ID: 1167421103

View in Genome Browser
Species Human (GRCh38)
Location 19:49403855-49403877
Sequence GTGTGGAGGGGGAAGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1146
Summary {0: 1, 1: 1, 2: 3, 3: 84, 4: 1057}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167421103 Original CRISPR GTGTGGAGGGGGAAGGTAGA GGG (reversed) Intronic
900145593 1:1157561-1157583 GTGTGGAGCAGGAAGGGGGAAGG + Intergenic
900422801 1:2562913-2562935 AGGTGGAGGGGGGAGGGAGAGGG - Intronic
900629038 1:3624239-3624261 GTGTGGAGGGGGGCGGTGAACGG - Intergenic
901441790 1:9282518-9282540 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
902385155 1:16072222-16072244 CTGGGGAAGGGGAAGGTACAGGG - Intronic
903066189 1:20700995-20701017 GTCTGGAGGGAGAAGGGAGTGGG - Intronic
903331706 1:22600042-22600064 GAGTGGAGGAGGAAGGAAGGGGG + Intronic
903387615 1:22938221-22938243 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
903557156 1:24202407-24202429 GAGTTGAGGGGGAAGAGAGAGGG - Intergenic
903921111 1:26801746-26801768 GTGTGGAGAGAGAAGAGAGAGGG + Intergenic
904419812 1:30384366-30384388 GTGGGGAGGGGGAAGGTGCCAGG + Intergenic
904441656 1:30535722-30535744 GTGAGGGTGGGGAAGGGAGAGGG + Intergenic
904580543 1:31540509-31540531 GTATGTAGAGGGAGGGTAGATGG + Intergenic
904879466 1:33684455-33684477 TCGTGGAGGGGGAAGGAAGAAGG - Intronic
905105222 1:35559750-35559772 GTGTGGGGGGTGAAGGGAGGAGG + Intronic
905173499 1:36122926-36122948 GTGTGGAGGGGGAAGCTTCAGGG - Intronic
905389112 1:37624859-37624881 GTGCTGAGGGGTAAGGTGGATGG - Intronic
905682324 1:39883198-39883220 GGGCGGAGGGGGTAGGTAAAGGG - Intronic
905874537 1:41423679-41423701 GGGGGGCGGGGGCAGGTAGAGGG - Intergenic
906135972 1:43501238-43501260 GAGGGGAGGGGGGAGGGAGAGGG - Intergenic
906509064 1:46400837-46400859 GGGAGGAGGGGAAGGGTAGAGGG + Intronic
906522791 1:46477247-46477269 GAGAGGAGGGGTAAGGGAGAGGG - Intergenic
906616190 1:47234468-47234490 GTGTGGAGGGGGAAGGACTCTGG + Intergenic
906904502 1:49875298-49875320 GTGTGGAGGGGGGAGGGGGGAGG - Intronic
907253690 1:53161356-53161378 GAGTGGAGGGGAAAGGAAAAAGG + Intergenic
907617881 1:55943145-55943167 GTGTGGAGGGGGGTGGTGGCTGG + Intergenic
908431583 1:64063897-64063919 GTGAGAAGGGGGATGGGAGAGGG - Intronic
909115021 1:71522714-71522736 GTGTGTAAGGGGGGGGTAGAGGG - Intronic
909180710 1:72420335-72420357 CTGTGGTGGGGGGAGGGAGAGGG - Intergenic
909663608 1:78110036-78110058 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
909847246 1:80410094-80410116 GTGCGGTGGGGGGAGGGAGAAGG + Intergenic
910363744 1:86441574-86441596 GTGGGGAGTGGGAAGGGAGAAGG + Intronic
910672823 1:89790186-89790208 CTCTGGAGGGGAAAGGAAGAAGG - Intronic
910840680 1:91558426-91558448 TTGGGGAGGGGGAAGGGGGATGG - Intergenic
910875884 1:91877332-91877354 GTGTGGTGGGGGTAGGGACAAGG + Intronic
911022417 1:93402100-93402122 GTGGGGGGGGGGAAGGGAGGAGG - Intergenic
911392018 1:97256947-97256969 GTGTGAAGTGGGAAGGTGGGTGG - Intronic
911649689 1:100373946-100373968 GTGGGGTGGGGGGAGGTAGGAGG - Intronic
912065193 1:105730017-105730039 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
912103604 1:106242373-106242395 TTGGGGTGGGGGAAGGGAGAGGG + Intergenic
912660597 1:111526173-111526195 GTGTGTGGTGGGGAGGTAGAGGG - Intronic
912690401 1:111800679-111800701 CTTTGGAGGGGAAAAGTAGAAGG + Intronic
912799559 1:112712515-112712537 GGGTGGAGGGGGTAGGGGGAGGG - Intronic
912913738 1:113790157-113790179 GTGGGGAGTGGGAATGGAGAAGG + Intronic
913171198 1:116233805-116233827 AAGTGGAGGGGGAAAGGAGAGGG + Intergenic
913209296 1:116570162-116570184 GTGTGGAGGGTGAAGGAGGATGG + Intronic
913371504 1:118104771-118104793 GTGTGGAGGTGGAAAATAGGAGG + Intronic
913485926 1:119332837-119332859 ATGTGGAGGGGGAAGGAGAAAGG - Intergenic
913703041 1:121392281-121392303 AGGAGGAGGGGGAAGGAAGAAGG - Exonic
913963675 1:143357556-143357578 GTGGGAAGGGGGAAGGGAGGGGG - Intergenic
913979211 1:143493442-143493464 AGGAGGAGGGGGAAGGAAGAAGG - Intergenic
914043602 1:144072776-144072798 AGGAGGAGGGGGAAGGAAGAAGG - Intergenic
914058034 1:144183145-144183167 GTGGGAAGGGGGAAGGGAGGGGG - Intergenic
914073614 1:144319092-144319114 AGGAGGAGGGGGAAGGAAGAAGG - Intergenic
914105541 1:144647268-144647290 AGGAGGAGGGGGAAGGAAGAAGG + Intergenic
914121111 1:144783220-144783242 GTGGGAAGGGGGAAGGGAGGGGG + Intergenic
914134485 1:144887715-144887737 AGGAGGAGGGGGAAGGAAGAAGG + Exonic
914677147 1:149914064-149914086 GGGTGGATGGGGAAGGGACAGGG + Exonic
915106390 1:153537264-153537286 GGGTGGAGGGTGAGGGTGGAGGG + Exonic
915301896 1:154956457-154956479 GTGAGATGGGGGAAGGGAGAGGG + Intergenic
915440978 1:155945319-155945341 GTGTGGAGGGGGTTGGTACGGGG + Intergenic
915736993 1:158091332-158091354 TGGTGGAGAGGGAAGGAAGAAGG - Intronic
915799443 1:158773667-158773689 ATGTGGTGGGGGAGGGAAGATGG - Intergenic
915974431 1:160375644-160375666 GGGTGGAGAGGGAAGGGAGGTGG - Intergenic
916031438 1:160880927-160880949 GTGTGGATGGGTCAGGGAGAAGG - Intronic
916242920 1:162657820-162657842 GTGGGGAGGGGAAGGGAAGAAGG - Intronic
916822172 1:168410198-168410220 GGGAGGAAGGGGAAGGTAGGTGG + Intergenic
917392358 1:174552314-174552336 GGGTGGAGGCGGAGGGTGGAAGG - Intronic
917452884 1:175161855-175161877 ATGAGGAAGAGGAAGGTAGAAGG - Intronic
917485480 1:175451362-175451384 GTGGGGTGGGGGAAGGGGGAAGG - Intronic
917562824 1:176177743-176177765 AGGTGGAGGGGGAAGGTAAGTGG - Intronic
919010835 1:191960789-191960811 GTGGGGTGGGGGAAGGGAGGAGG - Intergenic
919498611 1:198309329-198309351 GTGGGGTGGGGGAAGGGAGAAGG + Intronic
920098239 1:203500220-203500242 GTGTGGAGGTGGGTGGTAGGTGG - Intronic
920497325 1:206464572-206464594 GTGGGGAGGGAGAAGGTGGCTGG - Intergenic
920547336 1:206829381-206829403 GTGGGGAGAGGAAAGGAAGAGGG + Intronic
920923201 1:210315527-210315549 GTGTGGCGGCAGAAGGGAGAAGG - Intergenic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921973180 1:221173346-221173368 GTGGGGGGGGGGAGGGTACATGG + Intergenic
922061690 1:222098645-222098667 GAGTGGAGGGGTTAGGAAGAAGG + Intergenic
922073526 1:222219977-222219999 GTGTTGAGAGAGAAGGTGGAAGG - Intergenic
922080949 1:222296043-222296065 GTTTGGAGGGCCAAGGTGGAAGG + Intergenic
922383298 1:225055677-225055699 GTGTGGTGGGGGAGGGGGGAGGG - Intronic
922434142 1:225586297-225586319 GAGAGGAGGGGGAAGGAAAAGGG + Intronic
922612180 1:226938945-226938967 GGCTGGAGGGGGAAGATGGAAGG + Intronic
922689440 1:227676663-227676685 GTGGGGAGGGGGAGGGGGGAGGG - Intronic
922694850 1:227724731-227724753 GTGGGGAGGGGCTGGGTAGAGGG + Intergenic
923007371 1:230061704-230061726 GGGTGGGAGGGAAAGGTAGAAGG - Intronic
923092711 1:230752256-230752278 GTGTGGAAGGGGCAGCTAGGCGG - Intronic
923427849 1:233890178-233890200 GTATGGAGGTGGGAGGTGGAAGG + Intergenic
923536654 1:234857775-234857797 GTCTGGAGGGAGTAGGGAGAGGG + Intergenic
923710608 1:236385932-236385954 GTGGGGAGAGGGAAAGGAGAGGG - Intronic
923751813 1:236753802-236753824 GGGTGTAGGGGGAAGGAAGAGGG - Intronic
924857434 1:247888463-247888485 GTGGGGAGGGGGGAGGGAGGAGG - Intergenic
1062812376 10:476647-476669 GTGTGGAGGGGCCTGGGAGAGGG - Intronic
1062924128 10:1301841-1301863 GTGTGGAGGCAGCAGGTACAGGG - Intronic
1063300255 10:4844430-4844452 GTGTGGAAGGGGACGGGAGTGGG + Intronic
1063337341 10:5228690-5228712 GTGGGGTGGGGGAGGGGAGAGGG + Intergenic
1063353124 10:5374236-5374258 GTGGGGAGGGGGAGGGGAGGGGG + Exonic
1063604390 10:7509510-7509532 ATGTGGAGGGAGGAGGTATAGGG - Intergenic
1064526300 10:16260353-16260375 GAAGGGAGGGAGAAGGTAGAAGG + Intergenic
1064587377 10:16852191-16852213 GTGAGGAAGGGAAAGATAGAGGG - Intronic
1064850301 10:19701828-19701850 GGGAGGAGGGAGAAGGGAGAAGG - Intronic
1064968315 10:21037264-21037286 GGGTGGAGGGGGTGGGGAGAGGG + Intronic
1065651504 10:27897222-27897244 GAGTGTAGGTGGAAGGGAGAAGG - Intronic
1065865837 10:29914590-29914612 TGGTGGAGGAGGAAGATAGAAGG - Intergenic
1066594173 10:37030601-37030623 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1066756323 10:38716395-38716417 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1067031177 10:42879514-42879536 GTGTGGAGGGGGCAGGATCAGGG + Intergenic
1067035616 10:42914318-42914340 GTGTGTAGAGGGAAGGTGCAAGG - Intergenic
1067142671 10:43669739-43669761 GTGTGGAGGGAGATGGGAGCTGG + Intergenic
1067213181 10:44278870-44278892 GTGTTGCTGGGGAAGATAGAAGG + Intergenic
1067300967 10:45009315-45009337 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1067304707 10:45050936-45050958 GGGTGGAGAGGGTAGGCAGAGGG + Intergenic
1067473825 10:46553705-46553727 TTGTGGAGGGGGAATGGGGAAGG - Intronic
1067523827 10:47026737-47026759 GTGGGGAGGGGGAGGGCAGAGGG + Intergenic
1067532967 10:47087891-47087913 GGGTGGAGGGGGAATGTTGCTGG + Intergenic
1068153549 10:53166575-53166597 GTGTGGATGGGGCAGGAAGGGGG - Intergenic
1068780465 10:60914194-60914216 GTGTGGAGGGGGCAGGGAGGAGG + Intronic
1068967981 10:62933046-62933068 GTGGGGTGGGGGGAGGGAGAGGG - Intergenic
1069184075 10:65400471-65400493 GAGTGGTGGGGGAAGGGGGAAGG - Intergenic
1069681704 10:70290230-70290252 GTGAGGAGGGGGACAGGAGAGGG - Intergenic
1069956941 10:72057716-72057738 GTGTGGAGGGGGATGGAATCTGG - Intergenic
1069973993 10:72198109-72198131 GAGGGGAGGGGGGAGGGAGAGGG + Intronic
1070030671 10:72674173-72674195 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1070191260 10:74113930-74113952 GAGAGGAGGGGGAAAGGAGAGGG - Intronic
1070319516 10:75343984-75344006 TTGTGGAGGGGAAAGGAAGATGG + Intergenic
1070573772 10:77661497-77661519 GTGTTGAGTGTGAATGTAGAAGG + Intergenic
1070716726 10:78727850-78727872 GTTTGGAGGGGGAGGGTGGGTGG - Intergenic
1070727464 10:78802227-78802249 GCATGGAGGGGAAAGGTAGGAGG + Intergenic
1070776799 10:79114537-79114559 GTGTGAAGGTGGGAGGGAGAAGG + Intronic
1070831630 10:79421425-79421447 GGAGGGAGGGGGAAGGGAGAGGG - Intronic
1071331940 10:84569387-84569409 GTATGGAGGGGCATGGGAGAGGG + Intergenic
1071544047 10:86514487-86514509 TTGTGAAGGAGGAAGGAAGATGG + Intronic
1071814044 10:89213141-89213163 GTGGGGTGGGGGGAGGTAGGAGG + Intergenic
1071864168 10:89707642-89707664 GTGTGAAGGGGGAAAGGGGATGG - Intronic
1072108022 10:92291830-92291852 TTGGGGAGGGGGAAGGGGGAGGG - Intronic
1072201352 10:93161665-93161687 TTGTGGAGGGGGCAGGGACAGGG - Intergenic
1072230502 10:93410339-93410361 GAGTGCAGAGGGAAGGTAGAGGG - Intronic
1072311419 10:94159760-94159782 GTGGGGAGGGGGAAGGAGGGAGG - Intronic
1072397370 10:95058785-95058807 GTGTGGTGGGGGGAGGGGGAAGG - Intronic
1073093818 10:100968167-100968189 GCGGGGAGAGGGAAGGTAGCTGG - Intergenic
1073213978 10:101826554-101826576 TTGTGGTGGGGGAATGTGGATGG - Intronic
1073250280 10:102117078-102117100 GCCTGGAGGGGGAAGGGAGTAGG - Intronic
1073588857 10:104736922-104736944 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1073614260 10:104976908-104976930 GTGGGGTGGGGGAAGGTGGGAGG + Intronic
1074061224 10:109967615-109967637 GTGTGGCGGGGGAGGGGAAATGG + Intergenic
1074163755 10:110857020-110857042 GGGGGGAGGGGGAAGGGGGAAGG + Intergenic
1074658487 10:115622003-115622025 GTGTGGAAGGGGAGAGCAGAGGG + Intronic
1074724108 10:116289835-116289857 GTCGGGAGGAGGAAGGGAGAGGG - Intergenic
1074852281 10:117448440-117448462 TTGTGGAGTGGGTGGGTAGATGG + Intergenic
1074902718 10:117833027-117833049 GTGGGGAGGGGGAGGGAGGAGGG - Intergenic
1075323514 10:121511437-121511459 GGGTGGTGGGGGAAGGTGTAGGG - Intronic
1075585430 10:123653782-123653804 ATGGGGAAGGGGAAGGGAGAAGG + Intergenic
1075995625 10:126873993-126874015 GTGTGGAGAGGAAAGGAAGGAGG - Intergenic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076290695 10:129343399-129343421 GTAGGGAGGTGGAAGGAAGATGG - Intergenic
1076479144 10:130772877-130772899 GGCTTGAGGGGGTAGGTAGAAGG + Intergenic
1076768311 10:132649721-132649743 CTGTGGAGGGGCCAGGCAGACGG + Intronic
1076995146 11:294099-294121 GTGTGGACGGAGAATGCAGACGG + Exonic
1077047632 11:553420-553442 CTGTGGAGGGGGCAGACAGAGGG + Intronic
1077163254 11:1123119-1123141 AGGGGGAGGGGGAAGGAAGAAGG - Intergenic
1077555481 11:3224021-3224043 GAGGGGAGGGGGAATGTGGATGG + Intergenic
1077609540 11:3635938-3635960 GTGCGGACCTGGAAGGTAGAAGG - Intergenic
1077648113 11:3944464-3944486 GAGTGGAGGGGGAAGTGGGATGG + Intronic
1078399275 11:11009988-11010010 GTTTGGAGAGGGAGGGGAGAAGG + Intergenic
1078529460 11:12125764-12125786 GTGGGGACGTGGTAGGTAGATGG + Intronic
1078613367 11:12841551-12841573 GCCTGGAGGGGGAATGTGGAGGG - Intronic
1078653352 11:13216139-13216161 GTTTGGAGGGAGAAGCTAGTGGG + Intergenic
1078997954 11:16723323-16723345 TTGCGGAGGGGGAAGGTGGGAGG + Intronic
1079087132 11:17454525-17454547 GGGAGGAGGTCGAAGGTAGAAGG + Intronic
1079174491 11:18126633-18126655 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1079251597 11:18791471-18791493 GTGCGGAGCCGGAAGGTGGAGGG - Intronic
1079547143 11:21646151-21646173 GTGTTGGGGGGGAAGGTTGTGGG + Intergenic
1080007066 11:27420762-27420784 GTGTCTTGGGGGAAGGTGGAGGG + Intronic
1080420098 11:32102143-32102165 GTGTGGTGGGGGGTGGTAGTAGG + Intronic
1080438809 11:32271419-32271441 GTAGGGAGGGGGAAGGAAGGGGG - Intergenic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1080873576 11:36257796-36257818 CTGTGGAGGGTGGAGGCAGATGG + Intergenic
1081000188 11:37659739-37659761 GTGGGGTGGGGGAGGGTGGAGGG + Intergenic
1081268956 11:41060981-41061003 GTGTGGAGGGGGGAGGGGAAGGG - Intronic
1081627150 11:44662950-44662972 GTGGGGAGGGGAGAGGGAGAGGG - Intergenic
1081774396 11:45667419-45667441 GTGGGGAGGGGGAAGGCAGGTGG - Intergenic
1082207985 11:49462252-49462274 GGGGGGAGGGGGAAGGGGGAGGG - Intergenic
1082244476 11:49905292-49905314 GAATGGAGGGGGAAGGGGGAAGG + Intergenic
1082721828 11:56687161-56687183 GGTAGGAGGGGGAAGGAAGAAGG + Intergenic
1082915682 11:58433904-58433926 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1083050167 11:59769864-59769886 GTGTGGGGGGGGAAGGTGTGTGG + Intronic
1083589179 11:63882954-63882976 GGGTGGTGGGGGTAGGCAGAAGG - Intronic
1083590050 11:63888490-63888512 GGGGGGAGGGGGAGGGGAGAAGG + Intronic
1084642589 11:70434682-70434704 CTGTGGAGGGGGTGGGGAGATGG - Intronic
1084668006 11:70586912-70586934 GTGAGGTGGGGGAGGGAAGAGGG - Intronic
1084740042 11:71133560-71133582 GAGTGGAGGGGGGATGTGGATGG + Intronic
1084866809 11:72065043-72065065 GTGTTAAGGGGGAAAGTAAAAGG - Intronic
1085235931 11:75015510-75015532 TTGTGGAGGGGGAAGCTTGAGGG - Intronic
1085270180 11:75265607-75265629 GGGAGGAGGGTGAAGGCAGAAGG + Exonic
1085446897 11:76606748-76606770 GTCTGGAGAGGGAAGGTGGCAGG - Intergenic
1087167107 11:95015989-95016011 GGGTGGAGGGTGTAGGAAGAGGG - Intergenic
1087995265 11:104798688-104798710 TTGGGATGGGGGAAGGTAGATGG - Intergenic
1088339330 11:108745128-108745150 GAGTGGAAGGAGAAGGGAGAAGG - Intronic
1088710634 11:112505442-112505464 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1088718915 11:112574791-112574813 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1089202077 11:116730643-116730665 GTGTGGAGGGGGAAGAAAGCAGG - Intergenic
1089500147 11:118927192-118927214 GTGAGGAGGGGCAGGGGAGAGGG - Intronic
1089644445 11:119869405-119869427 GTGTGGAAGGGGATGACAGAGGG - Intergenic
1089698030 11:120227697-120227719 GTGTGGAGGGGAGAGGGAAATGG + Intronic
1089733726 11:120535364-120535386 GTGTGAAGGGGGAGGTAAGAGGG + Intronic
1090071814 11:123550560-123550582 GTGGGGTGGAGGAAGGTGGAGGG + Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090265549 11:125350976-125350998 GTGGGGAGGGGGCACGAAGAGGG - Intronic
1090334291 11:125952185-125952207 GTGCGGACGGGGAAGCTAGGAGG + Intergenic
1091042562 11:132295695-132295717 GGGTGTAGGGGGAAGTGAGATGG + Intronic
1091219061 11:133919864-133919886 GGGTGGAGGGGAAGGGTAGCCGG + Exonic
1091798104 12:3308773-3308795 GGCTGGAGGGGGCAGGGAGAGGG + Intergenic
1092045799 12:5431344-5431366 GTGTGGAAGGGAGAGGGAGATGG - Intergenic
1092305641 12:7297872-7297894 GGCTGGAGGGGGAAAGGAGAGGG + Intergenic
1092495961 12:8995463-8995485 GTGGGGAGGGAGAGGGAAGAAGG - Intronic
1092560222 12:9604980-9605002 GTGGGGTGGGGGTAGGGAGAAGG - Intronic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1092745560 12:11669283-11669305 GGGAGGAGGGGGAAGGAACATGG + Intronic
1092817240 12:12322940-12322962 GAGGGGAAGGGGAAGGGAGAAGG + Intergenic
1093112669 12:15170338-15170360 GTGTGTAGGGGGAAGGGAGTGGG + Intronic
1093514125 12:19965615-19965637 GTCTGGAAAGGGAAGATAGAGGG + Intergenic
1094120499 12:26969070-26969092 GTGAGGAGGGAAAAGGGAGAGGG + Intergenic
1094523776 12:31218734-31218756 GTGTGGAGGGGGCAGATGCAGGG + Intergenic
1094597092 12:31875306-31875328 GTGGGGAGAGGGAAGGGAGGTGG + Intergenic
1095184357 12:39184689-39184711 GTGTTGAGGGGGATGGAGGATGG - Intergenic
1095187786 12:39221880-39221902 GAGTGGAGAGGGAAAGGAGAAGG - Intergenic
1095550678 12:43435254-43435276 GTGTGGAGGAGAATGGCAGAGGG + Intronic
1095919260 12:47513043-47513065 TTGTGGAGGGGGAGGGGAGAGGG + Intergenic
1096255005 12:50057585-50057607 GAGGGGAGGGGGAGGGGAGAGGG - Exonic
1096379717 12:51145941-51145963 GTGGGGAGGGGGAAGGGACAGGG - Intronic
1096411947 12:51383361-51383383 TGCTGGAGTGGGAAGGTAGATGG - Intronic
1096528397 12:52228098-52228120 GAGGGGAGGGGGAAGGGAGGGGG - Intergenic
1096745218 12:53722388-53722410 GTGGGGAGGGGTAAGAGAGATGG - Intronic
1096747384 12:53737814-53737836 GTGAGGAGAGGGCAGGCAGAGGG - Intergenic
1096807890 12:54151423-54151445 GTTTGGAGGGGGAAGGACGGAGG + Intergenic
1097465209 12:59914497-59914519 GTGTGATGGAGGAAGGTAGAAGG - Intergenic
1097548904 12:61041656-61041678 CTGTGGAATGGAAAGGTAGAGGG - Intergenic
1098172489 12:67760842-67760864 GTGAGTAGGGTGAAGGGAGATGG + Intergenic
1099196854 12:79626731-79626753 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1099239563 12:80123175-80123197 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1099571140 12:84320486-84320508 GTGGGGTGGGGGAGGGGAGATGG - Intergenic
1099842495 12:87983532-87983554 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1099900750 12:88708997-88709019 GTGGGGTGGGGGAAGGTGGGAGG - Intergenic
1099951308 12:89307543-89307565 GTTTGGAGGGGGGAGGAACAGGG - Intergenic
1100184971 12:92129077-92129099 GGAGGGAGGGGGAAGGGAGAAGG + Intronic
1100256334 12:92886626-92886648 GAGGGGAGGGGGAAGGGGGAAGG + Intronic
1100648471 12:96558040-96558062 TTGTGGAGGTGGCAGGGAGATGG + Intronic
1101049299 12:100844589-100844611 CTGTGGGGTGGTAAGGTAGAGGG + Intronic
1101289877 12:103357146-103357168 GTGGGGTGGGGGGAGGGAGAGGG + Intronic
1101830731 12:108254227-108254249 GTGCGGGGAGGGAAGGTATAGGG + Intergenic
1102277916 12:111597992-111598014 GTCTGGCGGGGGAAGGAGGAAGG + Intronic
1102504177 12:113373524-113373546 GTGTGGAATGGACAGGTAGATGG - Intronic
1102660652 12:114524672-114524694 GTGTGGAGCGTGCAGTTAGAAGG - Intergenic
1102676636 12:114664026-114664048 ATGTGGAGGTGGAAGGTGTAGGG + Intergenic
1102725754 12:115063109-115063131 GGGTGGGGGTGGCAGGTAGACGG + Intergenic
1102813194 12:115841712-115841734 GTGTGCAGTGGGAAGAGAGAAGG - Intergenic
1102832253 12:116013903-116013925 TTGTGGAGGTGTAAGGTTGATGG + Intronic
1103225242 12:119281871-119281893 GTGTCGAGGGGGTAGGTGGAGGG - Intergenic
1103425578 12:120830519-120830541 GTGGGGAGGGGGAGAGCAGAGGG + Intronic
1103486751 12:121288320-121288342 GTGGGGAGGAGGGAGGGAGAGGG - Intronic
1103884006 12:124187571-124187593 GGGTGGAGGGGGAGAGTGGAGGG + Intronic
1104004930 12:124885212-124885234 CGGTGGAGGGGGAAGGGAGGAGG - Intergenic
1104289205 12:127453544-127453566 GTGTGAGGAGGGAAGGCAGAAGG + Intergenic
1104800770 12:131554079-131554101 GGGTCCAGGGGGAAGGCAGAAGG + Intergenic
1104955928 12:132465817-132465839 ATGTGCAGGGTGAAGGCAGACGG + Intergenic
1105508065 13:21028071-21028093 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1105821875 13:24087287-24087309 GTGTGCAGGGGGTGGGTAGCAGG - Intronic
1107300867 13:38964344-38964366 GGGTGGTGGGGGAAGTTGGAAGG - Intergenic
1107438293 13:40401603-40401625 GTGTGGTGTGAGAAGGTAGCAGG + Intergenic
1107743399 13:43479150-43479172 GTGTTGAGGGGGATGGCAGGAGG + Intronic
1108315713 13:49235140-49235162 GGATGGAGGGGGAAGGGGGAGGG + Intergenic
1108377915 13:49830355-49830377 GTGTGGAGGGGAATTTTAGATGG + Intergenic
1109058908 13:57587167-57587189 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1109365802 13:61354992-61355014 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1110305933 13:73986704-73986726 ATGTGAAGGAGGGAGGTAGAAGG + Intronic
1110359109 13:74605465-74605487 GGGAGGAGGGGGGAGGGAGAGGG - Intergenic
1110479886 13:75961647-75961669 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1110619733 13:77581904-77581926 GTGTGGAGGGGAGTGGAAGATGG + Intronic
1110665582 13:78114169-78114191 GTTTGGGGGGCCAAGGTAGATGG - Intergenic
1110772032 13:79360466-79360488 GTGGTGAGGGTGATGGTAGATGG - Intronic
1110874225 13:80490132-80490154 GTGTGGAAGGGGACGGGAGCTGG + Intergenic
1111158571 13:84361976-84361998 GTGGGGTGGGGGATGGGAGAGGG - Intergenic
1111640069 13:90957385-90957407 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1112175648 13:97021003-97021025 GTCTGGAGGTGGAAGGTAGGAGG - Intergenic
1112306618 13:98280261-98280283 GTGTGGAGGGGGAGGGCATGGGG - Intronic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1112488002 13:99836889-99836911 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
1112627153 13:101118170-101118192 GTGTGGGGGCAGAAGGTACATGG + Intronic
1113337155 13:109387699-109387721 CTGTGGAGTGGGAAGGCAGTGGG - Intergenic
1113913302 13:113854924-113854946 GCGGGGAGGAGGAAGGAAGAGGG + Intronic
1113993780 14:16050848-16050870 GTGGGGTGGGGGAAGGTAGGAGG + Intergenic
1114952910 14:27779426-27779448 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1115412748 14:33093968-33093990 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
1116062530 14:39941937-39941959 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1116579061 14:46615496-46615518 GTGGGGTGGGGGAAGGTGGGAGG - Intergenic
1117457542 14:55912905-55912927 TAGTGGAGGTGGAAGGTAGATGG + Intergenic
1118033371 14:61839878-61839900 TTGTGGAGGGGAAAGGGGGAGGG + Intergenic
1118181045 14:63493500-63493522 GTGTGGTGGGGGGAGGGGGAGGG + Intronic
1118253460 14:64183967-64183989 GTGGGGAGGGGGAGGGGAGGGGG + Intronic
1118316434 14:64728927-64728949 GTGTGGCTAGGGAAGGTAGTGGG + Intronic
1118421690 14:65612659-65612681 GTATGGAGGGGAAATGCAGATGG - Intronic
1118466833 14:66038760-66038782 GTGGGGAGGGGAAAGTAAGAAGG - Intergenic
1118732607 14:68678969-68678991 GGGAGGAGGGAGAAGGGAGAAGG - Intronic
1118748081 14:68788701-68788723 GGGAGGAAGGGGAAGCTAGATGG - Exonic
1119057227 14:71435317-71435339 GTGGGGTGGGGGAAGGGAGGAGG - Intronic
1119273161 14:73327896-73327918 GTGTGGTGGGGGAGGGCAGGCGG - Intronic
1119432038 14:74574855-74574877 GGGAGAAGGGGGAAGGTAGGAGG + Intronic
1119513368 14:75229040-75229062 ATGCAGAGGTGGAAGGTAGATGG + Intergenic
1119630008 14:76222057-76222079 GTGTGGGGGAAGAAGGTATATGG + Intronic
1119730841 14:76950286-76950308 GTGTGTAGGGGGCAGGTGGTGGG + Intergenic
1119768189 14:77203965-77203987 GTCTGGAGGGGGCAGGAAGGAGG - Intronic
1119932030 14:78556945-78556967 GAGGGGAGGGGGAGGGGAGAAGG - Intronic
1121001872 14:90456839-90456861 ATGTGGAGTGGGGAGGAAGAGGG + Intergenic
1121338092 14:93089327-93089349 GTGTGGAGAGGGGAGGAACAGGG - Intronic
1121405764 14:93718260-93718282 GTGGGGTGGGGGAAAGGAGAAGG - Intergenic
1121456698 14:94043095-94043117 GTGAGGAGGGAGAAGGTGGTGGG - Intronic
1122092876 14:99351753-99351775 GTGTGAAGAGGGAAGGGAGGTGG - Intergenic
1122279827 14:100615166-100615188 GGCTGGAGGGAGAGGGTAGAGGG + Intergenic
1122606048 14:102948228-102948250 GTGTGGAGGTGGAGGGGAGTCGG + Intronic
1123068732 14:105630740-105630762 ATGTGGAGGTGGGAGGTAGCGGG + Intergenic
1123092756 14:105749068-105749090 TTGTGGAGGTGGGAGGTAGCAGG + Intergenic
1123208750 14:106738662-106738684 GTGTGGGGGGGGTAGGTGGGGGG - Intergenic
1123440587 15:20288467-20288489 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1123499752 15:20868921-20868943 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123503624 15:20915485-20915507 GTGTGGCGAGGGAAGGTGGTTGG - Intergenic
1123560871 15:21489159-21489181 GTGTGGCGAGGGAAGGTGGTTGG - Intergenic
1123593225 15:21879884-21879906 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123597110 15:21926450-21926472 GTGTGGCGAGGGAAGGTGGTTGG - Intergenic
1123725686 15:23099097-23099119 GTGGGGTGGGGGAAGGGAGGAGG + Intergenic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1124045184 15:26142503-26142525 GAGGGGAGGGGGAAGGGAGAGGG - Intergenic
1124493601 15:30173381-30173403 GCGGGGAGGGGGAAGGGAGCAGG + Intergenic
1124590850 15:31051650-31051672 GAGTAGAGTGGAAAGGTAGAAGG - Intronic
1124749967 15:32365268-32365290 GCGGGGAGGGGGAAGGGAGCAGG - Intergenic
1125056956 15:35371446-35371468 GTGTGGAGGTAGAGGGTATATGG + Exonic
1125196280 15:37050679-37050701 GAGTGGAGGGGCAGGGTGGAGGG - Intronic
1125429976 15:39583879-39583901 GTGTGAAGGATGCAGGTAGAGGG - Intronic
1125456518 15:39865552-39865574 GTGAGGAGGTGGAAGGAGGATGG + Intronic
1125660620 15:41391946-41391968 GTGTGGAGGAAGGAGGTAGGAGG + Intronic
1126328204 15:47504692-47504714 GTGTGGTGGGTGCAGTTAGAAGG - Intronic
1126786003 15:52178496-52178518 GTGTGGAGAAGAAAGGCAGAAGG + Intronic
1126935950 15:53708019-53708041 ATGTGGAAGGTGAAGGCAGAGGG - Intronic
1127065559 15:55234187-55234209 GTGTTGGAGGGGAAGGCAGAAGG - Intronic
1127136900 15:55933535-55933557 GGGGGGAGGGGGAAGGGGGAGGG + Intronic
1127271971 15:57409622-57409644 GTGTGAAAGGGGGAGGGAGAAGG + Intronic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1127979680 15:64025377-64025399 GTGTGGCTGGGGTAGGAAGAAGG - Intronic
1128448466 15:67785702-67785724 GGAAGGAGGGGAAAGGTAGAAGG + Intronic
1128539777 15:68518499-68518521 GAGAGTAGGGAGAAGGTAGAAGG - Intergenic
1128783357 15:70377414-70377436 GGTTGGAGGAGGAAGGTGGAGGG - Intergenic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129164607 15:73769310-73769332 GGGTGGGGTGGGAGGGTAGACGG + Intergenic
1129233179 15:74208098-74208120 GTGAGGAGGAGGAGGGTAGCCGG + Intronic
1129332048 15:74832719-74832741 ATGGGGAGGGGGAAGGAAGAAGG - Intergenic
1129480108 15:75817305-75817327 CTGTGGAGGGGGAAGTGATAGGG - Intergenic
1129616560 15:77103611-77103633 GAGTGGAGGGGGTAGGTGAATGG + Exonic
1129683436 15:77671291-77671313 GAGAAGAGGGAGAAGGTAGAGGG + Intronic
1129836574 15:78711551-78711573 GTGAGGAAGGGTAAGGGAGAGGG + Intronic
1130654964 15:85786195-85786217 GTAGGTAGGGGGAAGGGAGAGGG - Intronic
1130689582 15:86070143-86070165 GTGGGGTGGGGGATGGTGGAGGG - Intergenic
1131144415 15:90001900-90001922 AGGGGGAGGGGGAAGGGAGAGGG + Intronic
1131229166 15:90647470-90647492 GTGTGGAGGAGGAGGGGTGAGGG - Intergenic
1131438240 15:92439792-92439814 GAGGGGAGGGGAAAGGAAGAAGG + Intronic
1131555014 15:93390118-93390140 GTGGGGTGGGGGAAGGGAGAGGG - Intergenic
1131667387 15:94585079-94585101 GTTTGGAGGAAGAAGGAAGAGGG - Intergenic
1132240391 15:100253349-100253371 GTGAGGGAGGGGAAGGTAGAGGG + Intronic
1132240399 15:100253367-100253389 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240407 15:100253385-100253407 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240415 15:100253403-100253425 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240423 15:100253421-100253443 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240431 15:100253439-100253461 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240439 15:100253457-100253479 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240454 15:100253493-100253515 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1202965344 15_KI270727v1_random:169808-169830 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1202969216 15_KI270727v1_random:216323-216345 GTGTGGCGAGGGAAGGTGGTTGG - Intergenic
1132599645 16:767915-767937 GCGTGGAGGGGGCACGTGGAGGG + Intronic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1133146611 16:3791734-3791756 GTATGCAGGGGGCAGGGAGAGGG + Intronic
1133302063 16:4788342-4788364 GTGTGATGGGGGAGGGGAGAGGG + Exonic
1133560583 16:6946599-6946621 TTTTTGAGGGGGAAGGTAGTAGG + Intronic
1133598315 16:7314104-7314126 TTGGGGAGGAGGAAGGGAGAGGG + Intronic
1133702958 16:8326141-8326163 GGGTGGAGGGGAGAGGGAGAGGG + Intergenic
1133720358 16:8488948-8488970 GGGTGGAGGAGGAAGGGAGGGGG + Intergenic
1134006570 16:10822225-10822247 GTGGGTAGGGGGAGGGGAGAGGG - Intergenic
1134112440 16:11523978-11524000 GTGGGGAGTGGGCAGATAGATGG - Intergenic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1134277346 16:12788574-12788596 GTAGTGAGGGGGAAGGGAGATGG + Intronic
1134325435 16:13203326-13203348 GTGATGGGAGGGAAGGTAGATGG + Intronic
1134405916 16:13958716-13958738 GTATGGATGGGGAAGGGAGGAGG - Intergenic
1134449442 16:14354315-14354337 GAGGGGAGGGGGAAGGGAGGAGG + Intergenic
1134449452 16:14354334-14354356 GAGGGGAGGGGGAAGGGAGGAGG + Intergenic
1134898706 16:17914713-17914735 AGGGGGAGGGGGAAGGGAGAAGG - Intergenic
1135222475 16:20624854-20624876 GTGTGGTGGGGGCAGGTGGGTGG - Intronic
1135244723 16:20845787-20845809 GAGTGGAGGTAGAAGGTAAATGG + Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136601138 16:31289605-31289627 GTGGGGTGGGGGAAGGGAGGAGG + Intronic
1136726254 16:32359897-32359919 GAGGGGAGGGGGAAGGAAGGAGG + Intergenic
1136844597 16:33565976-33565998 GAGGGGAGGGGGAAGGAAGGAGG + Intergenic
1137041552 16:35617259-35617281 GTTTGGAGATGGAAGCTAGATGG + Intergenic
1137481675 16:48856965-48856987 GTGTGCATGGGGAAGATGGAAGG + Intergenic
1137511996 16:49108899-49108921 GTGGGGAGGAGGAAGGATGATGG - Intergenic
1137577244 16:49608307-49608329 GAGGGGAGGGGGAAGGAGGAGGG + Intronic
1137628914 16:49928346-49928368 GTGTGGAGTGGGGATGTGGAGGG - Intergenic
1137745228 16:50815617-50815639 GTGTGGACGGGGAAGACAGGTGG - Intergenic
1137829064 16:51526544-51526566 GTGTGGAGGGGGCAGAAAGGGGG - Intergenic
1137881189 16:52050219-52050241 GTGGGTAGGGGGAAAATAGAGGG + Intronic
1138315010 16:56062413-56062435 GTGTCCAGGGGGAAAGTAAAGGG + Intergenic
1138731216 16:59197146-59197168 GTGGGGGGGGGGAATGGAGAGGG - Intergenic
1139624998 16:68180642-68180664 GTGGGGTGGGGGAAAGTGGAAGG - Intronic
1139754509 16:69132189-69132211 GTGTGGAGACGGAAGGCGGAGGG - Intronic
1139940961 16:70605019-70605041 GGCTGGTGGGGGAAGGGAGAAGG + Intronic
1140136135 16:72207171-72207193 GAGTGCAGGGTGAAGGGAGATGG + Intergenic
1140245290 16:73242839-73242861 GTGTGGAGGTGTGGGGTAGAGGG + Intergenic
1141230990 16:82167427-82167449 GTGGAGAGGGGAAGGGTAGATGG + Intronic
1141251648 16:82364088-82364110 GTGTGGAGTGGGAGGGTGGGGGG + Intergenic
1141560228 16:84862924-84862946 GTGGGGATGGGGATGGAAGAAGG + Intronic
1142018487 16:87765486-87765508 GGGTGGAGGGAGAAGGGAGGAGG + Intronic
1142234538 16:88915520-88915542 GTGTGGAGGGGGAGCGTGGAGGG + Intronic
1142234577 16:88915630-88915652 GTGTGGAGGAGGAGCGTGGAGGG + Intronic
1142234581 16:88915643-88915665 GCGTGGAGGGGGAGCGTGGACGG + Intronic
1142234590 16:88915670-88915692 GTGTGGAGGGGGAGCGTCGACGG + Intronic
1142234606 16:88915712-88915734 GCGTGGAGGGGGAGCGTGGAAGG + Intronic
1142337962 16:89502446-89502468 GTTGGGAGGGGGCAGGTAGCAGG - Intronic
1203000178 16_KI270728v1_random:157859-157881 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1203131779 16_KI270728v1_random:1694262-1694284 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1203154764 16_KI270728v1_random:1866274-1866296 GAGGGGAGGGGGAAGGAAGGAGG + Intergenic
1142753020 17:1999663-1999685 GTGTGGGGGGGGCATGTATAGGG - Intronic
1142785329 17:2217615-2217637 ATGTGCAGGAGGATGGTAGAGGG - Intronic
1142870189 17:2814843-2814865 GTGTTGGGGGGGAGGGTTGACGG + Intronic
1142977942 17:3656380-3656402 GGGTGGAGGGGCAGGGCAGAGGG - Intronic
1143432971 17:6900356-6900378 GTGTGGTGGTGGAAGGTGGGAGG + Intronic
1143593354 17:7899248-7899270 GTGGGGAGGGGGAAGATAAAGGG + Intronic
1143624925 17:8104220-8104242 GTGTGGGGAGGAAGGGTAGAGGG + Intronic
1143884621 17:10056733-10056755 GTGGGGAGGGAGACGGGAGAGGG - Intronic
1144084321 17:11794923-11794945 GTGGGGTGGGGGGAGGGAGAAGG + Intronic
1144534807 17:16077574-16077596 GAGGGGAGGGGGAGGGGAGAAGG + Intronic
1145867033 17:28248032-28248054 GTGTGGTGGGGGGTGGAAGAGGG + Intergenic
1145867438 17:28250190-28250212 GTGAGGTGGGGGAAGGTTGCTGG + Intergenic
1146086111 17:29831319-29831341 TTGAGGAGGGGAAAGGTAAAAGG + Intronic
1146097914 17:29950332-29950354 GTGGGGAGGAGGAAGGAAGGAGG - Intronic
1146508881 17:33428755-33428777 GTGGGTGGGAGGAAGGTAGAGGG - Intronic
1146991052 17:37272700-37272722 GTAAGGAGCGGGGAGGTAGAAGG + Intronic
1147164407 17:38585831-38585853 GTGTGATGGGGGAAGGGCGATGG + Intronic
1147263805 17:39223577-39223599 GTGTGGGGAGGGAAGGTCAAGGG - Intronic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147390321 17:40105257-40105279 GTGTGGTGGGGGGAGGGGGATGG + Intergenic
1147422387 17:40328320-40328342 GGGTGGAGTGGCAAGGTATAGGG + Intronic
1147600323 17:41741143-41741165 GTGTGGAAGGCTGAGGTAGAGGG - Intergenic
1147924693 17:43939091-43939113 GTGGAGTGGGGGAAGGTGGATGG - Intergenic
1148043271 17:44725640-44725662 GGATGGAGGCAGAAGGTAGATGG - Intronic
1148445615 17:47735153-47735175 GGGTGGAGGGGAGAGGGAGAAGG + Intronic
1148491911 17:48028710-48028732 GCGTGGAGGGTGAGGGAAGATGG + Intronic
1148582501 17:48753273-48753295 GGGTGGCGGGGGAAGCTGGAGGG + Intergenic
1148747966 17:49928964-49928986 GTGTGGAGGGGGAAGGCTGTGGG - Intergenic
1148753961 17:49962898-49962920 GTGGTGAGGGGGAAGGAAAATGG - Intergenic
1149033173 17:52106183-52106205 GTGTGGAGGGTGAAGGCAAGTGG - Intronic
1149080837 17:52655306-52655328 GTGGGGTGGGGGAAGGTGGGAGG - Intergenic
1149807281 17:59630567-59630589 GGGAGGAGGGGGATGGGAGAGGG - Intronic
1150280242 17:63925873-63925895 CTGGGGAGGGGGCAGGCAGAGGG + Intergenic
1150919593 17:69469254-69469276 AAGTGGAAGAGGAAGGTAGAGGG - Intronic
1151063842 17:71128179-71128201 GTGGGGTGGGGGAGGGGAGAGGG + Intergenic
1151247252 17:72804394-72804416 GTGGGGAGTGGGAGGGAAGAGGG - Intronic
1151288993 17:73134942-73134964 GTGTGGAAGGGGAAGATGGCTGG + Intergenic
1151327666 17:73388937-73388959 GAGGGGAGGGGGAAGGGAAAGGG - Intronic
1151520977 17:74629318-74629340 GTGGGGAGGGGGAGGGGGGAGGG + Intergenic
1151529475 17:74695372-74695394 GAGTGAAGGGGGAAGCTGGAGGG - Intronic
1151786349 17:76276894-76276916 GGGTGGAGCGAGAAGGTGGAGGG + Intronic
1151849980 17:76684495-76684517 GTGTGGAGGGAAAAGGTGGCGGG + Intronic
1152266272 17:79296824-79296846 GGGAGGAGGGGGGAGGAAGAAGG - Intronic
1152364104 17:79845091-79845113 GTGGGGAGGGGGAAGGGACGGGG - Intergenic
1152409678 17:80117158-80117180 GGGTGGAGGGGGCAGGTGGGAGG - Intergenic
1152650545 17:81490521-81490543 ATGTGGAGGGGGTAGGCAGAGGG - Intergenic
1152784098 17:82239118-82239140 GTTTTGAGGGGGAAGGTGGCGGG + Exonic
1153852122 18:9104702-9104724 GGGTGGAAGGGGGAGGGAGAAGG - Intronic
1153946359 18:10021564-10021586 GTGGGTAGGTGGGAGGTAGATGG - Intergenic
1153963341 18:10158761-10158783 GTGTAGAGGGGGAAAGAAAAAGG - Intergenic
1154128629 18:11716470-11716492 GTGTGGAAGGGGACGGGAGCAGG + Intronic
1154338079 18:13481897-13481919 GGCAGGAGGGGGAAGGCAGAAGG + Intronic
1154388793 18:13918884-13918906 GTGTGGAGGGGGAGTGCATAGGG + Intergenic
1154388802 18:13918926-13918948 GTGTGGAGGGGGAGTGGATAGGG + Intergenic
1155075578 18:22351195-22351217 GTGTGTTGGGGGAAGGGAGATGG + Intergenic
1155401564 18:25445557-25445579 GTGTGGAGCAGGAAGGCAGAGGG + Intergenic
1155615980 18:27722142-27722164 GTGTGGGGGTGTAAGGTACAAGG - Intergenic
1155756841 18:29509145-29509167 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1156043904 18:32856795-32856817 GTGGGGAGGGGGAAGGGGGGAGG - Intergenic
1156111418 18:33731843-33731865 GTGAGGAGGAGGAAGGGGGAAGG - Intronic
1156490334 18:37492196-37492218 GTGGGGAATGGGAAGGTAGCAGG + Intronic
1156897737 18:42265808-42265830 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1157142460 18:45123399-45123421 GTGTGGCGGGGGCAGGGGGATGG + Intergenic
1157220489 18:45825638-45825660 GCGTGGTGGGGGAAGGAAGGCGG - Exonic
1157311142 18:46554168-46554190 GTGGGGATGGTGAAGATAGAAGG + Intronic
1157421934 18:47554989-47555011 GTGTGGAAGGTGAGGGAAGAGGG - Intergenic
1157470265 18:47983124-47983146 GGGAGGAGGGGGAAGGCAAAAGG - Intergenic
1157575101 18:48738444-48738466 GTGTGAAGGGGGAGGGCAGATGG - Intronic
1157762632 18:50275648-50275670 GCGGGGAGGGCGAAGGCAGATGG + Exonic
1158038804 18:53068404-53068426 GTGGGGTGGGGGGAGGGAGAGGG - Intronic
1158793925 18:60818416-60818438 GTGGGGTGGGGGGAGGGAGAAGG - Intergenic
1158812072 18:61049495-61049517 GTGTGAAGGGCGAAAGTACAAGG + Intergenic
1158907676 18:62029665-62029687 GTGGGGAGGCGGAGGGGAGAAGG + Intergenic
1159128049 18:64247736-64247758 GTGTGGTAAGGGAAGGTAGATGG - Intergenic
1160122495 18:76143354-76143376 GAGTGGAGGGAGACGGCAGATGG + Intergenic
1160237663 18:77098918-77098940 GGAGGGAGGGGGAAGGAAGAGGG - Intronic
1160248221 18:77178047-77178069 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
1160392675 18:78546958-78546980 GGGTGGAGGGGGGAGGAAGGGGG + Intergenic
1160719654 19:591594-591616 GTGTGGAGGGTGCAGGTGGAGGG + Intronic
1160872128 19:1282365-1282387 GTATGAAGGGGGAAGGAAGGAGG + Intergenic
1161043330 19:2121594-2121616 GTGTGGTGGGGCAGGGCAGAGGG - Intronic
1161104920 19:2438555-2438577 GTGGGGAGGGGCAAGGTCCATGG + Intronic
1161507239 19:4650511-4650533 GGGTGGAGGGGGAAGCTCCAGGG + Intronic
1161756429 19:6137460-6137482 GTGAGGAGGGGGAGGGAGGAAGG + Intronic
1161821539 19:6533551-6533573 CTCTGGAGGGGGAAGGAAGGGGG - Intronic
1162237375 19:9319803-9319825 GTGTGGTGGGGGGAGGGGGAGGG + Intergenic
1162377158 19:10311366-10311388 GTGTGGTGGGGGAAGGAATCAGG + Intronic
1163728278 19:18934749-18934771 TGGTGGAGGGGTAAGGTGGAAGG - Intronic
1163941280 19:20496445-20496467 GTGGGGTGGGGGAAGGGAGGAGG + Intergenic
1164431824 19:28195542-28195564 GTGGGGAGGGAGAAGGCAGAAGG + Intergenic
1164896026 19:31878505-31878527 GTGTGGTGGGGGGAGGCTGAAGG - Intergenic
1165310094 19:35024517-35024539 GTGTCGAGGGGGAAAGCGGATGG + Intronic
1165478452 19:36046501-36046523 AGGTGGAGGGGGCAGGTAGCTGG + Intronic
1165707819 19:37988876-37988898 GTGTGGAGTGGGAGGGAGGACGG - Intronic
1165854621 19:38871871-38871893 CTGTGGTGGGGGGAGGAAGAAGG + Intronic
1166116943 19:40662232-40662254 GTGGGGAGGGGACAGGCAGAGGG + Intergenic
1166139740 19:40799489-40799511 GAGTGGAGGGGGAGGGGAGGGGG + Intronic
1166151760 19:40880251-40880273 GTGTGGAGGGAGAAGGGGGTTGG + Intronic
1166228371 19:41411250-41411272 GTGGGGAGAGGGCAGGGAGAAGG + Intronic
1166529232 19:43532807-43532829 CTTCCGAGGGGGAAGGTAGATGG + Intronic
1166670356 19:44706179-44706201 GTGGGGTGGGGGCGGGTAGAGGG - Intronic
1166870600 19:45868038-45868060 GTGGGGAGGGAGATGGGAGAGGG + Intronic
1166929049 19:46290191-46290213 GTGGGGAAGGGGTAGGGAGAGGG - Intergenic
1167421103 19:49403855-49403877 GTGTGGAGGGGGAAGGTAGAGGG - Intronic
1167444563 19:49529700-49529722 GTGTGGAGGGGAGAGGTTGTTGG + Intronic
1167508240 19:49882339-49882361 GGGTGGCGGGGGAAGGTCGGAGG - Exonic
1168098918 19:54130660-54130682 GGGAGGAGGTGGAAGGTAGGAGG + Intronic
1168122632 19:54260748-54260770 GTGTGCTTGGGGAAGGGAGAAGG - Intronic
1168296659 19:55380329-55380351 GAGGGGAGGGGGAAGGGGGAAGG - Intronic
1168302680 19:55415309-55415331 GTGTGGATGTGGAGGGTAGGAGG - Intergenic
1168474957 19:56668899-56668921 GTGTGTAGGGGGAGGGCAGGTGG + Intronic
1202697518 1_KI270712v1_random:135813-135835 GTGGGAAGGGGGAAGGGAGGGGG - Intergenic
925306138 2:2849264-2849286 CTGTGGAGGGGGCAGGCAGATGG - Intergenic
926023104 2:9514363-9514385 GGGGGGAGGGGGAAGGGGGAAGG + Intronic
926124508 2:10263916-10263938 GGGGGGAGGGGGAAGGGGGAAGG + Intergenic
926297654 2:11580266-11580288 GTCTTGAGAGAGAAGGTAGAAGG + Intronic
926406799 2:12561850-12561872 GTGTAGAGAGGGAAGGTGGAGGG + Intergenic
926414565 2:12636451-12636473 GGGTGGAGGAGGGAGATAGATGG - Intergenic
926453363 2:13034985-13035007 TTGTGGAGTAGGAAGGAAGATGG + Intergenic
926703928 2:15823012-15823034 GAGTGGAAGGTGAAGGTTGAGGG + Intergenic
926766462 2:16326463-16326485 GTGGGAAGGGCGAAGGAAGAGGG - Intergenic
927039126 2:19210416-19210438 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
927207038 2:20617308-20617330 GTGTGAAGGGGGAAGGCAAATGG + Intronic
927320452 2:21738329-21738351 GTGGGGAGTGGGAAGGTTGATGG + Intergenic
927321723 2:21755106-21755128 TTGTGAAGTGGTAAGGTAGAAGG + Intergenic
927333744 2:21896343-21896365 CTGGGGAGGGGGAAGGTTGGGGG + Intergenic
927466138 2:23338101-23338123 GTGTGGAGAGGGAGAGTGGATGG + Intergenic
927466898 2:23343585-23343607 GTGTCGCGAGGGAAGGTATAGGG - Intergenic
927467803 2:23350349-23350371 GTGGGGAGGCGGGAGGCAGAAGG - Intergenic
928363574 2:30684954-30684976 GTGGGGAGGGGGAAGGGAGGAGG + Intergenic
928460749 2:31470204-31470226 TTGTGGAGGTGGAAGACAGACGG - Intergenic
929510452 2:42562406-42562428 GTGGGGAGGGGGAGGGAAGATGG - Intronic
929942080 2:46341967-46341989 GTGTGGTGGGGGGAGGCAGATGG - Intronic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
930083994 2:47480030-47480052 GGGAGAAGGGGGAAGGGAGAAGG - Intronic
930088285 2:47513910-47513932 GAGTGGAGGAGGAAAGCAGATGG - Intronic
930167107 2:48213826-48213848 GGCTGGAGGGGGAAGACAGATGG + Intergenic
930526508 2:52536881-52536903 GTGGGGTGGGGGAAGGTGGGAGG + Intergenic
930835401 2:55788259-55788281 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
930838488 2:55819985-55820007 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
931054160 2:58449992-58450014 CTGGGGAGGGGAAAGGTAGTAGG - Intergenic
931694920 2:64864610-64864632 GTGTGTCGGGGGAGGGTATAAGG - Intergenic
932049937 2:68388305-68388327 GAGGGGAGGGGGAATGGAGATGG + Intronic
932231787 2:70089249-70089271 GTTTGGAGGGAGGAGGGAGAAGG + Intergenic
932566957 2:72916613-72916635 GGGTGGAAGGTGAAGGTCGAGGG + Intronic
932585087 2:73022618-73022640 GTAGGGAGGGGGAAGGGGGAAGG + Intronic
932744911 2:74325923-74325945 GAGGGGAGGAGGAAGGGAGAAGG + Intronic
932841601 2:75088310-75088332 GCGTGGAGAGGGAAGGAAGGAGG - Intronic
933780341 2:85796600-85796622 GTGCTGAGGGGGAAGGCAGACGG - Intergenic
934046830 2:88179282-88179304 GTGTGGAGAGGCAAGGTCAAGGG + Intronic
934319622 2:91960653-91960675 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
934701706 2:96446847-96446869 TTGGGGTGGGGGAAGGGAGAAGG + Intergenic
934713409 2:96529775-96529797 GCGTGGAGGCTGAAGGCAGAGGG - Intergenic
934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG + Intronic
935063291 2:99626539-99626561 GAGGGGAGGGAGAAGGGAGAAGG - Intronic
935386897 2:102509306-102509328 GTGTGGAAGAGGGAGGCAGAAGG - Intronic
935981660 2:108634194-108634216 GTCTGTAGGGGGAGGGAAGAAGG + Intronic
936159743 2:110075784-110075806 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
936184922 2:110295569-110295591 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
936272221 2:111057591-111057613 ATTAGGAGGGGGAAGGCAGAGGG + Intronic
936690861 2:114886904-114886926 GGGTGGAGTGGGAAGGCAGGTGG - Intronic
936927475 2:117751971-117751993 GTGGGGAGGGGGGAGGGGGAAGG + Intergenic
937214465 2:120302833-120302855 GTGGGGAGCGGCAAGGCAGACGG - Intergenic
937985027 2:127634573-127634595 CTGGGGAAGGGGAAGGTACAGGG - Intronic
938043423 2:128095407-128095429 GAGGGGAAGGGGAAGGTAAAGGG - Intronic
938537905 2:132260024-132260046 GTGGGGTGGGGGAAGGTGGGAGG - Intergenic
938600246 2:132830307-132830329 ATGTGGAGGGGGATGGGAGGGGG + Intronic
939617405 2:144376843-144376865 TTTTGTAGGGGGAAGGGAGAAGG + Intergenic
939811111 2:146833299-146833321 GTGGGGTGGGGGGAGGGAGAGGG + Intergenic
940384611 2:153056040-153056062 GGATGGAGTGGGAAGGGAGAAGG + Intergenic
940450968 2:153836649-153836671 GTGGGGAGGGGGGAGGGGGAGGG - Intergenic
940616873 2:156059789-156059811 GTGGGGAGGAGGAAGGAACAAGG + Intergenic
941393943 2:164951518-164951540 GGGTGGAGGTGGTAGGAAGAAGG + Intronic
941830022 2:169945822-169945844 ATATGGAGGAGAAAGGTAGAAGG - Intronic
943549861 2:189325166-189325188 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
943946162 2:194068595-194068617 GTGTGGTGGGGGACGGGAGGAGG - Intergenic
944107523 2:196095148-196095170 GTGGGGTGGGGGAAGGGAGTAGG + Intergenic
945102694 2:206275707-206275729 GTGGGGAGGGGGAGGGACGATGG + Intronic
945874094 2:215258956-215258978 GTGTGGTGGGGGCAGGGGGAAGG + Intergenic
946010503 2:216560166-216560188 GAGGGGAGGGGGAAGGGAGAAGG - Intronic
946283422 2:218683726-218683748 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
946292592 2:218756343-218756365 GCATGGTGGGGGAAGGGAGAAGG + Intergenic
946522303 2:220479714-220479736 CTGTGGAGAGGTAAGGAAGAAGG - Intergenic
946955904 2:224929775-224929797 GAGTGGAGGATGCAGGTAGATGG - Intronic
947204713 2:227649848-227649870 GTGAGGTGGGTGAATGTAGATGG + Intergenic
947529398 2:230899207-230899229 GGGTGAAGGGGAAAGGGAGAGGG - Intergenic
947732186 2:232437406-232437428 GTGTGGAAGGGGAGGGGAGCTGG + Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948218749 2:236252687-236252709 ATGTGGAGGGGTCAGGCAGAGGG + Intronic
948670487 2:239565366-239565388 GTGTGAAGGAGGCATGTAGAAGG + Intergenic
948720838 2:239899082-239899104 GTGTGGAGGGGTGTGGTGGAGGG + Intronic
948720875 2:239899209-239899231 GTGTGGAGGGGTGTGGTGGAGGG + Intronic
948745889 2:240093757-240093779 GGGGGGAGGGGGGAGGTAAAGGG + Intergenic
949032255 2:241802657-241802679 GGGAGGAGGGGAAAGGAAGAGGG + Intronic
1168797705 20:622538-622560 GTGTGGCTGGAGAAGGGAGAGGG - Intergenic
1168913711 20:1469516-1469538 GACTGGAGTGGGAAGGAAGATGG - Intronic
1169192971 20:3669503-3669525 AGGTGGAGAGGGAAGGGAGAAGG - Intronic
1169217983 20:3804374-3804396 GTGGGGAGGCGGAAGGAAGGAGG - Intronic
1170134823 20:13061383-13061405 TGGTGGAGGGGGCAGGTGGATGG - Intronic
1170441355 20:16382739-16382761 GTGGGGTGGGGGGAGGTAGCTGG - Intronic
1170633333 20:18083606-18083628 GTGTGGAAGGGAAAGGAAGGTGG + Intergenic
1170837258 20:19895045-19895067 GTGGGGAGGGGTAAGGGATAGGG - Intronic
1171293697 20:23998072-23998094 AAGTGGAGAGGGAAGGGAGAAGG - Intergenic
1172101166 20:32484403-32484425 GTGCGGATGGGGAAGGGGGAGGG - Intronic
1172107084 20:32523206-32523228 GGGTGGAAGGGGAGGATAGAAGG + Intronic
1172324284 20:34022433-34022455 TTATGGAGGGGAAAGGTATAGGG - Intronic
1172337120 20:34126310-34126332 GTGAGGAGGGGGCAGGGAAAGGG + Intergenic
1172608217 20:36230067-36230089 GTGGGGTGGGGGAAGGGGGAAGG - Exonic
1172698123 20:36836059-36836081 GGGTGGTGGGGGAAGGCAGTAGG - Intronic
1172841773 20:37906248-37906270 GAGTGGAGGTGGGAGGGAGATGG - Intronic
1173168588 20:40704108-40704130 GGGTGGAGGGGAAGGGAAGAAGG + Intergenic
1173371136 20:42437048-42437070 GAGTGGAGGGGTCAGGAAGATGG + Intronic
1173380967 20:42540856-42540878 GGGAGGATGGGGAAGGTAGGTGG + Intronic
1173381951 20:42553369-42553391 GAGTGGAAGGGGGAGATAGAAGG - Intronic
1173427907 20:42958457-42958479 GGGGGGAGGGGGAGGGGAGAAGG + Intronic
1174127243 20:48315611-48315633 GTGTGGGGTGGGGAGGTGGAGGG + Intergenic
1174484226 20:50851344-50851366 GTGGGGAGGGGGCTGGTAGGTGG - Intronic
1174896065 20:54451504-54451526 GCGTGGAGAAGGAAGGGAGAAGG - Intergenic
1175281203 20:57805170-57805192 GTGGGGAGGGGGCAGGTTTAGGG - Intergenic
1175424836 20:58856783-58856805 AGGAGGAGGGGGAAGGTAGAAGG - Intronic
1175427885 20:58881475-58881497 GTCTGGAGAGGGAAGGAAGAAGG - Intronic
1175625217 20:60484003-60484025 GTGGGGAGGGGGAGGGGAGGGGG - Intergenic
1176028575 20:62999068-62999090 GTGGGGAGGGGAAGGGGAGAGGG + Intergenic
1176057130 20:63154810-63154832 GGGAGGAGGAGGAAGGGAGAGGG - Intergenic
1176125522 20:63472965-63472987 GAGTGGAGGGGGAGGGGAGGGGG + Intergenic
1177143420 21:17381904-17381926 GTGGGGAGGGGGGAGGGGGAGGG + Intergenic
1178319866 21:31597207-31597229 GAGGGGAAGGGGAAGGGAGAAGG - Intergenic
1178359378 21:31935314-31935336 GTGAGTAGGGGGAAGGTATGCGG - Intronic
1179438277 21:41376726-41376748 GTGTGTAGGGGGTAGGTTGTAGG + Intronic
1180307873 22:11144698-11144720 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1180313488 22:11256665-11256687 GTGGGGTGGGGGAAGGTAGGAGG - Intergenic
1180546349 22:16506511-16506533 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1181037382 22:20176426-20176448 ATGTGGAGGGAGAAGGAAGAAGG - Intergenic
1181037559 22:20177260-20177282 GTGCGGAGGGGGAATCTAGGGGG - Intergenic
1182116275 22:27758254-27758276 GTGTGGAGGTGGAAGGATCAGGG - Intronic
1182212844 22:28690868-28690890 GAGGGGAGGGGGAAGGAAGGAGG + Intronic
1182297143 22:29316275-29316297 GTGGGCAGGAGGAAGGTAGGAGG - Intronic
1182351675 22:29703278-29703300 GTGAGGAGGGGGAAGGATGAAGG - Intergenic
1182657161 22:31899897-31899919 GAGTGGAGGGGGAAGGGTGGAGG - Intronic
1183153165 22:36053761-36053783 GAGGGAAGGGGGAAGGGAGAAGG - Intergenic
1183153178 22:36053792-36053814 GAGGGAAGGGGGAAGGGAGAAGG - Intergenic
1183343667 22:37295351-37295373 GTGTGGTGGGGGAGGGGAGGAGG - Intronic
1183350677 22:37333057-37333079 GTGTGCAGGGAGAAGGTCGGGGG - Intergenic
1183390306 22:37541952-37541974 GTGGGGAGGAGGAAAGCAGAGGG - Intergenic
1183400943 22:37604027-37604049 GTGTGCAGGGGACAGGGAGAAGG - Intergenic
1183422442 22:37719806-37719828 GTGTGCAGGGAGAAGACAGAAGG - Intronic
1183868225 22:40721140-40721162 GTGGGGTGGGGGAAGGATGAGGG - Intergenic
1184043576 22:41958429-41958451 GTGTGGTGGGGGTATGCAGAGGG + Intergenic
1184307250 22:43613612-43613634 GGGTGGAGGGGGAAAGGAGGGGG + Intronic
1184729814 22:46366055-46366077 AGGTGGAGGGGGAAGGTGGAGGG + Intronic
1184878279 22:47289176-47289198 GGGTGGTGAGGGAAGGTAGGGGG + Intergenic
1185189197 22:49423396-49423418 GTGTGTTGGGTGAAGGCAGAGGG + Intronic
1185189206 22:49423448-49423470 GTGTGTTGGGTGAAGGCAGAGGG + Intronic
1185229808 22:49673554-49673576 GTGGGGAGGGGGAAGGGGAAGGG + Intergenic
1185373226 22:50470356-50470378 GTGGAGAGGGTCAAGGTAGATGG - Intronic
1185411175 22:50683795-50683817 TGGTGGAGGGGGATGGTGGAGGG + Intergenic
949462646 3:4309614-4309636 GTGTGAAGGGGGAAGGTGGTGGG - Intronic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949507872 3:4743732-4743754 TTGTTGAGGGGGAAGGGGGAGGG + Intronic
949980447 3:9499315-9499337 GTGTGGATGGGGCAGGTGGCAGG - Exonic
950052431 3:10002799-10002821 GCGTGGAGGGGGAAGACACAGGG - Intronic
951063822 3:18240900-18240922 GTGTGGAGGAGGAAAGGACAGGG - Intronic
951160094 3:19408291-19408313 GGGTGGAAGGGGAAGGTAAAGGG + Intronic
951170450 3:19535771-19535793 TTGGAGAGGGGGAAAGTAGAAGG - Intergenic
951719090 3:25679517-25679539 GTGAGGAGGGGAAAGGGGGAGGG + Intergenic
952569238 3:34694478-34694500 GAGGGGAGGGGGAAGGGAGAAGG - Intergenic
952647616 3:35680760-35680782 GGGAGGAGGAGGAAGGAAGAGGG - Intronic
952986500 3:38789793-38789815 GGGTGGAAGGGGAAAATAGAAGG + Intronic
953188438 3:40660665-40660687 GTGAGGAGGGAGAAAGAAGAAGG + Intergenic
953219262 3:40954010-40954032 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
953256503 3:41296201-41296223 GTGTGGAGGCAGAAAGTATATGG + Intronic
953405137 3:42656202-42656224 GGGAGGAGGGAGCAGGTAGAGGG + Intronic
954100130 3:48365750-48365772 AAGAGGAGGGGGAAGGGAGAAGG + Intergenic
954411883 3:50374391-50374413 GAGGGGAGGGGGAAGGTAAGGGG + Intronic
954619242 3:51986268-51986290 GTGAGGAGGCTGAAGGTGGAGGG + Exonic
954935751 3:54325003-54325025 GAGGGGAGGGAGAAGGCAGAAGG + Intronic
955058277 3:55474789-55474811 GTAGGGAGGGGGGAGGTAGGAGG + Intronic
955131329 3:56171933-56171955 GTGTGGAGGTGGATGGAAGGGGG + Intronic
955162638 3:56479791-56479813 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
955219432 3:57011556-57011578 GGGTGGCGGGGGAAGGTGGGGGG - Intronic
955750752 3:62183811-62183833 GTGGGGATGGGGAAGGATGAAGG + Intronic
956026885 3:64992673-64992695 GTGGGGTGGGGGAAGGTGAAGGG + Intergenic
956082001 3:65567299-65567321 GTGTGGAGGGAGCAGGAAGCAGG - Intronic
956861299 3:73326656-73326678 CTGGGGAGGGGGATGGCAGAGGG - Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957657811 3:83104156-83104178 GTGTGGTGGGGATCGGTAGATGG - Intergenic
957762971 3:84583683-84583705 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
957802510 3:85103843-85103865 GTGTGGCGGAGGAATGTAGTGGG + Intronic
957894447 3:86403309-86403331 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
957980582 3:87504654-87504676 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
958044662 3:88268726-88268748 GTGAGGAGTGGGATGGCAGAGGG + Intergenic
958111286 3:89149625-89149647 GTGGGGAGGGGGGAGGGGGAGGG - Intronic
959017959 3:101157353-101157375 GTGGCTAGGGGGAAGGGAGATGG + Intergenic
959743513 3:109748896-109748918 AAGTGGAGAGGGAAAGTAGAAGG - Intergenic
959839742 3:110960388-110960410 GTGTGGAGGGGGGTGGTGGTTGG - Intergenic
960084017 3:113571469-113571491 GTGTGCAGAGGATAGGTAGATGG - Intronic
960213900 3:115006282-115006304 CTATGGAGGGGGAATGGAGAGGG - Intronic
960662912 3:120080301-120080323 GGGAGGAGGGGGAGGGAAGAAGG + Intronic
960690699 3:120343051-120343073 AAGTGGACAGGGAAGGTAGACGG + Intronic
960744153 3:120867788-120867810 GTGGGGTGGGGGCAGGGAGAGGG + Intergenic
960863023 3:122171123-122171145 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
961345286 3:126260116-126260138 ATGTGGAGAGGGAAGGGGGAGGG - Intergenic
961384417 3:126516055-126516077 GTGAGGAGGGGGTGGGTAGGTGG - Intronic
961384452 3:126516149-126516171 GTGAGGAGGGGGTGGGTAGGTGG - Intronic
961384525 3:126516342-126516364 GGGACGAGGGGGAAGGTAGGTGG - Intronic
961384560 3:126516440-126516462 GTGATGAGGGGGAGGGTAGGTGG - Intronic
961810845 3:129520928-129520950 GTGGGGCTGGGGAAGGTGGATGG - Intergenic
961936476 3:130590452-130590474 GTGGGGTGGGGGGAGGGAGAGGG - Intronic
962522154 3:136207267-136207289 GCTTGGAGGGGGAAGGGAGGTGG - Intergenic
962991109 3:140578211-140578233 GTGGGGAGAGGGCAGGAAGATGG - Intergenic
963706063 3:148689907-148689929 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
963890649 3:150632584-150632606 ATGAGGAGGGGAAAGGAAGAAGG + Intergenic
965094740 3:164210649-164210671 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
965135664 3:164764224-164764246 GTGGGGTGGGGGAAGGGAGGAGG - Intergenic
965772245 3:172193263-172193285 AGGGGGAGGGGGAAGGTAGAGGG - Intronic
965772259 3:172193291-172193313 GAGGGGAGGGGGATGGGAGAGGG - Intronic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
965895146 3:173566627-173566649 GTTTGCAGGGTGAGGGTAGAGGG - Intronic
966279994 3:178215005-178215027 GTGGGGAGGGGGAAGGAAGGAGG - Intergenic
968052221 3:195662975-195662997 GGGTGGGTGGGGAGGGTAGATGG - Intergenic
968103589 3:195985363-195985385 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968229190 3:196994629-196994651 GTGTAGGGGCGGGAGGTAGATGG - Intronic
968276218 3:197442306-197442328 GTGGGGAGGGAGAAGGCAGATGG + Intergenic
968301891 3:197622956-197622978 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968647873 4:1749164-1749186 GTGGGGAGGGGGCAGGGGGAGGG - Intergenic
969390247 4:6887377-6887399 GGCTGGAGGGGGAAGGGGGAGGG + Intergenic
970137826 4:12945433-12945455 GGGTGGATGGGTAAGGGAGAAGG - Intergenic
971443388 4:26715284-26715306 ATGTGGAAGTTGAAGGTAGAAGG - Intronic
971904661 4:32710952-32710974 GTGTGGAGGCAGTAGGTATATGG - Intergenic
972073550 4:35054951-35054973 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
973661914 4:53116819-53116841 GTTTTGAGGGAGATGGTAGAAGG + Intronic
973663262 4:53130575-53130597 GTGTAGAGGGAGAGGGGAGATGG - Intronic
974308238 4:60170474-60170496 GTGTGGAGGGAGAGGGTATATGG - Intergenic
974321170 4:60352514-60352536 ATGGGGTGGGGGAAGGAAGAAGG - Intergenic
974447909 4:62010304-62010326 GTGTTGAGGGGGAAGGTGTGTGG - Intronic
975249650 4:72163917-72163939 GTGGGGTGGGGGATGGGAGAGGG - Intergenic
975281472 4:72568044-72568066 GTGCAGAGGGGGAGGGGAGAAGG + Intronic
975320156 4:73000955-73000977 GTGGGGAGGAGGAAGTTACAGGG + Intergenic
975442029 4:74421808-74421830 GAGGGGAAGGGGAAGGAAGATGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
977140199 4:93361983-93362005 GTGGGGTGGGGGAAGGGGGAAGG - Intronic
977891304 4:102314528-102314550 GAGTTGGTGGGGAAGGTAGAAGG - Intronic
977986759 4:103391378-103391400 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
978943042 4:114460436-114460458 GGGTGGAGGTCAAAGGTAGAAGG - Intergenic
979473824 4:121131628-121131650 GTGTGGAGTGGGTGGGTAGGGGG + Intronic
979751712 4:124287596-124287618 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
979802301 4:124926120-124926142 GTATGGAGGGAGATGATAGAAGG + Intergenic
980000883 4:127486357-127486379 GAATGCAAGGGGAAGGTAGAGGG + Intergenic
980081033 4:128344347-128344369 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
980238668 4:130143214-130143236 GTGTGGAGGGGGGTGGTCGGGGG + Intergenic
980297987 4:130947540-130947562 GAGTGGTGGGGAAAGGTAGAGGG - Intergenic
980884996 4:138752637-138752659 GGGTGGAGGAGGAAGGAAGGGGG - Intergenic
981221258 4:142238699-142238721 GGGTGGAGGGGAAAGGAACAAGG + Intronic
981990010 4:150907223-150907245 GGGGGGAGGGGGGAGGGAGAGGG + Intronic
982040234 4:151390165-151390187 GTGGGAAGGGGGGAGGGAGAGGG - Intergenic
982311293 4:153988062-153988084 GTGAAGAGGGTGAAGGTAGGAGG - Intergenic
982710688 4:158755949-158755971 GAGAGGAGGGGGAGGGAAGAGGG - Intergenic
982868459 4:160546694-160546716 GAGAGGAGGAGGAAGGCAGATGG - Intergenic
982900753 4:161000024-161000046 GTGGGGTGGGGGGAGGGAGAAGG - Intergenic
983143344 4:164181163-164181185 TTGTGGAGGGAGAAGGTTGGTGG - Intronic
983272917 4:165584161-165584183 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
983690991 4:170469018-170469040 TTGTGGAGGAGGAAGATAGATGG - Intergenic
983707196 4:170676080-170676102 AAGTGGAGGGGGAAGGAATAAGG - Intergenic
983905169 4:173174145-173174167 GTGTGGGGGGAGAAGGGGGATGG - Intronic
983968852 4:173846394-173846416 ATGTGGAGGGTGGGGGTAGAAGG + Intergenic
984070347 4:175103418-175103440 GGGAGGAGGGAGAAGGGAGAGGG + Intergenic
984070368 4:175103471-175103493 GGGAGGAGGGAGAAGGGAGAGGG + Intergenic
984189127 4:176583664-176583686 GTGTGTATGGGGAAGAGAGAAGG + Intergenic
984602291 4:181742818-181742840 GTGGGGAGGGGGGAGGGAGGAGG - Intergenic
984751167 4:183277122-183277144 GTGGGGAGGGGGGAGGGAGGAGG - Intronic
984760317 4:183357531-183357553 GTCTGGAGGAGCAAGGTGGACGG + Intergenic
984911444 4:184676942-184676964 GGGGGAAGGGGGAAGGGAGAAGG - Intronic
985096180 4:186415234-186415256 GAGAGGAGGGGGAAGAGAGACGG - Intergenic
985135664 4:186783604-186783626 TGGTGGAGGAGGAAGGTAAAAGG - Intergenic
985165331 4:187088254-187088276 GTGTGGAGGGTGAATGCTGATGG + Intergenic
985200152 4:187476274-187476296 GTGTGGTGGTGGCAGGGAGATGG - Intergenic
985661721 5:1160611-1160633 GGGTGGAGGGGGAAGAGAGCAGG - Intergenic
985871399 5:2560160-2560182 GTGGGGAGGGGGCAGGAAGGTGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986179704 5:5382304-5382326 GTGTTGGGGGAGAAGGGAGAGGG + Intergenic
987403974 5:17506602-17506624 CTGTGGAGGTGGAAGTTAAAGGG - Intergenic
987411445 5:17619350-17619372 CTGTGGAGGTGGAAGTTAAAGGG - Intergenic
987524559 5:19030774-19030796 GTGAGGAGGAAGAAGGGAGAAGG - Intergenic
988836894 5:35042174-35042196 GGCTGGAGGGGGAAGGGAGTTGG + Intronic
988942979 5:36164540-36164562 ATGTGGAGGGAGAAGCCAGACGG - Intronic
989745490 5:44824649-44824671 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
990186640 5:53217095-53217117 GTGTGGAGAGGGCAGATTGAAGG + Intergenic
990446183 5:55896578-55896600 GAGGGGAGGGGGAAGGTGGGGGG - Intronic
990689170 5:58343469-58343491 GTGTGGAGAGAGTAGGAAGAGGG + Intergenic
991144398 5:63283832-63283854 GTGGGGACGGGGAGGGTGGAGGG + Intergenic
991350179 5:65713254-65713276 GTGAGGGGGAGGAAGGAAGAAGG - Intronic
991609965 5:68439922-68439944 GAATTGAGGGGGAAGGAAGAAGG + Intergenic
992628524 5:78657866-78657888 GGGTGGGGGTGGGAGGTAGAGGG + Intronic
992652412 5:78872665-78872687 GTGGGGAGGGGGAGGGGGGAGGG + Intronic
993467778 5:88269141-88269163 GTGGGGAGCGGGAGGGGAGAGGG + Intronic
993663042 5:90662753-90662775 GTGTGGTGGGGGGAGGGGGAAGG - Intronic
993730818 5:91420519-91420541 GTGGGGTGGGGGAAGGTGGGAGG + Intergenic
994022633 5:95045071-95045093 GTAGTGAGGGGGAAGGTAGCTGG - Intronic
994227068 5:97265188-97265210 ATGTGGAAGGGCAAGGTATAGGG + Intergenic
994479679 5:100317896-100317918 GTGGGGTGGGGGAAGGGAGGAGG + Intergenic
994901036 5:105769495-105769517 GTGGGGCGGGGGAGGGGAGAGGG + Intergenic
995054606 5:107745407-107745429 GTGCAGATAGGGAAGGTAGAAGG - Intergenic
995202462 5:109441757-109441779 GTGGGGTGGGGGGAGGTGGAGGG - Intergenic
995568824 5:113458139-113458161 GTGTGGAAGGGGACCGTAGTGGG - Intronic
996012450 5:118495882-118495904 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
996256273 5:121408039-121408061 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
996788284 5:127265059-127265081 GTGGTGAGGGGGAAGGGAGGAGG - Intergenic
997138245 5:131349339-131349361 GTGGGGTGGGGGGAGGGAGAAGG + Intronic
997229094 5:132229764-132229786 GTGTGGAGGGGGAAGATGTAGGG - Intronic
997564655 5:134877559-134877581 GTTGGGATGGGGAAAGTAGATGG + Intronic
997572722 5:134944239-134944261 GTGAGGAGGGTGAAGGTATTTGG + Intronic
997813777 5:136996873-136996895 GTGTGGAAGGGGAACCGAGAGGG - Intronic
997834312 5:137179904-137179926 GTGTGCAGTGGCAAGGTAGGAGG - Intronic
997876265 5:137550371-137550393 GTGGGGTGGGGGAAGGAGGAGGG + Intronic
998400368 5:141845707-141845729 GTGTGAAGGGGGAGGGTGGGTGG - Intergenic
998628579 5:143873672-143873694 GGGTGGTTGGGGAAGGTAGTTGG - Intergenic
999303891 5:150507713-150507735 GTCTGGAGGGGGAAGGGCCAGGG + Intronic
999418919 5:151423879-151423901 GTGTGTAGGGAGAGGGTATATGG + Intergenic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999519107 5:152332132-152332154 GTGTGGAGGGGGCAGGGACATGG + Intergenic
1000070928 5:157740508-157740530 CTCTGAAGGGGGAAGGTAGTGGG + Exonic
1000648670 5:163787737-163787759 ATGTGGAAGAGGAAGGCAGAAGG - Intergenic
1000829394 5:166084299-166084321 GTGTGAAGGAGAAAGGAAGAAGG - Intergenic
1000865978 5:166515235-166515257 ATGGGGAGGTGGGAGGTAGAAGG - Intergenic
1001293890 5:170485426-170485448 GTGTGGACGGGGAGGGTGGCTGG + Intronic
1001350977 5:170964539-170964561 GTGGGGTGGGGGGAGGTGGAAGG - Intronic
1001403672 5:171461211-171461233 GTGGGGAGGGGGAGGGCAGTGGG + Intergenic
1001403681 5:171461229-171461251 GTGGGGAGGGGGAGGGCAGTGGG + Intergenic
1001440683 5:171740467-171740489 GGGAGGATGGGGAAGGTAGGCGG - Intergenic
1001742820 5:174067946-174067968 GTGGGGAGGGGGAAGACAGGTGG + Intronic
1001771701 5:174301813-174301835 GTGTGGTGGGGGATGGGAGGGGG - Intergenic
1001780110 5:174360986-174361008 GCGGGGAGGGGGAAGGTGGGGGG + Intergenic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1002025979 5:176396558-176396580 GTTAGGTGGGGGAAGGCAGATGG + Intronic
1002400497 5:178989190-178989212 GTGGGGAGGGGGAAGGCGGGAGG - Intronic
1002606059 5:180383437-180383459 CGGTGGAGCAGGAAGGTAGAAGG - Intergenic
1002686740 5:181017818-181017840 GGGTGGAGGGGGAAAGGGGAGGG + Intergenic
1202772758 5_GL000208v1_random:26871-26893 GTGTGGTGGGGGGAGGTGGGAGG + Intergenic
1002857948 6:1054995-1055017 GGGTGGAGGAGGCAGGAAGATGG - Intergenic
1003230896 6:4252819-4252841 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1003649226 6:7943325-7943347 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1003901485 6:10659607-10659629 GTGAGGAGGGGGAGAGGAGAGGG + Intergenic
1003974134 6:11326775-11326797 GAGTGGAGGGGGAAGGAAGATGG - Intronic
1004073937 6:12328156-12328178 GTGTGAAGCAGGAAGGGAGAAGG + Intergenic
1004420917 6:15469156-15469178 GTGTGGAGGAGGAGGATAAAAGG + Intronic
1004500109 6:16201611-16201633 GTGTGGAGGGTGGAGGGAGCTGG + Intergenic
1004947041 6:20626968-20626990 CTGTAGACGGGGAAGGGAGAAGG + Intronic
1005391932 6:25342855-25342877 TGGAGGAGGAGGAAGGTAGAAGG - Intronic
1005492971 6:26363719-26363741 TTGGGGAGGGGGAAGGGGGAGGG + Intergenic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006009679 6:31032053-31032075 GTGTGGTGGGGGAGGAGAGATGG - Intronic
1006514027 6:34536162-34536184 GTTTGGAGGAGTAAGGAAGATGG - Intergenic
1006945051 6:37779320-37779342 GGGTGGAGGGGGAGGGAAGAAGG + Intergenic
1006983979 6:38165974-38165996 GTGCAGAGGGGGGAGGTGGAGGG - Intergenic
1006984063 6:38166241-38166263 GTGCGCAGGGGGGAGGTGGAGGG - Intergenic
1006984094 6:38166337-38166359 GTGCGGAGGGGGGAGGTGGAGGG - Intergenic
1006984156 6:38166548-38166570 GTGCGGAGGGGGAAGGTGGAGGG - Intergenic
1006984207 6:38166718-38166740 GTGCGGAGAGGGGAGGTGGAGGG - Intergenic
1007155836 6:39742404-39742426 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1007158341 6:39768147-39768169 GTGGGGTGGGGGGAGGGAGAAGG + Intergenic
1007224446 6:40303053-40303075 GTGTGGAGGCGGCAAGGAGAGGG - Intergenic
1007236941 6:40397303-40397325 ATGTGGAGTTGGAAGGCAGAGGG - Intronic
1007407849 6:41645081-41645103 TTGGGGAGGGGGCAGGTGGAAGG + Intronic
1007558055 6:42782970-42782992 CTGGGGAGGGGGAGGGGAGAGGG + Intronic
1007732322 6:43954699-43954721 GTGGGGTGGGGGAGGGTGGAGGG - Intergenic
1007755775 6:44098484-44098506 TTGGGGAGGAGGGAGGTAGAAGG - Intergenic
1008400565 6:51058004-51058026 GTGTGGTGGGGGGAGGGGGAAGG - Intergenic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1010754219 6:79648512-79648534 GTTTGGAGGGCAAAGGTGGAAGG - Intronic
1010754909 6:79655944-79655966 GAGTGGGAGGGGAAGGTAGTTGG + Intronic
1010768382 6:79801681-79801703 GTGTGTATGGGGAAGGCAGTAGG - Intergenic
1011151202 6:84275345-84275367 GAGTGGAGGGTGAGAGTAGATGG + Intergenic
1011358596 6:86498274-86498296 GTGTGGTGGGAGAAGGTACAAGG - Intergenic
1011894880 6:92213222-92213244 GTGTGGAGGTAGAAGATACATGG + Intergenic
1012367156 6:98455649-98455671 GGGGGGAGGGGGCAGGTAGGAGG - Intergenic
1012448121 6:99327588-99327610 GTGTGGAGTAGGAAGATAGGAGG - Intronic
1012454847 6:99392527-99392549 GTGTGTAGGTGGAGGGCAGAAGG - Intronic
1012464045 6:99497247-99497269 ATGGGGAAGGGGGAGGTAGAGGG + Intronic
1012577601 6:100822001-100822023 GGGTGGAGGGGGTAGGGAGAAGG + Intronic
1012950164 6:105509742-105509764 GTGTGGGGTGGGGAGGTGGAAGG + Intergenic
1013109509 6:107053889-107053911 GGGGGGAGGGGGAAGGTAAAGGG - Intergenic
1013149740 6:107432930-107432952 GGGTGGTAGGGAAAGGTAGAGGG - Intronic
1013173441 6:107657881-107657903 ATGTGGAGGGGGAGGGTTGCTGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013869784 6:114743156-114743178 GTGTGGAGGGGGAGTGGGGAGGG - Intergenic
1014059431 6:117053096-117053118 TTGTGGAGGGAGATGGGAGAGGG + Intergenic
1014093046 6:117427160-117427182 GTGGGGTGGGGGATGGGAGATGG - Intronic
1015598709 6:134891849-134891871 GGGTGGAGGGGCAAGGTAGAAGG - Intergenic
1015730476 6:136341894-136341916 TGCTGGAGGGGGAAGGTACAGGG - Intergenic
1016132016 6:140485697-140485719 AAGTGGAGAGGGAAGGTGGAAGG - Intergenic
1016339289 6:143044376-143044398 TTGTTGAGGGGGCAGGGAGAGGG - Intergenic
1016878001 6:148882568-148882590 TGGGGGAGGAGGAAGGTAGAAGG + Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017937893 6:159023126-159023148 GTGTGGCCGGGGAGGGTAAATGG + Intergenic
1017988214 6:159463201-159463223 CTGTGGCTGGCGAAGGTAGACGG - Intergenic
1018207603 6:161450173-161450195 GTGAAGAGGGGGAAGGTGTATGG + Intronic
1018270732 6:162074479-162074501 GTGTGGTGGGGGGAGGGGGAGGG + Intronic
1018509461 6:164509847-164509869 TTGTGGTGGGGGAAGGAAGGTGG + Intergenic
1018617013 6:165696103-165696125 TTGGGGAGGGGGAAGGAAGATGG + Intronic
1018641588 6:165908868-165908890 GTGTGGTGGGTGGAGGAAGACGG - Intronic
1018799849 6:167213563-167213585 GTGTGGAAAGGGAAGGCAGTGGG + Intergenic
1018813158 6:167312324-167312346 GTGTGGAAAGGGAAGGCAGTGGG - Intronic
1018868318 6:167762093-167762115 GGGTGGAGATGAAAGGTAGAGGG - Intergenic
1019057935 6:169236346-169236368 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057942 6:169236375-169236397 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019130913 6:169873843-169873865 GTGTGGGGGTGGGAGGTAGATGG - Intergenic
1019159081 6:170057623-170057645 GAGGGGAGGGGGAAGGGAAAGGG - Intergenic
1019159105 6:170057670-170057692 GAGGGGAGGGGGAAGGGAAAGGG - Intergenic
1019361044 7:604336-604358 GTGTGGAGGGGGAAGGCTGGAGG - Intronic
1020598422 7:10241960-10241982 GTGGGGTGGGGGAAGGGAGGAGG - Intergenic
1021303852 7:19006725-19006747 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1021426727 7:20508406-20508428 GGGGGAAGGGGGAAGGGAGAAGG - Intergenic
1022106510 7:27200804-27200826 GTGTGGACAGGGAAGGGATAGGG - Intergenic
1022503463 7:30896687-30896709 GGCTGGAGGGGGAAGCAAGAGGG - Intergenic
1022523142 7:31020599-31020621 GAATGCAGGAGGAAGGTAGATGG + Intergenic
1023127011 7:36964713-36964735 ATGTGGAGGAGGAAGGAAGTAGG - Intronic
1023518751 7:41029658-41029680 GAGAGGACGGGGAAGGTATATGG - Intergenic
1023638878 7:42238185-42238207 GTGTGGAGAGAGAAGAGAGAGGG - Intergenic
1023671370 7:42580707-42580729 GTGGGGTGGGGGAAGGGAGAGGG - Intergenic
1023689315 7:42769949-42769971 GCTTGGAAGGAGAAGGTAGAGGG - Intergenic
1023971754 7:44996762-44996784 GTGTGTTGGGGGAAAGTAGGGGG + Intergenic
1023993481 7:45144766-45144788 GGGTGGAGGGAGTAGGGAGATGG + Intergenic
1024796353 7:53026459-53026481 GTGGGGTGGGGGAGGGGAGAGGG - Intergenic
1026157783 7:67842270-67842292 ATGTGAGGGTGGAAGGTAGAGGG + Intergenic
1026189628 7:68112961-68112983 GTGTGGTGTGGGAGGGTTGAAGG + Intergenic
1026471872 7:70700607-70700629 GTGTGGAGGGGGAAAGCATCGGG + Intronic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1026946776 7:74321279-74321301 GTGGTAAGGGGGAAGGGAGAAGG - Intronic
1028113973 7:86976547-86976569 GTGTGGAGGGGGCAGGTGAGGGG - Intronic
1028320410 7:89452443-89452465 GTGTGGAGGGGGGAGGGAAATGG + Intergenic
1028338929 7:89694313-89694335 ATGTGGAGGAGGCAGGTAGGGGG - Intergenic
1028668191 7:93371338-93371360 GTGGGGTGGGGGAAGGGAGGAGG + Intergenic
1029148484 7:98463569-98463591 TTGGGGAGGGGGCAGGTGGAGGG + Intergenic
1029485168 7:100835959-100835981 GAGTGGAGTGGAAAGGTACAGGG + Intronic
1029538027 7:101167112-101167134 GTAGGGAGGGGGAGGTTAGAAGG - Intergenic
1029670929 7:102030358-102030380 GAGGGGAGGGGGGAGGTACATGG - Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1029985662 7:104921012-104921034 GTGGGGTGGGGGAGGGAAGATGG - Intergenic
1030433988 7:109491414-109491436 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1031041799 7:116846037-116846059 GTGTGGGGGCGGAAGATATATGG + Intronic
1031972269 7:128073452-128073474 GTGTGCAGAGAGAAGGTAGCGGG - Intronic
1032545325 7:132737256-132737278 GTGTGGTGGGGGGAGGGAAAAGG - Intergenic
1032644995 7:133813836-133813858 GTGTGGTGGGGGGATGAAGATGG - Intronic
1033026115 7:137774541-137774563 GTGTGTAGGGGGAGGGTAATGGG - Intronic
1033120822 7:138665018-138665040 GGGTGGAGGGGAAGGGTCGAGGG - Intronic
1033390690 7:140924743-140924765 GCGGGGAGGGGGAAGGGAGGCGG + Exonic
1034384785 7:150731971-150731993 GTGTGGAAGGGAAAGGAAAAAGG - Intronic
1034952621 7:155310656-155310678 GTGAGGAGGGGTAAGGTGGCAGG - Intergenic
1035024555 7:155817337-155817359 GTGTGGAGGGGGTACGGTGAGGG + Intergenic
1035526990 8:321716-321738 GTCTGGAGGGGCAAGCTAGGAGG - Intergenic
1036254784 8:7197105-7197127 GTGTGGTGGGGGAAGGGATGTGG - Intergenic
1036279025 8:7383325-7383347 ATGTGGAGGGGAAAGAGAGAAGG - Intronic
1036342495 8:7928549-7928571 ATGTGGAGGGGAAAGAGAGAAGG + Intronic
1036362703 8:8090402-8090424 GTGTGGTGGGGGAAGGGATGTGG + Intergenic
1036608346 8:10328238-10328260 GTGGGGAGGGGGGAGGGAGGAGG - Intronic
1037386409 8:18347422-18347444 GTGTGCAGGTGGAGGGGAGATGG + Intergenic
1037439088 8:18895957-18895979 GTGTGGAGGGGAAGGGGAGTAGG - Intronic
1037674706 8:21043276-21043298 GTGGGGTGGTGGAAGGTGGAGGG - Intergenic
1037675034 8:21044014-21044036 GGGTGGTGGTGGAAGGTGGAGGG - Intergenic
1037913927 8:22760601-22760623 GTGTGGTGGGTGCAGGGAGAAGG + Intronic
1038179220 8:25210874-25210896 GAGGGGAGGGGGAAGGGAGGAGG + Intronic
1038569983 8:28652921-28652943 GTGTGGAGGTGAGAGGTATATGG - Intronic
1039374140 8:37016285-37016307 GTGGGGAGGGGTAGGGTACATGG - Intergenic
1039407900 8:37328471-37328493 GCCTGGTGGGGGAAGGGAGAGGG + Intergenic
1039454838 8:37699492-37699514 GTCTGGAAGGTGACGGTAGACGG - Exonic
1039742687 8:40396772-40396794 GAGTGGAAGGGGTAGGGAGAGGG + Intergenic
1039867001 8:41513724-41513746 GTTTGGAGGGGGAAAGAAGCTGG - Intergenic
1040607997 8:48954044-48954066 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1040932207 8:52747180-52747202 GTGGGAGGGGGCAAGGTAGAGGG - Intergenic
1041976514 8:63805163-63805185 GTGGGGTGGGGGGAGGGAGAGGG - Intergenic
1042222079 8:66483892-66483914 GTGGGGACGGGGATGGTAGTAGG - Intronic
1042238736 8:66640976-66640998 TTGTGGAGGGGAAAGATAAAAGG + Intronic
1043048271 8:75354453-75354475 GTGGGGTGGGGGAAGGTTGGAGG - Intergenic
1043333250 8:79142832-79142854 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1043842204 8:85120607-85120629 GGGTTGAGGGTGGAGGTAGAAGG - Intronic
1044619555 8:94175688-94175710 TTGTGGAAGTGAAAGGTAGAAGG + Intronic
1045030497 8:98130547-98130569 GAGGAGAGGGGGAAGGCAGAAGG + Intronic
1045284880 8:100781893-100781915 GGGTGCATGGGGAAGGGAGAGGG - Intergenic
1045342240 8:101265407-101265429 CTGGGTAGGGGGAAGCTAGATGG + Intergenic
1046093312 8:109528624-109528646 ATGTAGAGTGGGAAGGAAGAAGG - Intronic
1046323709 8:112612933-112612955 GCGGGGAGGGGGATGGTTGAAGG + Intronic
1046829633 8:118730340-118730362 GTGAGGGTGGGGAAGGGAGATGG - Intergenic
1046940126 8:119922876-119922898 GTGTGGAGTGGAAATGTAGCAGG + Intronic
1047015698 8:120720849-120720871 CTGTGGAAGGGTAAGGTAGGTGG - Intronic
1047419359 8:124693650-124693672 GTGTGTAGGAGGAAGGCAGGTGG - Intronic
1047544718 8:125804491-125804513 GGGTGGAGGGGCCAGGTAGCAGG + Intergenic
1047724909 8:127676011-127676033 GGGTGGAGGGCAAAGGAAGAAGG - Intergenic
1047938606 8:129806048-129806070 GTGGGGTGGGGGAAGGGAGGAGG - Intergenic
1048167619 8:132077338-132077360 GTCTAGAGGAGGAAGGTGGAGGG + Intronic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1048927603 8:139284624-139284646 GTGGGCAGGGGGAAGGTTGACGG - Intergenic
1049074958 8:140388227-140388249 GTGGGGAGGGGGGAGGTGGGAGG + Intronic
1049361134 8:142213042-142213064 AGGTGGAGGGGGAAGGGAGGGGG - Intronic
1049711228 8:144064233-144064255 GTGTCGTGGGGGAAGGGATATGG + Intergenic
1049952770 9:661266-661288 GTGGGGAGGGGGAAGAGAGGAGG - Intronic
1050497324 9:6258169-6258191 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1050612153 9:7364174-7364196 GTGTTGGAGGGGAAGGCAGAGGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051475664 9:17505902-17505924 GTGTGGTGCTGGCAGGTAGAGGG + Intergenic
1051492086 9:17677771-17677793 GTGGGGTGGGGGGAGGTAGGAGG - Intronic
1051569298 9:18537630-18537652 GGGTGGAGGGGTGAGGCAGAAGG + Intronic
1052081790 9:24214934-24214956 GTGGGGAGGGGGAAGGGGGGAGG + Intergenic
1052951856 9:34219822-34219844 GAGGGGAAGGGGAAGGGAGAGGG - Intronic
1052951994 9:34220100-34220122 GAGGGGAGGGGGAGGGAAGAGGG - Intronic
1053287969 9:36862078-36862100 GTGTGGAGGCAGCTGGTAGAGGG + Intronic
1053329163 9:37188497-37188519 GGGGGGAGGGGGAAGGAAGGGGG - Intronic
1053522190 9:38791491-38791513 GTGTGGAGGGGGTGGGAAGAAGG - Intergenic
1053699543 9:40675859-40675881 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054194416 9:62015955-62015977 GTGTGGAGGGGGTGGGAAGGAGG - Intergenic
1054310832 9:63475260-63475282 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054409621 9:64799411-64799433 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054643991 9:67572735-67572757 GTGTGGAGGGGGTGGGAAGGAGG + Intergenic
1054708615 9:68488239-68488261 GTGTGCTGGGGGATGGGAGAGGG - Intronic
1055058550 9:72045935-72045957 GTGTGTGGGGGGAAGGAAGGTGG + Intergenic
1055825867 9:80323881-80323903 GTGAGGATGAGGAAGGTAGCTGG - Intergenic
1056235721 9:84592069-84592091 GTGTGCTGGGGGTAGGGAGAAGG + Intergenic
1056499576 9:87195156-87195178 GAGTGGAGGGAGAAGATAGATGG + Intergenic
1056524920 9:87433981-87434003 GTGTGGCAGGAGAAGGTATATGG + Intergenic
1056992612 9:91424691-91424713 GCGTGGCGGGGGTGGGTAGATGG - Intergenic
1057117709 9:92541401-92541423 GTGGGGAGGGGGAAGGGGGGTGG - Intronic
1057120069 9:92563758-92563780 GTAGGGAGGGGGGAGGAAGAGGG - Intronic
1057163660 9:92909169-92909191 GTGGGGAGGGGGCTGGCAGATGG - Intergenic
1057194291 9:93108184-93108206 GTGAGGAGGGAGGAGGCAGAGGG + Intronic
1057517428 9:95734034-95734056 GTGGAGAGGGGAAGGGTAGAAGG - Intergenic
1057761126 9:97875197-97875219 ATGTGGAGTGGGCTGGTAGATGG - Intergenic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1058235816 9:102487842-102487864 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1058310099 9:103490152-103490174 GTGGGGTGGGGGAAGGCAGGAGG - Intergenic
1058410430 9:104725177-104725199 GTGTGGAGAGGGATGGTTGGTGG - Intergenic
1058579311 9:106437625-106437647 GGGGGGAGGGGGAGGGGAGAGGG - Intergenic
1058840516 9:108903218-108903240 GTGGGGTGGGGGAGGGTGGAGGG - Intronic
1059045943 9:110866823-110866845 GTTTGGAGGGGAAAGAGAGAAGG + Intergenic
1059418630 9:114177416-114177438 GTGTGGAGGAGGACTGCAGAGGG + Intronic
1059545277 9:115169534-115169556 GTGTGGAGCAGGATGGTAGCTGG + Intronic
1059900905 9:118923752-118923774 GTGGGGTGGGGGAGGGGAGAGGG + Intergenic
1060070301 9:120541207-120541229 GGGTGGAGGGGTAAGGGAAAGGG - Intronic
1060190330 9:121588549-121588571 GGGTGAAGGGGGAAGGGGGAAGG + Intronic
1060227630 9:121804086-121804108 GTGTTGAGGGTGAGGGTGGACGG - Intergenic
1060227804 9:121806080-121806102 GTGTTGAGGGTGAGGGTGGACGG + Intergenic
1060389443 9:123267010-123267032 TTGGGGAGGAGGAAGGTGGAGGG - Intronic
1061390623 9:130315355-130315377 GAGGGGAGGGGGAGGGGAGAGGG - Intronic
1061453415 9:130681209-130681231 GCGGGGCGGGGGAAGGGAGACGG - Intronic
1061657488 9:132104238-132104260 CTGGGGAGGGTGAGGGTAGAGGG - Intergenic
1061679546 9:132236177-132236199 CTGTGGTGGGTGAAGGGAGAAGG + Intronic
1061881729 9:133572290-133572312 GTGAGGAGGGGAAAGGCTGAGGG + Intronic
1062108551 9:134768970-134768992 GTGTGGAGGGGGGAGGTGTGAGG + Intronic
1062147370 9:134997109-134997131 GTGTGGAGGGAGCACCTAGAGGG + Intergenic
1062200545 9:135300570-135300592 ATGTGGAGGGGGAGGGGACAAGG + Intergenic
1062253868 9:135611776-135611798 GTGTGCAGGGGGCAGACAGAAGG - Intergenic
1062267975 9:135696068-135696090 GTGGGAAGTGGGGAGGTAGAGGG - Intronic
1062303109 9:135886945-135886967 GTGTGGAGGAGGAGGGCAGTCGG + Intronic
1062321099 9:135990855-135990877 GTGTGGAGAGGGGAGGGAAAGGG - Intergenic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1185608445 X:1380464-1380486 GGGAGGAGGGGGAAGGGAGGGGG + Intronic
1186477350 X:9867831-9867853 GTGTGGTGGGGGAAGGCTGATGG + Intronic
1186497840 X:10026034-10026056 GGGTGTAGGGAGAAGGAAGAGGG - Intronic
1186576776 X:10775130-10775152 GGGAGGAGGGGGAGGGGAGATGG + Intronic
1186641781 X:11463247-11463269 GTGTGGAGAGGGAGGATGGAGGG + Intronic
1186647254 X:11520303-11520325 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1186801914 X:13101469-13101491 TGGTGGAGGGTGGAGGTAGAAGG + Intergenic
1187128348 X:16475686-16475708 CTGTGGAGGGGGAAGTTAGGAGG + Intergenic
1187132222 X:16514086-16514108 ATGTGGAGAAGGAAGGAAGAAGG + Intergenic
1187253464 X:17620866-17620888 GTGGGGAGGGGAAAAGTGGAGGG + Intronic
1187769883 X:22683146-22683168 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1188575090 X:31639259-31639281 CTGTGGAGAGGGAATGAAGATGG + Intronic
1189406666 X:40731218-40731240 ATGTTGAGGGGGAAGGGAGGTGG + Intronic
1189746588 X:44174655-44174677 GGGGGGAGGGGGAAGGCAGGAGG + Intronic
1190066632 X:47245866-47245888 GTGTGGAGGAGGGAGGAGGAAGG - Intronic
1190172329 X:48121524-48121546 GTGGGGAGGGGAAGGGCAGAGGG + Intergenic
1190237505 X:48628311-48628333 GGGTGGAGGGAGAGGGAAGAAGG + Intergenic
1190366876 X:49703346-49703368 GTTTGGAGGGTAAAGGTGGAGGG + Intergenic
1190403809 X:50066011-50066033 GTGGGGAGGGGGGAGGGGGAAGG + Intronic
1190741070 X:53289152-53289174 GTGTGGAGGGGGAAGGGCTAGGG - Intronic
1190910168 X:54764401-54764423 GTGGGGAGGGGGAAGGGGGGAGG - Intronic
1191045812 X:56135550-56135572 GTGGGGTGGGGGACGGGAGAGGG + Intergenic
1191675055 X:63784900-63784922 AAGTGGAGGGGGATGGTAGGGGG + Intronic
1191932373 X:66388305-66388327 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1192050776 X:67722072-67722094 ATGGGGAGGGGGAATGAAGAAGG - Intronic
1192409126 X:70916916-70916938 GTGGGGAGGTGGATGGTAAAAGG - Intergenic
1192906931 X:75561412-75561434 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1193026228 X:76848985-76849007 GTGGGGTGGGGGAAGGGTGAAGG + Intergenic
1193832037 X:86300529-86300551 GTGGGGTGGGGGAAGGGAGAGGG + Intronic
1194035310 X:88863868-88863890 GTGTGGAGGGGGAAGTGTGGAGG + Intergenic
1194145650 X:90258697-90258719 TTCAGGAGGGGGAAGGTAAAGGG + Intergenic
1194337227 X:92663052-92663074 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1194517112 X:94868237-94868259 GTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1194562517 X:95439870-95439892 GTGTGGTGGGGGGAGGGAGGAGG + Intergenic
1194587611 X:95755483-95755505 GCCTGCAGGGGGAAGGTGGATGG - Intergenic
1195029110 X:100909192-100909214 GTGAGGAGAAGGATGGTAGAGGG - Intergenic
1195339373 X:103891259-103891281 GTGTGGTGGGGGAGGGTGGAGGG - Intergenic
1195457936 X:105090437-105090459 GAGTGGATGGGAAAGGGAGATGG - Intronic
1195609661 X:106851556-106851578 GTGGGGTGGGGGAGGGGAGAGGG - Intronic
1196060450 X:111402819-111402841 GTGCGGAGGGGGAGGGTAAGTGG + Intronic
1196147368 X:112332680-112332702 GTGGGGTGGGGGGAGGGAGAAGG + Intergenic
1196573182 X:117287027-117287049 GTGGGGTGGGGGAAGGGAGGAGG + Intergenic
1196592747 X:117506153-117506175 GTGGGGTGGGGGAAGGGAGGAGG + Intergenic
1196632100 X:117953403-117953425 GTGGGGTGGGGGAAGGGGGAAGG + Intronic
1196914134 X:120514259-120514281 GGCTGGAGTGGGAAGGTAAAAGG - Intergenic
1197059511 X:122160719-122160741 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1197339076 X:125243787-125243809 GTATGTAGGGAGTAGGTAGAAGG + Intergenic
1198910666 X:141610005-141610027 GTGTGGCGGGGGGAGGAAGGTGG + Intronic
1198924451 X:141772066-141772088 GTGTGGAGGGGGAAGGAAGAAGG + Intergenic
1199444687 X:147908827-147908849 AAGTGAAGGGGGAAAGTAGAAGG + Intergenic
1199498842 X:148486707-148486729 GTGTGGAGACAGAAGGTATATGG + Intergenic
1199512694 X:148640373-148640395 GGAGGGAGGGAGAAGGTAGAAGG - Intronic
1199736718 X:150692935-150692957 GTATGGAGGGGGAGAGTGGAGGG + Intergenic
1199765933 X:150941727-150941749 TGGGGGAGGGGGAAGGCAGAGGG + Intergenic
1200698083 Y:6378813-6378835 GTGGGGTGGGGGGAGGTGGAGGG - Intergenic
1201036029 Y:9785886-9785908 GTGGGGTGGGGGGAGGTGGAGGG + Intergenic
1201144781 Y:11058233-11058255 GAGTGGAGGGGGGATGTGGATGG + Intergenic
1201167535 Y:11223473-11223495 GGGTGGTGGGGGCAGGGAGAGGG - Intergenic
1201172827 Y:11285756-11285778 GTGGGGGGGGGGAGGGGAGAGGG + Intergenic
1201187150 Y:11415749-11415771 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1201300241 Y:12498750-12498772 GGGAGGAGGGGGAAGGAGGAGGG - Intergenic
1201721065 Y:17097926-17097948 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1201908445 Y:19108512-19108534 GTGGGGTGGAGGAAGGGAGAGGG - Intergenic
1201917949 Y:19203087-19203109 TTGGGGAGTGGGAAGGCAGAAGG - Intergenic