ID: 1167418142

View in Genome Browser
Species Human (GRCh38)
Location 19:49387981-49388003
Sequence TTGGTGAAATGGGCTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167418142_1167418150 19 Left 1167418142 19:49387981-49388003 CCTTCCTCAGCCCATTTCACCAA No data
Right 1167418150 19:49388023-49388045 AAACACGAGCCCCAGCATGGCGG 0: 1
1: 0
2: 1
3: 21
4: 217
1167418142_1167418151 20 Left 1167418142 19:49387981-49388003 CCTTCCTCAGCCCATTTCACCAA No data
Right 1167418151 19:49388024-49388046 AACACGAGCCCCAGCATGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 139
1167418142_1167418149 16 Left 1167418142 19:49387981-49388003 CCTTCCTCAGCCCATTTCACCAA No data
Right 1167418149 19:49388020-49388042 GAAAAACACGAGCCCCAGCATGG 0: 1
1: 0
2: 2
3: 7
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167418142 Original CRISPR TTGGTGAAATGGGCTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr