ID: 1167422608

View in Genome Browser
Species Human (GRCh38)
Location 19:49413070-49413092
Sequence TCACAGCTGTTTACAGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167422605_1167422608 -4 Left 1167422605 19:49413051-49413073 CCTCAGGGTGACACCTTATTCAC 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1167422608 19:49413070-49413092 TCACAGCTGTTTACAGTAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 127
1167422604_1167422608 3 Left 1167422604 19:49413044-49413066 CCGTCTGCCTCAGGGTGACACCT 0: 1
1: 0
2: 2
3: 15
4: 256
Right 1167422608 19:49413070-49413092 TCACAGCTGTTTACAGTAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 127
1167422600_1167422608 27 Left 1167422600 19:49413020-49413042 CCATGTGGTAAGGAGCTGAGCCA 0: 1
1: 0
2: 5
3: 45
4: 263
Right 1167422608 19:49413070-49413092 TCACAGCTGTTTACAGTAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 127
1167422603_1167422608 7 Left 1167422603 19:49413040-49413062 CCATCCGTCTGCCTCAGGGTGAC 0: 1
1: 0
2: 0
3: 6
4: 188
Right 1167422608 19:49413070-49413092 TCACAGCTGTTTACAGTAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167422608 Original CRISPR TCACAGCTGTTTACAGTAGG AGG Intronic
906526284 1:46495014-46495036 TCACAGCTGTGGCCAGAAGGTGG + Intergenic
906947597 1:50308628-50308650 TCAGATCTGTTTTCACTAGGAGG - Intergenic
907340756 1:53734517-53734539 TCAAAGCTGCAGACAGTAGGTGG - Intergenic
908906365 1:69016277-69016299 CCATAGCTGTTTATAGTGGGAGG + Intergenic
910622838 1:89274681-89274703 TCACAGTTGTTCAAAGTATGTGG + Intergenic
915094913 1:153455586-153455608 CCACTGCTGTTTACATGAGGTGG + Intergenic
916611419 1:166395689-166395711 TGCCAGCTGTTTACTATAGGGGG - Intergenic
917489421 1:175485300-175485322 TCAAAGCTGTTTACAGTTTGGGG - Intronic
921979584 1:221241300-221241322 TCACTGCTGATTTCAGTTGGTGG - Intergenic
922008861 1:221560491-221560513 TCACATCTGTTTTCAGTTAGGGG + Intergenic
924074660 1:240320830-240320852 GCACAGCTGTTTACACAAGGAGG - Intronic
1069764992 10:70849550-70849572 TCCCAGGTGTTTACAGAATGTGG + Intronic
1070397207 10:76021640-76021662 TCACAGCTCTTCATGGTAGGAGG - Intronic
1070765477 10:79053803-79053825 TCACAGCTGTTAGCAGCAGGAGG - Intergenic
1071699635 10:87916351-87916373 TCACAGTTGTTCACAGTGGTAGG + Intronic
1074650501 10:115518269-115518291 TTCCAGTTGTTTACAGCAGGAGG + Intronic
1076490725 10:130859533-130859555 TCACACCTGTTTTCAGGAAGGGG + Intergenic
1076939101 10:133589910-133589932 TCACAGTTGTATACACTTGGAGG + Intergenic
1077209056 11:1359917-1359939 TGACAGCTGTCTACAGGACGAGG - Intergenic
1079808795 11:24968917-24968939 TCACAGTTGTTTATAGGAGGAGG + Intronic
1082015249 11:47480917-47480939 TCCCAGCTGCTTGCAGTTGGAGG + Intronic
1086818401 11:91402772-91402794 TCACTGGTGCTAACAGTAGGAGG - Intergenic
1090905653 11:131072461-131072483 TCACAGGTGCTTGCACTAGGAGG + Intergenic
1095946278 12:47755658-47755680 TGAAAGCGGGTTACAGTAGGAGG - Intronic
1096199415 12:49671130-49671152 CCACAGCTGCTGACAGTGGGTGG - Intronic
1098284943 12:68897345-68897367 TCTCAGCTTTTTATAGTATGAGG - Intronic
1098359514 12:69641212-69641234 TCAGAGCTGTTCAGAGTTGGTGG - Intergenic
1106257529 13:28035095-28035117 TCACAACTGTTTAACTTAGGAGG + Intronic
1106302701 13:28484048-28484070 TTACAGGTGTGCACAGTAGGTGG + Intronic
1107251015 13:38363260-38363282 TTACAGTTGTTTACAGTATTAGG + Intronic
1107621148 13:42232006-42232028 TGACACCTGTTTCCAGGAGGGGG + Intronic
1108447924 13:50527850-50527872 ACACATCTGTTTATAGGAGGAGG + Intronic
1108932099 13:55837906-55837928 TCACAGCTGGTTGCACTTGGGGG - Intergenic
1110933910 13:81258957-81258979 TCATAGTTGCTTTCAGTAGGAGG - Intergenic
1120365052 14:83557269-83557291 TCACTGCTGTTTATATTAGTGGG - Intergenic
1120586589 14:86319270-86319292 TGACAGGTGTTTCCTGTAGGAGG + Intergenic
1121001359 14:90454084-90454106 TCACAGATGTTTAGAGGAGGTGG + Intergenic
1121056395 14:90858086-90858108 TCATCGTTGTTTTCAGTAGGAGG - Exonic
1121692898 14:95890476-95890498 CCACAGCTGTTTAGAGCAGAGGG - Intergenic
1127429869 15:58894354-58894376 TCATAGCTGTTAACAGTAGCAGG - Intronic
1128707244 15:69845589-69845611 TCCCAGCTATTTACAGGAGGAGG + Intergenic
1137448410 16:48547666-48547688 TCACAGCTGAGTAAAATAGGAGG + Intronic
1138661538 16:58521560-58521582 TCACAGCTGTTCAGAATAAGGGG + Intronic
1139510914 16:67428206-67428228 GAACAGATGTCTACAGTAGGGGG - Intergenic
1141188890 16:81809214-81809236 TCACAGGTGTTTCCAGCAAGTGG - Intronic
1142231651 16:88902925-88902947 CCACAGGTGTTAACAGGAGGAGG - Intronic
1142838266 17:2606085-2606107 CCACAGCTGTTTGAGGTAGGCGG + Intronic
1149194527 17:54103143-54103165 TCACAGGTGTATACATTAGCGGG - Intergenic
1149691356 17:58579582-58579604 TCACAGATGTTTAGAGCTGGGGG - Intronic
1151256738 17:72883241-72883263 GCACATGTGTTAACAGTAGGAGG - Intronic
1153619432 18:6963199-6963221 TCACAGATGTTCTCAGTAGAAGG - Intronic
1153730660 18:8008240-8008262 GATCAGCTGTGTACAGTAGGAGG + Intronic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1156383588 18:36586010-36586032 TCACATCTCTTTGGAGTAGGGGG - Intronic
1157548624 18:48565317-48565339 TCTCAGCTGTTTCCTGTAGAAGG - Intronic
1165533451 19:36422732-36422754 TCCCAGGTGTTTGCAGAAGGCGG - Intergenic
1167422608 19:49413070-49413092 TCACAGCTGTTTACAGTAGGAGG + Intronic
1167782035 19:51604926-51604948 TTATAGTTGTTTACAGCAGGAGG - Intergenic
925341207 2:3138710-3138732 TCACGGCTGTTCACAGTTGATGG - Intergenic
927050047 2:19319335-19319357 TCACAAATGTTTCCAGTTGGAGG - Intergenic
933609164 2:84416038-84416060 TCACAGCTCCTGTCAGTAGGAGG - Intergenic
934217064 2:90042043-90042065 TCACAGAAGATTACAGCAGGTGG + Intergenic
935193110 2:100794066-100794088 TCACAGCTGTGTCCAGTGTGAGG + Intergenic
936404485 2:112190214-112190236 TGACAGATGCTTCCAGTAGGAGG + Intergenic
938241379 2:129744798-129744820 TAACATCTGTTTAGAGTAGAAGG + Intergenic
938856406 2:135316446-135316468 TAACAGCTGTTTTCAGTAGTGGG - Intronic
939555891 2:143672965-143672987 TCATAGCTCTTTAGAATAGGAGG - Intronic
942462689 2:176179141-176179163 TTAGAGCTGTTTACAGCAGGAGG + Intergenic
943771499 2:191722470-191722492 TAACTGGTGTTTGCAGTAGGGGG - Intergenic
943856418 2:192799508-192799530 TTATAGTTGTTTACGGTAGGAGG - Intergenic
945587929 2:211690332-211690354 TGACAGCACTTTACAGTAAGTGG + Intronic
948250993 2:236528893-236528915 TCACAGCTGTTTTCTGGATGAGG - Intergenic
948666113 2:239535822-239535844 TCAGAGCTGTGGACAGAAGGTGG - Intergenic
1170417771 20:16162723-16162745 TTACAGCTGATGACAGCAGGTGG + Intergenic
1170721818 20:18887961-18887983 ACACAGCAGTTTACAGCACGAGG - Intergenic
1172838673 20:37888927-37888949 TCAAACCTGCTTACACTAGGGGG + Intergenic
1172927481 20:38551976-38551998 GAACAGGTGTGTACAGTAGGAGG + Intronic
1175221405 20:57418950-57418972 TTACAGCTGGTTAGAGTAGGGGG + Intergenic
1176916800 21:14635423-14635445 TTACAGCTGTCTACATTTGGTGG + Intronic
1178041536 21:28645322-28645344 TCAAATCTGTTTAGAGTAGAAGG - Intergenic
1179022403 21:37652110-37652132 TCATGGCTGGTTACAGGAGGTGG + Intronic
1180091017 21:45533870-45533892 GCCCAGCTGTTCACAGTAGCCGG - Intronic
1184960289 22:47923586-47923608 TGTCAGCTGTTTACAGGATGGGG + Intergenic
949756849 3:7421971-7421993 TCCCAGCTGCTTACATTGGGAGG + Intronic
953148751 3:40304684-40304706 TCACAGTTCTTGACAGCAGGAGG + Intergenic
956283192 3:67580881-67580903 TTAGAGCTGTTTATAATAGGGGG + Intronic
958751044 3:98193477-98193499 TCACAGATGCTTACAGTGGAGGG + Intronic
960041293 3:113152169-113152191 TCCCAGCTTTCTACAGTAGCAGG + Intergenic
960458099 3:117898912-117898934 TTCCAGCTCTTTCCAGTAGGGGG - Intergenic
962110464 3:132440570-132440592 TTACAGCTGCTTACAGTATTAGG + Intronic
966734304 3:183176710-183176732 TGACAGCTGGTTCCAGTAGCGGG + Intergenic
967964802 3:194952505-194952527 TCACAAATGTTTTCAGTGGGTGG - Intergenic
971221843 4:24716100-24716122 TCCCAGCTGATTCCAGGAGGCGG - Intergenic
972348908 4:38217606-38217628 TATTAGCTGTTTTCAGTAGGAGG + Intergenic
974077954 4:57184809-57184831 TCAAAGCTGGTTTCAGAAGGAGG + Intergenic
976201006 4:82578728-82578750 CCGAAGCTGTTTACAGTAGCTGG - Intergenic
977835677 4:101643434-101643456 TCACTGCTGTTTACTGTTTGGGG + Intronic
982634698 4:157879411-157879433 TTACAGCTGCTTACTGTAGAAGG + Intergenic
984248400 4:177303120-177303142 TCACAGTTGCTGATAGTAGGTGG - Intergenic
986106296 5:4662544-4662566 TCACAGCTTGTTACAGGAGAAGG + Intergenic
991099865 5:62780663-62780685 TCACCGCTCTTTACAGTTAGTGG + Intergenic
995834716 5:116388645-116388667 GCACAGCTGTGAACAGAAGGTGG - Intronic
996532823 5:124544214-124544236 GCACAGCTCTTTAGAGAAGGGGG - Intergenic
996838168 5:127817128-127817150 TCACACCTGTTGGCAGTTGGTGG + Intergenic
997855739 5:137370956-137370978 TCACAGCTGGTCACAGTAGCTGG + Intronic
999228142 5:150044525-150044547 TCACAACTTTTTACAGTGGAGGG + Intronic
999969181 5:156841993-156842015 TCACACCTGTTTTAAATAGGAGG + Intergenic
1006495168 6:34417643-34417665 TCCCAGCTGTTTACATTTGGGGG - Intronic
1010025164 6:71206733-71206755 TCACAGATGTTTCCAGCATGAGG + Intergenic
1011419405 6:87155734-87155756 GCACAGCTGCTGACAGTAGTCGG - Exonic
1011499529 6:87972690-87972712 TCACAGCTGCCTACAGTAGAAGG - Intergenic
1012231301 6:96763271-96763293 TCGCAGCTGAGTACAGGAGGAGG + Intergenic
1012747254 6:103108134-103108156 AAACAGCTGTGGACAGTAGGAGG - Intergenic
1012934901 6:105356763-105356785 TCCTAGCTGTGTACAGCAGGAGG + Intronic
1013108881 6:107049301-107049323 TCACCACTGCTTCCAGTAGGGGG - Intronic
1015762355 6:136677941-136677963 TGACAACTCTTTAAAGTAGGGGG + Intronic
1018155187 6:160979037-160979059 TTCCAGTTGTTTACAGTGGGTGG - Intergenic
1018636150 6:165861124-165861146 TCAATGCTGTTTCCAGTTGGTGG - Intronic
1026159124 7:67853175-67853197 TCACAGATGTAGAAAGTAGGGGG - Intergenic
1026896020 7:74010506-74010528 TCACAGCTGTCTGCAGTGGTGGG - Intergenic
1031821084 7:126502355-126502377 TAAGATCTGTTTACAGGAGGAGG + Intronic
1036196219 8:6717438-6717460 TTACACCTTTTAACAGTAGGTGG - Intronic
1038147336 8:24911167-24911189 TTCCAGCTGGTTACAGAAGGAGG - Intergenic
1038420107 8:27428690-27428712 TCACAGCTAGTTGGAGTAGGGGG - Intronic
1041090063 8:54293603-54293625 TGTATGCTGTTTACAGTAGGAGG + Intergenic
1042294008 8:67200631-67200653 TCCCATCTGTTTACATTAGCTGG + Intronic
1048633499 8:136270413-136270435 TCACAGCTGGATAATGTAGGGGG - Intergenic
1052481951 9:29041431-29041453 TCATAGCTATATACAGTAGCAGG - Intergenic
1052983559 9:34467738-34467760 TTACTGCTGTTTACAGTGTGAGG - Intronic
1058950698 9:109901297-109901319 TCTCAGCTGTTTACAACAGGTGG - Intronic
1060464443 9:123890260-123890282 TCACACCTGTTTAGAGTGGCTGG + Intronic
1060915671 9:127388401-127388423 TCAGGGCTGTTAACAGTAGTGGG + Intronic
1061878976 9:133559133-133559155 TTAAAGCTGTTGAAAGTAGGTGG + Intronic
1188992854 X:36845074-36845096 TTATAGCTGTTTGCAGTGGGAGG + Intergenic
1189060694 X:37749989-37750011 TTATAGCTGTTTGCAGTGGGAGG - Intronic
1193248356 X:79257881-79257903 TCACAGCTTTTTACAGTCTGTGG - Intergenic
1195891564 X:109701150-109701172 TAACAGCTTTTTACATTTGGTGG + Intronic
1195997866 X:110749383-110749405 TCAAAGCTGTCTGCAGGAGGGGG - Intronic
1196040917 X:111202890-111202912 TCACAGATGTTTCAAGTAAGGGG - Intronic
1199835318 X:151584422-151584444 TCACGGCTAGTTACAGTAGCTGG - Intronic
1201682658 Y:16665914-16665936 TCACAGCTGGTTACACTAGAAGG + Intergenic
1201859410 Y:18579524-18579546 TCAAGTCTGTTAACAGTAGGAGG - Intronic
1201873911 Y:18740857-18740879 TCAAGTCTGTTAACAGTAGGAGG + Intronic
1202063556 Y:20913540-20913562 TCACAGCTTTTTACAGGAAAAGG + Intergenic