAAGAAGG + Intergenic
1173657373 20:44709651-44709673 GTTTGGTGACTGAGGGAGGAGGG + Intergenic
1173688296 20:44939336-44939358 CTTTTGTGTCTGAGGGAGGTGGG + Intronic
1173960955 20:47072171-47072193 CTGTTGTGCCTGTGGGAAGGAGG - Exonic
1174848348 20:53966462-53966484 CTTTGGGGACTCAGGGGAGAAGG + Intronic
1174983258 20:55421215-55421237 CGTTGCAGCCTGAGGGAACAAGG + Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1176042530 20:63072937-63072959 TTTTAGTGACTGAAGGAAGAGGG - Intergenic
1176233781 20:64044935-64044957 CCTTGGAGCCTCAGGGAAGAAGG + Intronic
1176262231 20:64187931-64187953 CTTTGCTGCCTCAGGGAGGCAGG + Intronic
1176271386 20:64236712-64236734 CTTTTGTGCTGGTGGGAAGAAGG + Intronic
1177235270 21:18381811-18381833 CTTTGGGGCCTGTTGGAGGATGG + Intronic
1177763202 21:25426080-25426102 CTTTGGGGACTTAGGGGAGAAGG - Intergenic
1177778255 21:25594357-25594379 CTTGGGTGGCTGAGGCAGGAGGG - Intronic
1177822350 21:26045170-26045192 ATTTTATTCCTGAGGGAAGATGG + Intronic
1177876457 21:26637914-26637936 CTTTGGAGCCTCAGGGGAAAGGG - Intergenic
1178341424 21:31788570-31788592 CTTTGGAGGCTGAGACAAGAGGG + Intergenic
1178496484 21:33090539-33090561 ATGCAGTGCCTGAGGGAAGAAGG - Intergenic
1178824973 21:36007155-36007177 CTCTGGAGGCTGAGGCAAGAGGG + Intergenic
1178875965 21:36414117-36414139 CTGTGCTGCCTGACGGCAGAAGG - Intronic
1179401791 21:41091070-41091092 CTGTGGTTCATGAGGGAAGCGGG - Intergenic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1179668466 21:42928752-42928774 TTTTGGTCCCTGAGCGAGGAGGG - Intergenic
1181712693 22:24700541-24700563 ATTTGGTGACAGAGGGAAGGAGG - Intergenic
1181903550 22:26174692-26174714 CTTTGGTGGCTGTGACAAGAGGG + Intronic
1181910737 22:26236205-26236227 CTTTGGAGTTTGAGGGCAGATGG + Intronic
1182446588 22:30393242-30393264 CTGTGGTGCCAGGGGGAAGGGGG - Intronic
1182895451 22:33855660-33855682 CTGTGGTTCCTGGGGGCAGAGGG - Intronic
1184044707 22:41965647-41965669 CCTGGGTCCCAGAGGGAAGAGGG + Intergenic
1184207345 22:43013929-43013951 CTTGGGTGCCTGAGGGAAGGTGG - Intronic
1184241169 22:43211996-43212018 AGTTGGTGAGTGAGGGAAGACGG + Intronic
1184976818 22:48068077-48068099 CCCTGGTGCCTGAGTGATGAGGG + Intergenic
1185151048 22:49164162-49164184 CTTTCCTGCCCGAGGGGAGATGG - Intergenic
949358816 3:3209924-3209946 CTCTGGCCCCTGAGGCAAGAAGG + Intergenic
949363959 3:3260686-3260708 TTTTGAAGCCTGATGGAAGATGG - Intergenic
949571016 3:5293286-5293308 GATTGGAGCCTGAGGGAGGATGG + Intergenic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
950348107 3:12318079-12318101 CTCCGGTGGCTGAGGCAAGAGGG - Intronic
950814698 3:15688363-15688385 CTTGGGAGGCTGAGGCAAGAGGG - Intronic
950934842 3:16828438-16828460 CTTGGGTGGGTGAGAGAAGAAGG + Intronic
951823967 3:26846516-26846538 CTTTGGTGGCAGAGTAAAGAGGG - Intergenic
951954902 3:28242970-28242992 ATTTGGTTCTTGAGGGTAGAAGG + Intronic
952083357 3:29787670-29787692 CTTTGGGGACTCAGGGAAAAAGG + Intronic
952356367 3:32588271-32588293 CTTTGGAGTCTGAAGGATGAGGG + Intergenic
952539487 3:34352547-34352569 CTTTGGTGGCTGAGGTCATAGGG + Intergenic
953468472 3:43146314-43146336 TTTTGTTCCCTGAGAGAAGAAGG + Intergenic
954174665 3:48834616-48834638 CTTGGGAGGCTGAGGCAAGAGGG + Intronic
954527243 3:51283093-51283115 ATTTGGTGTCTGTGGGTAGAGGG - Intronic
954693552 3:52408768-52408790 CTTTGGTGTGTGAGGGCACAAGG - Intronic
955772827 3:62403557-62403579 CTTTGGTGCCAGAGAGATGAGGG + Intronic
957190821 3:77007140-77007162 CTTTGATGCCAGTTGGAAGAAGG - Intronic
957892917 3:86382838-86382860 TTTTGGTACCTGAGCAAAGAAGG + Intergenic
960925346 3:122790444-122790466 CTTTGGAGGCTGAGAGGAGAAGG - Intronic
961200643 3:125042824-125042846 CTTGGGGGCCTGTGGGAAGGTGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961655183 3:128437914-128437936 CTTTGGTGACTCAGGGGAAAGGG + Intergenic
961785703 3:129345300-129345322 CTTTGGTTCCACAAGGAAGATGG - Intergenic
962324679 3:134423262-134423284 TTGTGTTGCCTGATGGAAGAGGG + Intergenic
962382318 3:134908177-134908199 GTTTGGGGTCTGAGAGAAGAGGG - Intronic
963848046 3:150179955-150179977 TTTTGGTTGCTGAGAGAAGAAGG + Intergenic
963924769 3:150939571-150939593 CTTGGGGGTCTGGGGGAAGATGG - Intronic
966087066 3:176080601-176080623 CTTTTCTGCCAGAGGAAAGAAGG - Intergenic
966214321 3:177486382-177486404 TTTTTGTGTCTGAGGGAATAGGG + Intergenic
966220943 3:177550472-177550494 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
966774660 3:183533379-183533401 CTGGGGAGCCTGAGGGAAGAGGG - Intronic
967054469 3:185817427-185817449 CTTGGCTGCCAAAGGGAAGAAGG - Intronic
967180583 3:186899713-186899735 CTCTGGAGGCTGAGGCAAGAGGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968077645 3:195825226-195825248 CTCTGGGGCCAGAGGGAAGCTGG - Intergenic
968898620 4:3419974-3419996 CTCTGGGGCCTGAGGAGAGAGGG - Intronic
969258526 4:6019423-6019445 CTTGAGTGCCTGAGAGAAGATGG - Intergenic
969979736 4:11142291-11142313 CTTTGGAGGCTGAGGCAGGAGGG + Intergenic
970345381 4:15147801-15147823 CTTTTGTGCCAGATGGAAGAAGG - Intergenic
973645923 4:52951187-52951209 CTTTGGTGAGTCAGGGAGGAAGG - Intronic
974366164 4:60952321-60952343 TTTTGGTGGCTAGGGGAAGAGGG - Intergenic
974441116 4:61918921-61918943 CTTTGGTGCATAAGACAAGAAGG + Intronic
975725343 4:77286075-77286097 CTTTGGAGCCTGTGCTAAGATGG - Intronic
976646650 4:87394355-87394377 CTTTTTTGCGTTAGGGAAGAAGG - Intergenic
977637788 4:99320205-99320227 CTTTGGGGACTGAGGGAAAAGGG - Intronic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
979077119 4:116285869-116285891 CTTTGGTCCTTGAGGCAATATGG - Intergenic
979569859 4:122208797-122208819 TTTGGGAGCCTGAGGCAAGATGG + Intronic
980569731 4:134598675-134598697 CTTTGGGGACTCAGGGAAAAGGG + Intergenic
980586383 4:134821948-134821970 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
980670807 4:136004459-136004481 CTTTGATGCTTGAGGAATGAGGG + Intergenic
981478818 4:145214683-145214705 CTTGGGAGGCTGAGGCAAGAGGG - Intergenic
982086594 4:151842165-151842187 CTTGGGTACCTGAGGGAGGAGGG + Intergenic
982095723 4:151921315-151921337 CTAAGGTGCCTCAGGGGAGATGG + Intergenic
982150432 4:152449349-152449371 CTTTGAGGACTGATGGAAGAGGG + Intronic
982781380 4:159494582-159494604 CTTTGGAGGCTGAGGCAGGAGGG + Intergenic
983269431 4:165543949-165543971 CTTGGGAGGCTGAGGAAAGAGGG + Intergenic
983358473 4:166696887-166696909 ATTTGGGGCCTGAGGGAAAAGGG - Intergenic
983809872 4:172048462-172048484 CTGTGGTGACTGAGGGAAAATGG - Intronic
983923484 4:173371378-173371400 CTGTGCTGCCTGCGGGAGGATGG + Exonic
986259485 5:6131782-6131804 CTTTGGGGACTGAGGGGAAAGGG + Intergenic
986548662 5:8927644-8927666 CTTGGGTGCTGGAGGAAAGAAGG + Intergenic
988506692 5:31829938-31829960 CTCTGGAGGCTGAGGCAAGAGGG + Intronic
988821746 5:34893298-34893320 CTAGGGCGCCTGAGGGAAGATGG + Intronic
990112844 5:52349273-52349295 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
990466314 5:56074866-56074888 CTTAGGAGGCTGAGGGAGGAGGG + Intergenic
991142399 5:63259950-63259972 CTTTTGTTCCACAGGGAAGAAGG + Intergenic
991192245 5:63888216-63888238 CTTTGGTGCCTCTGGTTAGATGG + Intergenic
991460458 5:66852857-66852879 CTTTGGTGCGTGAAGAAAGAGGG + Intronic
992127589 5:73657707-73657729 CTTTGATGAGTGAGGAAAGAAGG - Intronic
993956123 5:94235011-94235033 TTTTTTTGCCTGAGGAAAGAGGG - Intronic
994617537 5:102124435-102124457 CTTTGGTGACTGATGGGGGAAGG + Intergenic
995469694 5:112488026-112488048 CTTTGGAGCCAGAGGGATGTTGG - Intergenic
996339358 5:122419017-122419039 ACTTGGTGCCTGAGCGATGAAGG + Intronic
996492301 5:124111943-124111965 CTTTGTTCCCAGAAGGAAGAAGG - Intergenic
996597309 5:125220184-125220206 CTTTTGTGCTTGATGAAAGAAGG - Intergenic
997243866 5:132329563-132329585 CTTTGGTGCCTGGGAGAACTAGG - Intronic
997335692 5:133107517-133107539 TTTTGGTACCTGCAGGAAGAGGG + Intergenic
997750415 5:136339290-136339312 TTTTGGTCCCTGAGCAAAGAGGG - Intronic
998241646 5:140451614-140451636 CTTGGGAGGCTGAGGGCAGAGGG - Intronic
999353418 5:150900381-150900403 CTTTGGCTCATGAGGGAAGTAGG - Intronic
999791154 5:154940589-154940611 CTTGGGAGGCTGAGGTAAGAGGG + Intergenic
1001008392 5:168075093-168075115 CTTTGGGGCCTCAGGGGAAAGGG - Intronic
1001190514 5:169626360-169626382 CTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1003252249 6:4440304-4440326 CTTTGGGGACTCAGGGAAAAAGG - Intergenic
1004370657 6:15049446-15049468 CCTTGCTCCCTGAGGTAAGAAGG - Intergenic
1004474977 6:15962924-15962946 CTCTGGTGACTTAGGGTAGAAGG - Intergenic
1006188319 6:32192575-32192597 CTTGGGTTCCTGAGGGGAGTGGG + Exonic
1006310818 6:33257905-33257927 CTTGGGAGGCTGAGGGAGGAGGG + Intronic
1007609021 6:43136894-43136916 CTTTGGAGGCTGAGGTGAGAGGG + Intronic
1007761268 6:44135003-44135025 CAGCAGTGCCTGAGGGAAGAGGG - Exonic
1009624857 6:66126469-66126491 CTCTGGTGCCTCAGGCAAGAGGG + Intergenic
1009626197 6:66141129-66141151 TTTGGGTTCCTGCGGGAAGAAGG + Intergenic
1009979934 6:70715891-70715913 CTTTGGGGACTGGGGGAAAAGGG - Intronic
1010390030 6:75326332-75326354 CTTTGGGGACTCAGGGAAGTGGG + Intronic
1011963671 6:93124439-93124461 CTTTTGTGCCACAGGGAAGGAGG - Intergenic
1012433734 6:99192933-99192955 CTTTGGTGAAAGAAGGAAGAAGG - Intergenic
1012665394 6:101962035-101962057 CTTGGGTTCATGAGGGCAGAGGG + Intronic
1013595693 6:111658613-111658635 CTTTGTTGCCTTAGGAAAGCTGG - Intergenic
1014419920 6:121230945-121230967 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1015380021 6:132556437-132556459 CTTTGGGGACTCAGGGGAGAAGG - Intergenic
1016027611 6:139303413-139303435 ATTAGGTTCCTGAGGGAATAAGG + Intergenic
1016801557 6:148174189-148174211 CTTTGGTAACTGATGGAAGCAGG - Intergenic
1016809887 6:148250131-148250153 CTCTGATGCCAGAGGGATGAGGG - Intergenic
1018055808 6:160051282-160051304 CTTTGGAGCCTGAATGAGGAAGG + Intronic
1019436992 7:1027695-1027717 CTTTCTTGCCTGAGGCAAGGCGG - Intronic
1019557442 7:1639799-1639821 CTTTGGTGTCGTAGGGAAGGGGG + Intergenic
1019882429 7:3874696-3874718 CTTTCATTCCTTAGGGAAGATGG + Intronic
1020635383 7:10690611-10690633 CTTTGGGGACTCAGGGAAAAAGG + Intergenic
1022025076 7:26440977-26440999 CTTTTGTGACTGATGGGAGAAGG + Intergenic
1022091147 7:27108795-27108817 CTTTGGGGCCTGGTGGAAGGAGG - Intronic
1024264663 7:47597523-47597545 CCTAGGTGCCTGAGCGAGGAGGG - Intergenic
1025117428 7:56270169-56270191 CTTTCCTGCCAGTGGGAAGATGG + Intergenic
1026326860 7:69318044-69318066 CTTGGGAGGCTGAGGCAAGAGGG - Intergenic
1026845810 7:73698672-73698694 TTTTGGTCCATGTGGGAAGAGGG + Intronic
1026966696 7:74444693-74444715 CTTGGGGGGCTGAGGGAGGATGG - Intergenic
1029163116 7:98567116-98567138 CTTTCTTGCCTGGGGGCAGATGG - Intergenic
1029416057 7:100443880-100443902 CTTTGTTGGCTGAGGCAGGAGGG + Intergenic
1029975177 7:104826808-104826830 CTTTGGTGACTCTGGAAAGAGGG + Intronic
1030074709 7:105726381-105726403 CTGTGCTGCCTGAGGGATGGGGG - Intronic
1030767971 7:113435813-113435835 CTTTGGTGACTCAGGGGAAAGGG - Intergenic
1031089990 7:117342886-117342908 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1031323479 7:120363186-120363208 CTCGGGTGGCTGAGGAAAGAGGG + Intronic
1031342618 7:120622624-120622646 CTTTAAAGCCTGAGAGAAGATGG - Intronic
1032549133 7:132768025-132768047 CTTTGGAGACCGAGGGGAGAGGG - Intergenic
1034809885 7:154122866-154122888 GTCTGATGCCAGAGGGAAGAGGG - Intronic
1035284987 7:157800088-157800110 CTGTGGTGCCTCAGGGATGGAGG - Intronic
1035331693 7:158100038-158100060 CTTTGGAGACTCAGGGAAAAGGG - Intronic
1037263379 8:17033055-17033077 TTTTTGTGACTGAGGGAACAGGG - Intronic
1039366664 8:36935192-36935214 CTTTTGTTCCAGTGGGAAGAGGG - Intronic
1040543122 8:48377069-48377091 CTGTGGGGCCTGAGGGAAGCTGG + Intergenic
1041308564 8:56489749-56489771 CTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1041431448 8:57785283-57785305 TATTGGGGCCTGTGGGAAGATGG - Intergenic
1041857960 8:62479592-62479614 TTTTGGTTTCTGAGGGCAGAGGG + Intronic
1042819031 8:72909865-72909887 ATTTAGTGCCAGAGGAAAGATGG + Intronic
1043691621 8:83160474-83160496 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1044857242 8:96489138-96489160 CTCGGGTGGCTGAGGTAAGAGGG - Intergenic
1046190614 8:110790077-110790099 CTTTGGTCCCTGAGCAAGGAGGG + Intergenic
1046770657 8:118113193-118113215 TTTTGCAGCCTGAGGGAAGCCGG - Intergenic
1047512811 8:125528703-125528725 CATGGGTTCCTGAGGCAAGATGG - Intergenic
1048632197 8:136256427-136256449 CATTGGTGACTGAGGGAGGAAGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049253681 8:141602854-141602876 GTTTGGGGCCTTAGGGAACATGG + Intergenic
1050441550 9:5669290-5669312 CTTTGGGGACTCAGGGAAAAGGG - Intronic
1050461988 9:5885025-5885047 CTCGGGTGTCTGAGGGAGGAGGG + Intronic
1050900167 9:10938309-10938331 CTTGGGGGCCTGAGGCAGGAAGG - Intergenic
1052219535 9:26002637-26002659 CTTTGGGGACTTAGGGAAAAGGG + Intergenic
1052732141 9:32300456-32300478 CTTTGTTGCCTAAAGTAAGAGGG + Intergenic
1052975202 9:34405183-34405205 CTTTGGTCCCTGAAGGGAGAGGG + Intronic
1055214733 9:73845376-73845398 CTCAGGAGGCTGAGGGAAGAAGG + Intergenic
1056178959 9:84062904-84062926 CTTTGGTGACTCAGGGGAAAGGG + Intergenic
1056188166 9:84157509-84157531 CTTTGCTGCCATAAGGAAGAGGG - Intergenic
1057964287 9:99488201-99488223 CTTTGGTGCCGGTGGGAAGCAGG + Intergenic
1057972852 9:99574016-99574038 CTTTGGTGCCTCAGGCCAGAAGG - Intergenic
1058484724 9:105432540-105432562 CTTTGGTCCCTAAAGGCAGAAGG - Intronic
1060692437 9:125675707-125675729 CTTTGTTGCCAGAAGGAATATGG - Intronic
1060750509 9:126165470-126165492 CCTTGGTGACAGAGGGAAGCGGG + Intergenic
1061402862 9:130377962-130377984 CTTTGGTCCCTCAAGGCAGAGGG - Intronic
1062150576 9:135016627-135016649 TTTTATTGCCTGTGGGAAGAGGG - Intergenic
1062478998 9:136742909-136742931 CCTTGGCGGCTGAGGGAGGAGGG - Exonic
1186507449 X:10104265-10104287 CTTTGGTGTCTGAGGGCAGAAGG + Intronic
1186725631 X:12355582-12355604 ATTAGGTGCCTGAGGAAAGTGGG + Intronic
1187975325 X:24699356-24699378 CCTTTGTGTTTGAGGGAAGATGG + Intronic
1188334764 X:28917147-28917169 CTTCATTGCCTGAGGGAAGATGG + Intronic
1188844259 X:35053915-35053937 CCTTTGTTCCTGATGGAAGAGGG + Intergenic
1188921103 X:35978892-35978914 CTATCATGCCTCAGGGAAGAAGG - Intronic
1191629187 X:63302735-63302757 CTTTGGGGACTCAGGGAAAAGGG - Intergenic
1191670626 X:63745267-63745289 CTCTGGGCCCTGAGGGTAGATGG + Intronic
1191982126 X:66937501-66937523 CTTTGATGAGTGAGAGAAGAAGG - Intergenic
1192418832 X:71010386-71010408 CTTTGGTGACTAAGTGAATATGG - Intergenic
1193088012 X:77464888-77464910 CTTTGGGGACTGAGGGGAAAGGG + Intergenic
1193833372 X:86314112-86314134 CTGTTGTGCCTCAGGGAATAGGG - Intronic
1194072044 X:89337950-89337972 CTCTGATGTCTAAGGGAAGAAGG + Intergenic
1194104128 X:89747347-89747369 CTTTGGGGACTGAGGGGAAAGGG - Intergenic
1195612236 X:106880966-106880988 CTCTGGTCCCTGTTGGAAGAGGG + Intronic
1196058010 X:111377054-111377076 CTTTAGTGCCTCAGGCAGGAAGG - Intronic
1197839899 X:130735091-130735113 CTCTGGAGCATTAGGGAAGATGG - Intronic
1199411167 X:147525195-147525217 CTTTGGTGGAGGTGGGAAGAGGG - Intergenic
1199527688 X:148810848-148810870 CTTTGGTAACTGAGGAAAGGGGG - Intronic
1200068349 X:153515646-153515668 CTGTGGTGCCTGAGGGCATGGGG + Intergenic
1200123698 X:153803358-153803380 CGGTGGTGACTGAGAGAAGAGGG + Exonic
1200211585 X:154349028-154349050 TGTTGTTGCCTGAGGCAAGAGGG + Exonic