ID: 1167421088

View in Genome Browser
Species Human (GRCh38)
Location 19:49403774-49403796
Sequence AAGGCACTCAACCTGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167421088_1167421099 28 Left 1167421088 19:49403774-49403796 CCTGCTGCCAGGTTGAGTGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1167421099 19:49403825-49403847 CGATAAACTGGAGCTATTCTTGG 0: 1
1: 0
2: 0
3: 5
4: 77
1167421088_1167421093 1 Left 1167421088 19:49403774-49403796 CCTGCTGCCAGGTTGAGTGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1167421093 19:49403798-49403820 AGCAGCATCTGGGACACCCTCGG 0: 1
1: 0
2: 0
3: 17
4: 226
1167421088_1167421091 -9 Left 1167421088 19:49403774-49403796 CCTGCTGCCAGGTTGAGTGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1167421091 19:49403788-49403810 GAGTGCCTTGAGCAGCATCTGGG 0: 1
1: 0
2: 1
3: 20
4: 174
1167421088_1167421094 16 Left 1167421088 19:49403774-49403796 CCTGCTGCCAGGTTGAGTGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1167421094 19:49403813-49403835 ACCCTCGGCCCTCGATAAACTGG 0: 1
1: 0
2: 0
3: 0
4: 29
1167421088_1167421090 -10 Left 1167421088 19:49403774-49403796 CCTGCTGCCAGGTTGAGTGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1167421090 19:49403787-49403809 TGAGTGCCTTGAGCAGCATCTGG 0: 1
1: 0
2: 2
3: 17
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167421088 Original CRISPR AAGGCACTCAACCTGGCAGC AGG (reversed) Intronic
900465946 1:2825512-2825534 AGGGAACCCAGCCTGGCAGCAGG + Intergenic
901912729 1:12473599-12473621 AAAGCACTCAGCCTGGCATGTGG + Intronic
902477432 1:16695663-16695685 AAGCAACTCATCCTGCCAGCTGG + Intergenic
906675730 1:47692429-47692451 AAGGCACACAGCATGGCAGGCGG - Intergenic
907724159 1:57003158-57003180 AATGCAAACAACCTGGCTGCAGG + Intronic
912233418 1:107822008-107822030 AAGGCACTGAAGCTGGCATAAGG - Intronic
913287046 1:117236180-117236202 CAGGCACTCTTCCAGGCAGCTGG + Intergenic
915955936 1:160219905-160219927 AAGGCACCCTGCCTTGCAGCTGG + Intronic
916458126 1:164992043-164992065 CAGGAACTCCACATGGCAGCTGG + Intergenic
917186425 1:172361650-172361672 AAGACTCTCAACTTGGCTGCTGG - Intronic
917599929 1:176563714-176563736 ATGGCAATACACCTGGCAGCAGG + Intronic
918136068 1:181674868-181674890 AAGGCAGTCACCCTGCCACCTGG - Intronic
919050916 1:192510312-192510334 AAGGCACTATGCCTGGCACCTGG - Intergenic
920186489 1:204162544-204162566 AAGGAACTCCACCTGGCGGGAGG + Intronic
921745513 1:218735964-218735986 AAGGCATTCAACAGGTCAGCTGG + Intergenic
922327618 1:224543489-224543511 AAGACCCTCAAACTTGCAGCTGG + Intronic
923426551 1:233875891-233875913 ATGGCACTTAACCTGGGAACTGG - Intergenic
1063223144 10:3989652-3989674 AAGGCTCTCAACCTTGCAGGAGG - Intergenic
1064264646 10:13815660-13815682 TAGGCTCTCACCCTGGAAGCAGG - Intronic
1064509482 10:16074213-16074235 AAGGCTCTCCCCCTTGCAGCTGG - Intergenic
1068667292 10:59690457-59690479 AAAGCACTCAAGATGGGAGCAGG + Intronic
1070741862 10:78908422-78908444 CAGGCCCTGAGCCTGGCAGCAGG + Intergenic
1074751081 10:116587895-116587917 AATGCACTCCAACTGGCACCAGG + Intergenic
1076543298 10:131227929-131227951 AATGCACTCAGCCAGGGAGCAGG - Intronic
1077674392 11:4183742-4183764 GATGCTCTCAACCTGGCAGGGGG - Intergenic
1079341626 11:19616544-19616566 AAGGCAGTCAGGCAGGCAGCTGG + Intronic
1079498852 11:21078319-21078341 AAGGCACTCCACATACCAGCAGG + Intronic
1081614876 11:44584901-44584923 CAGGCACTCCACCTGCAAGCTGG - Intronic
1084409544 11:68998575-68998597 GAGGCTCCCAGCCTGGCAGCCGG - Intergenic
1084532823 11:69738861-69738883 AGGGCTCCCAACATGGCAGCTGG - Intergenic
1085393948 11:76196856-76196878 AAGGCTCCCAAACTGTCAGCTGG + Intronic
1086168504 11:83808297-83808319 AAGGCACTGAACTTGGCCACAGG - Intronic
1087521015 11:99235897-99235919 AAGGCAAGGAACCTGGAAGCTGG + Intronic
1088375800 11:109140623-109140645 AAGGCCCTCAACATAGCACCTGG + Intergenic
1089093817 11:115901137-115901159 ATGGGACTCAAGCTGGCTGCTGG - Intergenic
1090395334 11:126414835-126414857 CAGGCACCCAGCCTGGCACCCGG + Intronic
1091583675 12:1803933-1803955 AAGGCAGTGGACATGGCAGCGGG + Intronic
1091619948 12:2079444-2079466 AAGGCAGTCATCCAGGAAGCAGG - Intronic
1093620208 12:21278843-21278865 AAGGAACTAAACAAGGCAGCAGG + Intronic
1096411320 12:51379003-51379025 AAGGAACTCAGCCTGGCACCAGG - Intronic
1097915090 12:65012869-65012891 GAAGCACTCAACTTGGCAACAGG + Intergenic
1098578960 12:72076133-72076155 AGGGCTCTCAAACTGGCAGCAGG + Intronic
1099710913 12:86223513-86223535 AAGGCACTCACAATGGAAGCAGG - Intronic
1100150981 12:91737352-91737374 AAAGAACTCAACCTGCCATCTGG - Intergenic
1101809864 12:108098384-108098406 ATGGAACACAACGTGGCAGCTGG + Intergenic
1102040365 12:109796908-109796930 AAGCCACTTAACCAGTCAGCTGG + Intronic
1104132838 12:125910929-125910951 AAGCCAGTCAACCTTGGAGCTGG - Intergenic
1104736165 12:131137144-131137166 AGGGCACACAACTTGGCATCAGG - Intronic
1108075993 13:46680305-46680327 TTGGCACTCCACCTGGCAGTGGG + Intronic
1113627899 13:111859782-111859804 AAGGCAGGCAGCCTAGCAGCAGG + Intergenic
1113692651 13:112322638-112322660 AAGGCATTCAACGCGGCTGCAGG + Intergenic
1118452618 14:65917869-65917891 AAGGCCCTCAGCTTGGCAGTGGG - Intergenic
1119849633 14:77857964-77857986 AAGGCCCTCAACTGGGCAGGGGG + Intronic
1121979770 14:98444471-98444493 TGGGCAAGCAACCTGGCAGCAGG - Intergenic
1128355187 15:66921452-66921474 AAGGAAGTCCAGCTGGCAGCAGG + Intergenic
1132382621 15:101377116-101377138 ACGGCACTCCACCAGGCCGCTGG + Intronic
1132405481 15:101539724-101539746 AAGCCACTCCAGCTGGAAGCAGG - Intergenic
1134827999 16:17299911-17299933 AAAGCACTGACCCCGGCAGCAGG + Intronic
1137685075 16:50381201-50381223 AAGGCACTCAACATGGTATTTGG + Intergenic
1139367735 16:66444029-66444051 AGGGCATTCAACCTGGCTGGAGG + Intronic
1146814536 17:35931873-35931895 AAGGCACTGACCCTGTGAGCCGG - Intergenic
1148388625 17:47254173-47254195 AAGGCGCTCAGCCTGGCTGATGG - Intronic
1148714995 17:49709562-49709584 AAAGCACTTAACATGGTAGCTGG + Intergenic
1150468889 17:65418872-65418894 AAGGCTCTCGCCCTGGCAGAGGG + Intergenic
1159030880 18:63229846-63229868 AAGGCACCCATCCTTGCAGGAGG - Intronic
1159881296 18:73860896-73860918 TAAGCACTCACCCTGGGAGCAGG + Intergenic
1163576718 19:18115215-18115237 AAGGCCTTCACCGTGGCAGCAGG + Intronic
1166108821 19:40610646-40610668 CAGGCCCTCACCCTGGCAGCTGG - Exonic
1167220112 19:48193877-48193899 AAGGCACACAGCCAGGAAGCAGG + Intronic
1167361675 19:49033519-49033541 AATGCAGTGAACCTGGGAGCGGG + Intronic
1167364394 19:49047333-49047355 AATGCAGTGAACCTGGGAGCGGG - Intergenic
1167384036 19:49153696-49153718 AAGGCACCCATCATGGCAGCCGG - Exonic
1167421088 19:49403774-49403796 AAGGCACTCAACCTGGCAGCAGG - Intronic
931684868 2:64784541-64784563 AGGCCACTCCACCTGGCCGCAGG - Intergenic
933802517 2:85974500-85974522 TATGCACTCAGCCTGGCAGCTGG + Intergenic
938118849 2:128620010-128620032 AAAGCACTCAGCCCTGCAGCAGG - Intergenic
938134889 2:128748751-128748773 AAAGCCCTCAACCCAGCAGCCGG + Intergenic
942937990 2:181581702-181581724 AATGCAATCAACCTGCCACCAGG + Intronic
943207479 2:184919258-184919280 AATGTACTCAACCTGCCACCAGG + Intronic
948103421 2:235393432-235393454 AAGGCACTCAACCACGCCACAGG + Intergenic
1170639411 20:18138277-18138299 AAGGCGCTAAGCCGGGCAGCCGG - Intronic
1170866249 20:20160621-20160643 AAAACACACAACCTGGGAGCAGG + Intronic
1173059451 20:39647677-39647699 AAGACACTCAAGCTGACTGCTGG + Intergenic
1173104521 20:40120991-40121013 CAGACACCCAACCTGGCAGAAGG + Intergenic
1173279627 20:41617654-41617676 AATGCACAAAACTTGGCAGCGGG + Intronic
1173917525 20:46719476-46719498 AAGGCACTTTACATGGCGGCAGG + Intronic
1174451961 20:50626047-50626069 AAGGCAAACAACCTGGCAGGAGG - Intronic
1175501488 20:59454050-59454072 AAGGCAGGCAAAATGGCAGCTGG - Intergenic
1175680466 20:60984726-60984748 AAGGGACTAAGCCTGGCTGCTGG - Intergenic
1175896578 20:62338457-62338479 AGGGGACTCACGCTGGCAGCCGG + Exonic
1179722295 21:43322654-43322676 AAGGCTCTGAACCAGGCACCAGG - Intergenic
1180245616 21:46545562-46545584 AAGGCACTCACCGTGGCCCCAGG + Intronic
1181052121 22:20242894-20242916 CAGGCACGGAAGCTGGCAGCTGG + Exonic
1181106600 22:20579428-20579450 ACGGGTCTCACCCTGGCAGCTGG - Intronic
949449442 3:4168972-4168994 AAGGGACTCAAGCTATCAGCAGG - Intronic
949738310 3:7200159-7200181 AAATCACTCACCCTGGCAGGAGG + Intronic
949857565 3:8475823-8475845 CAGGCACTGGACCTGGCTGCAGG + Intergenic
952639774 3:35579587-35579609 AAGGCCCTCAACATAGCACCTGG - Intergenic
952932122 3:38368536-38368558 GTGGCAGTCAAGCTGGCAGCCGG + Intronic
954638749 3:52085579-52085601 AAGGCAGGCATCCTAGCAGCGGG - Intronic
959612993 3:108315663-108315685 AAAGCACCCCAGCTGGCAGCTGG + Intronic
960796019 3:121488876-121488898 AAGGACACCAACCTGGCAGCAGG - Exonic
961506054 3:127371198-127371220 AAGCCACTTAGCCTGGCACCCGG - Intergenic
964257374 3:154791552-154791574 AAGGCAGTGGGCCTGGCAGCCGG - Intergenic
964259443 3:154818815-154818837 AAGGCACTCAACTGGGAAGAAGG + Intergenic
967182423 3:186917968-186917990 AAGGCCCTCAAACTGACGGCTGG + Intergenic
968523364 4:1044484-1044506 CAGGCACCTACCCTGGCAGCTGG - Intergenic
968912375 4:3482872-3482894 AAGGTGCTCAGCCTGGCAGCCGG + Intronic
975742326 4:77441708-77441730 AATGCAATCAACCTGTCATCAGG - Intergenic
979509436 4:121535517-121535539 AAGGCACTCCAGCTGACAGCTGG + Intergenic
985498203 5:222993-223015 AAGGCACTCAACATTGAATCAGG - Intronic
997605441 5:135172757-135172779 ATGGCATCCAGCCTGGCAGCTGG + Intronic
997626724 5:135336154-135336176 AAACCCCTCCACCTGGCAGCAGG - Intronic
998800407 5:145863642-145863664 AAAGAACCTAACCTGGCAGCAGG - Intronic
1002596784 5:180328872-180328894 AATGCACTGAGCCTGGCATCCGG + Intronic
1004275092 6:14229188-14229210 AAGGCACTCAGCCTGGCCAAGGG - Intergenic
1004486367 6:16069962-16069984 CTGGCTCTCACCCTGGCAGCAGG + Intergenic
1006571817 6:35011859-35011881 AAGGAAATCAGCATGGCAGCTGG - Intronic
1006916821 6:37600063-37600085 AGGAAACTCAACCAGGCAGCAGG + Intergenic
1007267321 6:40606647-40606669 TAGGCACAGAACCAGGCAGCTGG + Intergenic
1007820121 6:44554911-44554933 TAGGAAATCAACCGGGCAGCTGG + Intergenic
1009953594 6:70424624-70424646 AAGGCACTAAACCTGACATGGGG + Intronic
1013416629 6:109931446-109931468 AAAGAACTAAACCTGGCAGCTGG - Intergenic
1016419473 6:143869669-143869691 AATGTAATCAACCTGCCAGCAGG + Intronic
1017547918 6:155470983-155471005 AAGGGAGTGAACCTGGGAGCTGG + Intergenic
1017765518 6:157603878-157603900 AAGGCACACAACATGTCAGTGGG + Intronic
1019770155 7:2878581-2878603 AAGGCACACAGCCTGGCTGTGGG + Intergenic
1020547397 7:9550137-9550159 AGGGCACTGAACCAGGAAGCAGG - Intergenic
1023014176 7:35950417-35950439 AAGGTGCACAACCTGGTAGCTGG + Intergenic
1023987108 7:45103126-45103148 AGGGCAGTCAACCAGACAGCAGG + Intronic
1024066819 7:45744588-45744610 AAGGTACACAACCTGGTAGCTGG - Intergenic
1029914133 7:104189277-104189299 AAAGCACTCAACAGGGCAGTAGG + Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1038227662 8:25671628-25671650 GAGCCACACAACCGGGCAGCTGG + Intergenic
1039823238 8:41152238-41152260 AATACACTCAACCTTACAGCTGG + Intergenic
1040358960 8:46646639-46646661 AAGTCACTCTACCTGGGTGCTGG - Intergenic
1041016923 8:53600326-53600348 AAGGTAGTTAACCTAGCAGCAGG - Intergenic
1047644871 8:126859772-126859794 GAGGCATTGAACCTGGGAGCTGG + Intergenic
1049741799 8:144244584-144244606 AGGGCACTCCACCTGGCTGCTGG + Intronic
1051532491 9:18120242-18120264 ACTGCTCTCAACATGGCAGCTGG + Intergenic
1061362077 9:130149956-130149978 AAGGCACTCCACTTGGCTGAAGG - Intergenic
1187726909 X:22212783-22212805 AAGGCACTCCTCCTGGCACTGGG - Intronic
1188199595 X:27282474-27282496 AAGGCACTCCAAGTGGCACCCGG + Intergenic
1191741252 X:64437540-64437562 AAGGCAGGCAGCCTGGCACCAGG - Intergenic
1191809906 X:65175565-65175587 AATGCAGTCAAACTGGTAGCTGG + Intergenic
1192552058 X:72062521-72062543 AAGGCACTCAACCTCCAATCTGG - Intergenic
1194281885 X:91963120-91963142 AAGAAATTCAAGCTGGCAGCAGG - Intronic
1194928798 X:99862028-99862050 AAGGCCCTCAACATAGCACCTGG - Intergenic
1199757560 X:150879541-150879563 AGGGCACTAAACCTGGAACCAGG - Intronic
1200599482 Y:5187776-5187798 AAGAAATTCAAGCTGGCAGCAGG - Intronic
1200856776 Y:7947415-7947437 AAGTCACTCAACCTAGGAGCTGG + Intergenic
1202011566 Y:20346109-20346131 AAGACAATCAACCTGCCAGAAGG - Intergenic