ID: 1167423055

View in Genome Browser
Species Human (GRCh38)
Location 19:49415032-49415054
Sequence CAGCCTCTGTGGGTGTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 4, 3: 88, 4: 482}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167423055_1167423064 27 Left 1167423055 19:49415032-49415054 CCACTCCACACCCACAGAGGCTG 0: 1
1: 0
2: 4
3: 88
4: 482
Right 1167423064 19:49415082-49415104 GCCTCACACTCCAACTCCTCAGG 0: 1
1: 0
2: 4
3: 19
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167423055 Original CRISPR CAGCCTCTGTGGGTGTGGAG TGG (reversed) Intronic
900401814 1:2475840-2475862 CAGCCCCTGTGGCTGGAGAGGGG - Intronic
900507262 1:3035982-3036004 CAGGCTGTGTGGGGGTGGTGAGG - Intergenic
901050571 1:6424138-6424160 CAGCCGCTGTCGGTGTGGAGGGG - Intronic
901513611 1:9730771-9730793 CTTCCTCTGTGGCTGTCGAGAGG - Intronic
902286362 1:15410669-15410691 CAGCCTCGGTGTGTGCGGTGTGG - Intronic
902633588 1:17720275-17720297 CAGCCTGTGTGGGAGTTGGGAGG + Intergenic
902636249 1:17736769-17736791 CAGCAGCTGGGGGTGGGGAGGGG - Intergenic
903651262 1:24923660-24923682 CAGCTCCTGTGGGTGGGGCGGGG - Intronic
904130843 1:28274055-28274077 CAGCATGTCTGGGTGTGGAGAGG - Exonic
905337491 1:37255567-37255589 CAGTCTCTGCTGGCGTGGAGGGG + Intergenic
906126591 1:43430836-43430858 CTGCCTAAGTGGGAGTGGAGGGG + Intronic
906276641 1:44521560-44521582 GGGCCTCTGTGGGTGTGGGTGGG + Intronic
906524475 1:46486136-46486158 GAGCCTTCGTGGGGGTGGAGGGG + Intergenic
906528403 1:46509687-46509709 CAACCACTGTGGGTTTGTAGGGG - Intronic
907334692 1:53692610-53692632 CAGCCACTGTGGGTGTAGCTGGG + Intronic
908124281 1:61014665-61014687 CAGCCTCTGTGCCTGGGGTGAGG + Intronic
908544000 1:65147472-65147494 CAGGCTGGGTGGGAGTGGAGTGG + Intergenic
908667707 1:66510712-66510734 CAGCCTCAGTGGCAGTGGGGAGG - Intergenic
909354028 1:74686395-74686417 CAGCCCCTGTAGGTGGGGAGTGG + Intergenic
912633633 1:111270917-111270939 CAGGCTGTGTGGGTGTGAGGTGG - Intergenic
912764460 1:112396213-112396235 CAGCCGCTGTGGATGGGGAGTGG + Exonic
915073151 1:153288782-153288804 CAGCCCTGGTGGGTGTGGAGTGG - Intergenic
915285240 1:154848099-154848121 CAGCCACTCTGGCTGGGGAGGGG - Intronic
915436563 1:155911191-155911213 CAGCAGCTGGGGGTGGGGAGGGG - Intronic
915591836 1:156875282-156875304 TGGGCTCTGTGGGGGTGGAGGGG + Intronic
916056514 1:161072401-161072423 CTGACTGTGTGTGTGTGGAGGGG - Exonic
916720602 1:167482427-167482449 TGGCCTCTGTGGGGGTGGGGTGG + Intronic
916874327 1:168952922-168952944 CAGGCCCTGTGTGTGTGGTGGGG + Intergenic
917021011 1:170586887-170586909 CAGACTTTGCGGGGGTGGAGGGG + Intergenic
917589385 1:176460831-176460853 CAGCCACTTTGGAGGTGGAGTGG - Intergenic
918257495 1:182762661-182762683 CTGCCTTTGTGAGTGTTGAGGGG + Intergenic
918712168 1:187745093-187745115 CCCTCTCTTTGGGTGTGGAGTGG - Intergenic
920088133 1:203432846-203432868 CACACTCTGTGGGAGTGGAGAGG + Intergenic
920210867 1:204327345-204327367 CACCCTCTGTGGGCCTTGAGAGG - Intronic
920234635 1:204494589-204494611 CAGCTTGTGGGGGTGGGGAGGGG + Intronic
920679986 1:208064884-208064906 CAGTCTCTGTGTGTGTTGGGCGG - Intronic
921420079 1:214937297-214937319 CAGCCCATGTTGGTGTGCAGTGG + Intergenic
922351105 1:224735150-224735172 CAGCCACTGTGGGGCTGGGGTGG - Intronic
922575577 1:226658951-226658973 CAGCCTGATTGGGTGTGGAGGGG - Intronic
922615862 1:226960883-226960905 CAGCCCCTGTGGGTTTGGGTTGG + Intronic
922880591 1:228977515-228977537 GAGCAGATGTGGGTGTGGAGTGG - Intergenic
923017742 1:230140013-230140035 CAGCCTCTCTGGGCCTGGGGTGG - Intronic
923031464 1:230252230-230252252 GGGCCTCTGTGGGTGTGCATTGG + Intronic
923091594 1:230745215-230745237 CAGCATCTGTGGGAGTGGCAGGG + Intergenic
923195780 1:231665941-231665963 CACCCTCTGAGGGTGTGGAAGGG + Intronic
923297641 1:232610701-232610723 CAGCCTTTCTCAGTGTGGAGTGG + Intergenic
923368480 1:233286691-233286713 GAGTCTCTGAGGGTGTGGAAAGG + Intronic
923459639 1:234197204-234197226 CAGCCTCAGTGGGAGTGGGTAGG - Intronic
923761069 1:236844628-236844650 CAGTCACTGTGTGAGTGGAGGGG + Intronic
1065087269 10:22191375-22191397 CAGTGTATGTGGGTGGGGAGGGG - Intergenic
1065828673 10:29595237-29595259 CTGCCTCTGTGGGTATGGAAGGG + Intronic
1066441140 10:35440080-35440102 CAGCCTTTGTTGGTGTGGATGGG + Intronic
1066658027 10:37712872-37712894 CAGGCTCTGAGGCTGGGGAGCGG + Intergenic
1066698014 10:38095349-38095371 CAGCCTGTGGGGGTCTGGAAAGG - Intronic
1067746948 10:48943217-48943239 CTGGCTCTGTGGGTGAGGACAGG - Intronic
1067946023 10:50688411-50688433 CAGCTTCTGGGGGTGTGCTGAGG + Intergenic
1069499485 10:68938267-68938289 ATGCCTGTGTGTGTGTGGAGGGG + Intronic
1069796115 10:71053054-71053076 GAGACACTGTGGGTGGGGAGGGG + Intergenic
1069834828 10:71301892-71301914 CAGCTTCTGAGGGTGGGGTGGGG - Exonic
1069892301 10:71659450-71659472 CTGGCTCTGTGGGTTTGGGGTGG + Intronic
1070541224 10:77416753-77416775 CAGGCTTTGAGGATGTGGAGTGG - Intronic
1070799478 10:79236712-79236734 CAGCCTCTAAGGGTGTGTGGTGG - Intronic
1070953540 10:80449761-80449783 CAGCCTCTGTGTGTGTTTACAGG - Intergenic
1071334537 10:84590047-84590069 CAGTCCCTGTGGCTGTGGAGGGG - Intergenic
1072368797 10:94743406-94743428 CAGCCTCTGTAGGTGAGGTTGGG + Intronic
1072646334 10:97257720-97257742 GAGCCTCTGGGGGTGAGTAGGGG - Intronic
1075396689 10:122132851-122132873 CACCCTGTGTGTGTGTGCAGAGG - Intronic
1075917368 10:126180348-126180370 CAGGCTCTGTGATTCTGGAGGGG + Intronic
1076631198 10:131853280-131853302 CAGCCTCTTGGGGTCTGGGGTGG - Intergenic
1076717658 10:132374579-132374601 CAGCTTCTGTGTCTGTGGGGTGG + Intronic
1076839843 10:133040592-133040614 CGGCGTCTGTGGGTGAGGTGGGG + Intergenic
1077394006 11:2312340-2312362 CAGCGTCTGTGAGTGTGAAATGG - Intronic
1078469413 11:11575196-11575218 CAGTCTCTGTGGGTGGGGTGTGG + Intronic
1078741993 11:14075421-14075443 AAGACCCTGTGGGTGGGGAGGGG + Intronic
1079452561 11:20609831-20609853 CTGGATCTGTGGGTGGGGAGAGG + Intronic
1080810818 11:35702360-35702382 CAGCTTGTGTGGCTGCGGAGTGG + Intronic
1081298190 11:41418009-41418031 CAGCATATGTGTGTGTGGGGGGG - Intronic
1081704075 11:45170547-45170569 CAGCCCCTGTGGCTGTGATGTGG + Intronic
1081836490 11:46159861-46159883 CAGACTCTCTGGGTGGGGAAGGG - Intergenic
1083377148 11:62233256-62233278 CAGCCTCTGTGTGTGTGTGTAGG - Intergenic
1083939757 11:65889284-65889306 CAGCATCAGTGGGGGTGGAGAGG - Intergenic
1084043807 11:66557614-66557636 CAGCCTGGGTGTGGGTGGAGAGG + Intronic
1084216457 11:67649244-67649266 CAGCCTCTGTGGGGGTTGGGGGG - Intronic
1084266738 11:68008875-68008897 AAGCTGCTGTGGGTGTGGACAGG - Intronic
1084425737 11:69083763-69083785 CAGGCTGTGTGGGTGTGTAGAGG + Intronic
1084665413 11:70573704-70573726 CTGCCCCTGAGGGTGAGGAGGGG + Intronic
1084830733 11:71767220-71767242 AATCCTTTGTGGGTGTGTAGGGG - Intergenic
1085914659 11:80870821-80870843 CAGGCTCTGTGTATGTGGATGGG + Intergenic
1086508370 11:87529002-87529024 CAGGCTCTGAGGGTGGGAAGAGG + Intergenic
1088722561 11:112607381-112607403 CATTCTCTCTGGGTGAGGAGAGG + Intergenic
1088749830 11:112834323-112834345 CAGCCTGAGTGGGTGAGGTGAGG - Intergenic
1088788563 11:113204210-113204232 CAGCCACTGTCAGTCTGGAGGGG + Intronic
1088811571 11:113396029-113396051 CAGGCTATGTGGGTGCTGAGAGG - Intronic
1089161306 11:116439659-116439681 CAGACTCTGGGGGTGGGGTGGGG + Intergenic
1089498789 11:118921125-118921147 GAGCCTCTGTGGGTCTGAAGGGG - Intronic
1089778917 11:120859503-120859525 CGGGCTCTGTGTGTGGGGAGAGG + Intronic
1090076182 11:123581383-123581405 CGGCCTCTGGGGGTGAGAAGGGG - Intronic
1090397910 11:126431521-126431543 CAGACTCTGTGGGAGAGAAGCGG + Exonic
1090972205 11:131653547-131653569 CAGCCACTGTGGCAGGGGAGAGG - Intronic
1091215379 11:133898339-133898361 CAGGCAGTGTGGGTGGGGAGGGG - Intergenic
1091409867 12:232322-232344 AAGCCACTGTGGTTCTGGAGGGG - Intronic
1091820137 12:3470189-3470211 GATGCTCTGTGTGTGTGGAGAGG + Intronic
1092113712 12:5983124-5983146 AGGCCTCTGTGGATGAGGAGGGG - Intronic
1092137168 12:6158335-6158357 CAGCTCCTGTGGGAGTGAAGTGG - Intergenic
1092182028 12:6452529-6452551 CTGCCTCTGTGGCTGTGGTCAGG + Intronic
1094108320 12:26835760-26835782 ATACCTCTGTGGGTGTTGAGTGG - Intergenic
1094288831 12:28823063-28823085 TAGCCTATGTGGCAGTGGAGTGG + Intergenic
1094781977 12:33802146-33802168 CAGCCTCTGCTGGTCTGGAGTGG - Intergenic
1096252125 12:50040153-50040175 CAGCCTCTGGCGGTGGGTAGGGG - Intergenic
1097055147 12:56244641-56244663 CCGCTGCTGTGGGTGTGTAGGGG - Exonic
1097685363 12:62686052-62686074 CAGCATTCGTGGGAGTGGAGAGG - Intronic
1097918192 12:65042024-65042046 CTGCATCTGGGGGAGTGGAGAGG + Intergenic
1100501717 12:95180770-95180792 CAGACTCTGTGTGTGTCGGGGGG - Intronic
1100874575 12:98948770-98948792 CAGCATGTGTGTGTGTGGGGGGG - Intronic
1101512084 12:105402486-105402508 CAGACTCTGGGGGTGTTGTGAGG + Intergenic
1101706295 12:107224132-107224154 TAGTCTCTGGGGGTGAGGAGTGG + Intergenic
1101911308 12:108862056-108862078 TAGCCTCTGATGGGGTGGAGTGG + Intronic
1102210567 12:111123845-111123867 CACCCTCTGTGGGTTTTAAGAGG - Intronic
1102751421 12:115298028-115298050 CATTGGCTGTGGGTGTGGAGAGG - Intergenic
1102873584 12:116432653-116432675 AAGCCACTGTGGGTTTGGGGTGG + Intergenic
1103562129 12:121798259-121798281 CAGCCCCTGTGGATGGGGAAAGG + Intronic
1103850232 12:123928297-123928319 GCCCTTCTGTGGGTGTGGAGTGG + Exonic
1104611582 12:130233101-130233123 CAGCATCTGGGAGTGGGGAGCGG + Intergenic
1104730815 12:131104370-131104392 CGGCCACTGTGGGAATGGAGAGG + Intronic
1104797162 12:131527924-131527946 CAGCCCCTGAGGGTGTGGCCAGG + Intergenic
1105006861 12:132726865-132726887 CAGACGCTGTGGATGAGGAGGGG - Exonic
1105018170 12:132798775-132798797 GAGCCCCTGTGGGTGAGGAGGGG + Intronic
1105433323 13:20357236-20357258 CAGCCTAAGTGGGTGTGGCTGGG + Intergenic
1105548692 13:21371369-21371391 GAGCCTCTCTAGATGTGGAGAGG - Intergenic
1105795553 13:23848813-23848835 GAGTCACTGAGGGTGTGGAGAGG - Intronic
1106161119 13:27202194-27202216 TTTCCTCTGTGTGTGTGGAGAGG + Intergenic
1106693019 13:32139358-32139380 AAGCATCTGTGGCTGGGGAGGGG - Intronic
1107541460 13:41393174-41393196 CTGACTCTGGGGGTGTGTAGGGG + Intergenic
1107542803 13:41408790-41408812 CTGATTCTGTGGGTCTGGAGTGG - Intergenic
1108091275 13:46852469-46852491 TAGCCCCTGTGTGTTTGGAGTGG + Intronic
1108705448 13:52981419-52981441 GAGTCTCTTTGGGAGTGGAGGGG - Intergenic
1110046605 13:70840993-70841015 CCGTCTCTTTGGGTGTGGATCGG + Intergenic
1112146262 13:96703918-96703940 CAGCTTGTGGGGGTGGGGAGAGG - Intronic
1113056705 13:106275829-106275851 CAGCCTCAGTCAGGGTGGAGCGG + Intergenic
1115300720 14:31882265-31882287 CAGCCACTGTGGGAGTGGAGAGG - Intergenic
1115404137 14:32996567-32996589 CAGCCACTGTGGGAGTGGCTGGG - Intronic
1116196545 14:41734534-41734556 CAGTCTCTGTGTGTGCAGAGAGG + Intronic
1118248780 14:64137986-64138008 CAGCCTTTTTGGGGGTGGATTGG + Intronic
1118295680 14:64566714-64566736 CAGCCTGTATGTGTGTGCAGAGG - Intronic
1118846069 14:69548705-69548727 CAGCCTGTTTGTGGGTGGAGTGG - Intergenic
1119525557 14:75319989-75320011 CAGCCTGGGTGGGTTTGGAAAGG - Intergenic
1120067069 14:80055181-80055203 CAGCATATGTGGGTGTTGTGAGG + Intergenic
1121657158 14:95605466-95605488 GTGTCTCTGTGTGTGTGGAGGGG + Intergenic
1122078945 14:99253792-99253814 CTGCCTCTGTGGGAGTTCAGGGG - Intronic
1122114602 14:99521536-99521558 GAGCCTTGGTGGGTGTGTAGCGG - Intronic
1122326768 14:100885340-100885362 CAGCCACCTTGGTTGTGGAGCGG + Intergenic
1122594396 14:102879147-102879169 CAGCCTCTGAGGGTGTGCCCAGG - Intronic
1123116778 14:105898481-105898503 CAGCCTCTGTGGCTGTTTGGTGG + Intergenic
1202902146 14_GL000194v1_random:50172-50194 CAGCCTGTGTGGGAGGGGAGTGG + Intergenic
1126957907 15:53955181-53955203 CAGCATCTGTGGCTATGCAGGGG - Intergenic
1128145657 15:65331201-65331223 CAGCTCCGGTGGGTCTGGAGAGG + Exonic
1129450539 15:75648808-75648830 CAGCCTCTGGGGGGTTAGAGGGG - Exonic
1129465446 15:75722045-75722067 CGGCCTGTGAGGGAGTGGAGTGG + Intergenic
1130297032 15:82654665-82654687 CAGCCTCTGTGGGAGGGGCAGGG - Intergenic
1130661812 15:85836852-85836874 CACCCTGTGGGGGTGAGGAGGGG - Intergenic
1131521983 15:93123304-93123326 CTGATTCTGTGGGTCTGGAGTGG + Intergenic
1131685409 15:94762239-94762261 CAGCCTCTATGGAGGTGGAGAGG + Intergenic
1132350860 15:101138963-101138985 CTGGCTCTTTGGGTGGGGAGAGG + Intergenic
1132758994 16:1499920-1499942 CAGCTTCTGCGGGAGGGGAGGGG + Intronic
1133232784 16:4374338-4374360 CAGCCTCCCTGGGTGTGAGGAGG + Intronic
1133744442 16:8675777-8675799 CAGCCTTTGTGCGTGTGTTGGGG - Intronic
1134014261 16:10877759-10877781 CTGCTTCTCTGGGTATGGAGTGG - Intronic
1134084762 16:11348806-11348828 CACCCTCTGTCTGTGTGCAGTGG + Intronic
1134311021 16:13075331-13075353 CAGCCTCTCTGTCTCTGGAGGGG - Intronic
1135641798 16:24126083-24126105 CAGGCTCTGTGGATCTGCAGTGG - Intronic
1135960765 16:26993004-26993026 CAGCCTCTAGGGGTGGGGTGGGG - Intergenic
1137511892 16:49107900-49107922 CATCCTCTGTGGCCCTGGAGTGG - Intergenic
1137566746 16:49538069-49538091 CTGCCTCTGTGGGTCAGGAGTGG - Intronic
1137923959 16:52521803-52521825 CAGAAACTCTGGGTGTGGAGCGG + Intronic
1139019199 16:62726143-62726165 CAGTCTCTGTAGGTGTGGGAAGG - Intergenic
1140354340 16:74292449-74292471 CAGCCTCTGTAGGCCTGGAAAGG - Intergenic
1142088218 16:88195859-88195881 CAGCCTCTGTGGGTTTGGGAAGG + Intergenic
1142542729 17:673237-673259 CACCCTCAGTGGATGTGGTGAGG - Intronic
1142748733 17:1974706-1974728 CAGCCTGTGGGGGTGGGGAGGGG + Intronic
1142757382 17:2024293-2024315 CAGCGGCTGAGGGTGGGGAGCGG - Intronic
1142784826 17:2212815-2212837 CTGGCTCTGTGAGTGTGGACTGG - Intronic
1142795707 17:2304963-2304985 AAGCCTATGGGGCTGTGGAGGGG - Intronic
1142941076 17:3380154-3380176 TAGCCTCTGTGGGTGAGCTGTGG + Intergenic
1143226125 17:5305365-5305387 CAGGCTTTGTGGGTATAGAGTGG + Intronic
1143400334 17:6638983-6639005 CAGCCTGTGTGGGTGGAGACAGG - Intronic
1143408907 17:6696745-6696767 CAGCCACTGTTGGTTTGAAGGGG + Intronic
1143786336 17:9258545-9258567 CAGGCACTGGGGGTGTGGAGAGG + Intronic
1144353515 17:14422447-14422469 CAGGATTTGGGGGTGTGGAGTGG - Intergenic
1144398122 17:14865766-14865788 CAGCAGCTCTGGTTGTGGAGAGG - Intergenic
1144514737 17:15909600-15909622 AAGCCTGTGTGGGTGTGAATGGG - Intergenic
1144960219 17:19040436-19040458 CAGCCTCTGTGGGGGAGGCTGGG + Intronic
1144974941 17:19134088-19134110 CAGCCTCTGTGGGGGAGGCTGGG - Intronic
1145398898 17:22515712-22515734 CAGCCTCTGTGGTCTTTGAGAGG + Intergenic
1145773188 17:27508176-27508198 GAGCTTCTGTTGGGGTGGAGTGG + Intronic
1146509995 17:33438802-33438824 CAGCCTCTGGGGTTCTGGGGTGG + Intronic
1146832312 17:36080922-36080944 CAGCCGCTGTGTGACTGGAGGGG + Intergenic
1146846796 17:36187245-36187267 CAGCCGCTGTGTGACTGGAGGGG + Intronic
1147438743 17:40433841-40433863 CTGCCTCTGGAGGTGGGGAGCGG + Intergenic
1147862917 17:43533980-43534002 AAGCTACTGTGGGGGTGGAGGGG + Exonic
1148354786 17:46968557-46968579 CATCCTCTGTGTTTGTCGAGAGG - Intronic
1150573676 17:66410971-66410993 CAGGCTCTGTGGGTGGGTAAGGG - Intronic
1151332947 17:73421986-73422008 CAGCCCATGCGGATGTGGAGTGG + Intronic
1151460904 17:74253430-74253452 CAGCACATGTGGGTGTGGAGGGG - Intronic
1151977743 17:77492014-77492036 CTGCCTCGGTGGGTGTGGGTGGG + Intronic
1152199707 17:78938220-78938242 CAGCCAATGTGGAAGTGGAGAGG + Intergenic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152513969 17:80811318-80811340 CTTCCTCTGTGTCTGTGGAGGGG + Intronic
1152557159 17:81059127-81059149 CAGCCTGTGGGGGCGTGGGGGGG - Intronic
1152759461 17:82100396-82100418 CAGCCTTTGTCTGTGTGGTGTGG + Intergenic
1152855351 17:82662502-82662524 CAGCCCCAGTGGGTGTGGGGAGG + Intronic
1153226610 18:2905282-2905304 CTGCCTCTGTGGGTGGGGCGGGG + Intronic
1153411981 18:4803376-4803398 CAGCTCCTGTTGGTGTTGAGGGG + Intergenic
1154012519 18:10587901-10587923 GGGGCTCTGTGGGGGTGGAGTGG + Intergenic
1154498475 18:14980085-14980107 CAGCCACTCTGTGTGTGGAGTGG - Intergenic
1154502529 18:15003863-15003885 CAACCCCTGGGGGTGTGCAGAGG - Intergenic
1155088522 18:22482598-22482620 AAACCTTTGTGGGTGTGAAGGGG + Intergenic
1155117444 18:22783699-22783721 CAACCCCTGTGGGTGGGCAGGGG + Intergenic
1156315633 18:35966485-35966507 CAGTCTCTGTGCATGTGAAGTGG + Intergenic
1156346728 18:36263687-36263709 CTGTCTCTGTGGATGGGGAGAGG + Intronic
1157434323 18:47655468-47655490 GAGGCTCTGTGGGTGGGGATTGG - Intergenic
1157488287 18:48105017-48105039 CCGCCTCTGTGGTTCTGCAGGGG + Intronic
1157620951 18:49017250-49017272 CAGGGTGTGTGTGTGTGGAGGGG + Intergenic
1159670721 18:71217586-71217608 CAGCCTCTCTGCATGTGCAGCGG + Intergenic
1160799331 19:960511-960533 CAGCCTCTGTGTTTAGGGAGTGG + Intronic
1160855324 19:1214714-1214736 GAGCCTGGGTGGGTGTGGGGTGG + Intronic
1160859413 19:1231322-1231344 CATTCTGTGTGTGTGTGGAGCGG - Intronic
1160963147 19:1733590-1733612 CAGCGTCTGTGGGCCTGGCGGGG - Intergenic
1160979656 19:1811210-1811232 CAGCCTGGGGGGGTGAGGAGGGG - Intronic
1161064472 19:2230929-2230951 CAGCTGCTGTGGGTGTGCTGGGG + Exonic
1161114423 19:2488860-2488882 CAGACACTCTGGGGGTGGAGAGG + Intergenic
1161264537 19:3358375-3358397 GATCCTCAGTGTGTGTGGAGGGG + Intergenic
1161322194 19:3646449-3646471 CAGCCTCCTTGGGTGAGGAGTGG + Intronic
1161397561 19:4052584-4052606 CAGCCTCGGTGGGCGTGGCTGGG + Intronic
1162032615 19:7924002-7924024 CAGCGTTTGTGGGTCTGGTGCGG - Intergenic
1162052150 19:8041070-8041092 CAGCCTCTATTGGTGGGGAAGGG + Intronic
1162475965 19:10899484-10899506 GGGCCTCTGTGGGTGTAGTGAGG + Intronic
1162964501 19:14149544-14149566 AAGCATCTTTGGGTGTGAAGAGG + Exonic
1163362306 19:16854687-16854709 CAGCCTGAGTGAGTGTGGCGGGG + Intronic
1163365884 19:16875983-16876005 CTTCCTCTGTGGGTGAGGTGGGG + Intronic
1163443030 19:17331093-17331115 CAGCCTCTGTGAATGTGTACAGG + Exonic
1163696735 19:18768122-18768144 CAGCCCCTGTGGGTGCTGCGGGG - Intronic
1163737752 19:18991820-18991842 CAGCCTGTGGGGGCCTGGAGTGG - Intronic
1163829159 19:19539662-19539684 TGGCGTCTGTGGGTGAGGAGTGG - Exonic
1164827348 19:31293416-31293438 TAGCATCTCTGTGTGTGGAGGGG - Intronic
1164853274 19:31501892-31501914 CAGCCTCTGTCTTTCTGGAGTGG + Intergenic
1165433823 19:35786404-35786426 CAGCCTCTGGAGGCCTGGAGGGG - Intronic
1165828199 19:38717556-38717578 CGGGTTGTGTGGGTGTGGAGTGG + Intronic
1166284302 19:41814306-41814328 TTGCCTCTGTGGGTGGGAAGTGG - Intergenic
1166301934 19:41915891-41915913 CAGCCCCAGTGGCTGTGGATGGG + Intronic
1167044624 19:47042422-47042444 CAGACTCTATGGGGGAGGAGGGG + Intronic
1167249918 19:48394214-48394236 CAAGCTCTGGGGGTGTTGAGGGG + Intergenic
1167260338 19:48454505-48454527 AAGCCTCTGTGGGTGCTGAGGGG - Exonic
1167423055 19:49415032-49415054 CAGCCTCTGTGGGTGTGGAGTGG - Intronic
1167727125 19:51223897-51223919 CAGCATGTGTGTGTGTGGTGAGG + Intergenic
1168009916 19:53521735-53521757 GAGCGTCTGTGGGTGTGAAAGGG + Exonic
924991414 2:315858-315880 AAGCTTCTCTGGGTGTGGGGGGG + Intergenic
925237435 2:2292073-2292095 TTCCCTCTGTTGGTGTGGAGCGG + Intronic
925413236 2:3652123-3652145 CCGCCTCGGTGCGTGTGGAAGGG + Intergenic
925618657 2:5768806-5768828 CAGACTCTCTGTGTGTGGAAGGG - Intergenic
925719165 2:6811484-6811506 CAGCCTCTGTGTGAGAGCAGGGG + Intergenic
925884427 2:8382260-8382282 CAGCCTTTGTGTGTGTGGCAGGG - Intergenic
927101620 2:19791912-19791934 TAGCCTCATTGGCTGTGGAGAGG - Intergenic
927651374 2:24915501-24915523 CAGCCTGTGTTGCTGTGGGGAGG - Intronic
928166937 2:28978638-28978660 TATCCCCTGTGGATGTGGAGGGG + Intronic
928806442 2:35162290-35162312 CAGTCTCTGTGTGTGTGGTGGGG - Intergenic
929026428 2:37607888-37607910 GAGCCTGTGTGTGTGTGGGGAGG - Intergenic
929834120 2:45378800-45378822 CATCCTTAGTGGGTGTGAAGTGG - Intergenic
930060399 2:47283734-47283756 CTGCCTCTGTTGGGGTGCAGGGG + Intergenic
930163849 2:48184293-48184315 CAGCCTCAGTGGGAATGGAAAGG - Intergenic
931235719 2:60410914-60410936 CAGCCCCTGTGGGTGGGGGGGGG + Intergenic
932161566 2:69465106-69465128 CAGTTTCTGTGGGTGGGGCGGGG + Intronic
932306614 2:70708105-70708127 CAGTCTCTCTGGGTGGGGTGAGG + Intronic
932598274 2:73107639-73107661 CAGCGTCTTGGGGTGTGGGGCGG - Intronic
932796152 2:74697979-74698001 CATCTTCTCTGGGTCTGGAGAGG - Intergenic
932801738 2:74747522-74747544 CAGCCCCTGTGGGTAAGGGGAGG - Intergenic
933768083 2:85724768-85724790 CAGCCTCTGAGCCTGAGGAGGGG + Intergenic
933870599 2:86562379-86562401 CTGACTCAGTGGGTCTGGAGTGG + Intronic
934504541 2:94880257-94880279 CAGCCTGTGTGGAAGGGGAGTGG - Intergenic
934851848 2:97706884-97706906 CAGGGTGTGGGGGTGTGGAGGGG + Intergenic
937448784 2:121982697-121982719 CAGCTTCTGTGGGTGGGGTCTGG - Intergenic
937476285 2:122218306-122218328 CAGCCTCAGAGGGAATGGAGGGG - Intergenic
938014636 2:127857498-127857520 CTGCCTCTGTGGGAGGGTAGGGG + Intronic
938140649 2:128791875-128791897 CAGACCCTGCGGGTGTGGAGCGG + Intergenic
938176993 2:129142818-129142840 CAGACACGGTGGGAGTGGAGTGG - Intergenic
938224527 2:129604512-129604534 CAGCCTCTGCAGATGGGGAGAGG + Intergenic
938476282 2:131617158-131617180 CAGAATCTCTGGGTGTGTAGAGG - Intergenic
938501704 2:131834034-131834056 CAACCCCTGGGGGTGTGCAGAGG - Intergenic
940048370 2:149434690-149434712 GAGCCTCTGTGGGAGTGGATGGG - Intronic
940778754 2:157911038-157911060 ATGCCTCTGTTGATGTGGAGAGG - Intronic
942217002 2:173731319-173731341 TTGCGTCTGTGTGTGTGGAGTGG + Intergenic
946026647 2:216675828-216675850 CAGCCTCTGTGGGGGAGGATAGG - Exonic
946415301 2:219537180-219537202 CAGCTTGTGTGGGGGTGGATCGG + Intronic
947097166 2:226579083-226579105 CACCCTCTGTGGGTTATGAGAGG + Intergenic
947813897 2:233023311-233023333 CAATCCCAGTGGGTGTGGAGGGG - Intergenic
947985806 2:234446607-234446629 CTGGCCTTGTGGGTGTGGAGTGG + Intergenic
947990010 2:234479304-234479326 CTGCCTCAGTGGGCGTGGAAGGG + Intergenic
948491524 2:238316126-238316148 AAGCTTCTGTGGGTTGGGAGTGG + Intergenic
948523954 2:238559119-238559141 CTGCATCTGTGGGTGGGGAGGGG - Intergenic
948920717 2:241064734-241064756 CCTCCTGCGTGGGTGTGGAGGGG - Intronic
949005159 2:241641810-241641832 AGGCCTCTGCGGGTGTGGAGAGG + Intronic
1168941123 20:1712152-1712174 CAGCCCCTGTGGGTGTTGTGGGG - Intergenic
1170714203 20:18817924-18817946 CAACGGCTGCGGGTGTGGAGCGG + Intronic
1170763977 20:19274671-19274693 CACCCTCTGTGGATGAAGAGGGG - Intronic
1170849816 20:19994628-19994650 CAATCTTTGTGGGGGTGGAGGGG - Intronic
1171095695 20:22330743-22330765 CAGCCTCTCTGGGCTTGGTGTGG + Intergenic
1172115619 20:32571860-32571882 CAGCCTCGGCTGATGTGGAGTGG + Intronic
1172313040 20:33932768-33932790 CAGCCCAGGTGGGTGGGGAGGGG + Intergenic
1173658207 20:44715481-44715503 CTGACTATTTGGGTGTGGAGGGG + Intronic
1174087587 20:48020041-48020063 CAGGGTCTGTGGGTGTACAGAGG + Intergenic
1174111496 20:48200967-48200989 CAGCCTGTTTGGACGTGGAGAGG - Intergenic
1174130246 20:48339483-48339505 CAGGCTTTGTGTGTGTGGCGGGG - Intergenic
1174600211 20:51718358-51718380 CACCCTATGTGTGTGTGGGGGGG + Intronic
1174611496 20:51801707-51801729 CAGCTCCTGAGGGTGGGGAGAGG + Intronic
1175087000 20:56468319-56468341 CAGCTTGTGTGGCTGCGGAGCGG - Intergenic
1175208420 20:57329743-57329765 CCGCCTCTGGGTGTGTGGCGTGG + Exonic
1175430591 20:58899859-58899881 CAGCTTCTGTGGCCGGGGAGGGG + Intronic
1175834371 20:61984205-61984227 CAGCGTCTGTGGGTGTGCTGTGG - Intronic
1176094362 20:63333157-63333179 CTGCCTCTGGGGGTGGAGAGGGG - Intronic
1176253456 20:64138156-64138178 CAGGGTCTGTGGGGGTGGGGAGG + Intergenic
1176273611 20:64249704-64249726 CAGGCTCTGTTGGAGTGCAGTGG + Intergenic
1176621515 21:9064939-9064961 CAGCCTGTGTGGGAGGGGAGTGG + Intergenic
1177357900 21:20032006-20032028 CAGGCTCTGGGAGTGGGGAGAGG + Intergenic
1177781066 21:25622738-25622760 CAGCCTCGGTGGGGATGGTGGGG + Intergenic
1178445001 21:32631652-32631674 CAACCTCTTTGGGTCTGGGGTGG + Exonic
1178728977 21:35081617-35081639 TAGCATCTGTGGGTGGGGTGAGG - Intronic
1179299089 21:40090439-40090461 CAGCATCAGTGGGTGTGGAGGGG - Intronic
1179447612 21:41443991-41444013 CAGATTCTGTGGGTCTGGAGTGG + Intronic
1179613435 21:42566682-42566704 CAGCAGCTGTGGGTGAGGAGAGG + Intronic
1179940503 21:44636692-44636714 CAGGGTCTGAGGGTGGGGAGGGG - Intronic
1179959992 21:44762758-44762780 CAGCCCCTGTGGGAGGAGAGAGG + Intergenic
1180079101 21:45478159-45478181 CAGCCCTTGTGGGTGTGAGGAGG + Intronic
1180169760 21:46051896-46051918 CAAGATCTGTGGGTGTGGGGTGG + Intergenic
1180844079 22:18972060-18972082 CAGCCCTGGTGGGTGCGGAGTGG - Intergenic
1181116594 22:20635653-20635675 TAGCCCCGGTGGGTATGGAGGGG + Intergenic
1181427713 22:22855227-22855249 CAGCCACTGTCTGTGTGGGGAGG + Intronic
1181572093 22:23773144-23773166 CAGTCCCTGGGGGTGTGAAGGGG + Intronic
1181743373 22:24939073-24939095 CTGTCTCTGTAGGCGTGGAGTGG - Intronic
1182245643 22:28955471-28955493 CAGCCTCTGTGGATCAGCAGTGG + Intronic
1182397883 22:30049660-30049682 CTGCCTCTGGTGGTGTGGTGGGG + Intergenic
1182398344 22:30053861-30053883 CAGGGACTGTGGGTGAGGAGAGG + Intergenic
1182762671 22:32735139-32735161 CTGGCTCTGTGTGTGTTGAGGGG + Intronic
1183060803 22:35335339-35335361 CTGGATTTGTGGGTGTGGAGAGG - Intronic
1183243481 22:36675576-36675598 CAGGCTCTGTGGCTGTTGAATGG - Intronic
1183600246 22:38835758-38835780 CAGCCTCTGTGGCTGTGGGCAGG + Intronic
1183652943 22:39169462-39169484 CTGACTCAGTGGGTGTGGGGTGG - Intergenic
1183974373 22:41502320-41502342 CTGACTCAGTGGGTCTGGAGTGG - Intronic
1184313527 22:43664686-43664708 CAGCCTCTGTCTGAGGGGAGAGG + Intronic
1184655565 22:45940360-45940382 CTGTCCCGGTGGGTGTGGAGTGG - Intronic
1184754911 22:46510308-46510330 CAGCCTCTGTGGCTCAGGAAGGG - Intronic
1185054053 22:48568865-48568887 CAGCCTCTGGGGCTGGGGTGGGG + Intronic
1185075517 22:48680089-48680111 CAGCCCCGGTGGGTGTGGATGGG + Intronic
1185269514 22:49922696-49922718 GCGCCTGTGTGGGTGAGGAGCGG + Exonic
949745799 3:7290954-7290976 CAGCACCTGGGGGTGGGGAGGGG - Intronic
950358710 3:12434800-12434822 CTGGCTCTGTGGGTGCGCAGTGG - Intergenic
950416517 3:12872202-12872224 CAGGCAGTGTGAGTGTGGAGAGG - Intergenic
950534455 3:13571105-13571127 CAGCCGCTGTGGGCCTGGGGAGG - Exonic
950555642 3:13694336-13694358 CAACCTCTGGAGGTGTGGGGAGG + Intergenic
951078002 3:18420677-18420699 CACACTGTGTGGGGGTGGAGTGG - Intronic
951467756 3:23020437-23020459 CATCCACTGTGGGGGTGGATTGG - Intergenic
952833898 3:37588410-37588432 CAGCCTCTGTGGGGAGGGGGTGG - Intronic
952836657 3:37608109-37608131 CAGGCACTCTGGGTGTGGATGGG + Intronic
952901055 3:38111998-38112020 CAGCCTCTCAGGGAGTAGAGAGG + Intronic
953855790 3:46498456-46498478 CAGTCTGTGGGGGTGGGGAGAGG + Intronic
954307325 3:49735495-49735517 CAGCCTCTTGGGGAGTGAAGGGG + Intronic
954315471 3:49799037-49799059 CACTCTCTGTGGATGTGCAGCGG - Exonic
954420980 3:50418861-50418883 GAGCCTTTGCGGGTATGGAGGGG + Intronic
954662790 3:52234959-52234981 CTGCCTCTGTGGGTGGGGGAAGG - Intronic
955058649 3:55477492-55477514 CTGTCTCAGAGGGTGTGGAGAGG + Intronic
956465774 3:69519388-69519410 CAGCATCTGTGTGTGTGTGGCGG + Intronic
956646773 3:71464508-71464530 CAGCCTCTTTGGGAGTTGACTGG + Intronic
961089171 3:124094673-124094695 CAGCCTCTGTGTGGGAGGACTGG + Exonic
961481939 3:127186665-127186687 CATCCTAAGTGGGTGTGAAGTGG + Intergenic
961633957 3:128321396-128321418 CAGCCACAGTGGGTGGAGAGGGG + Intronic
961809991 3:129516191-129516213 CAGTCTCCGTGTGTGTGCAGGGG - Intronic
961809994 3:129516214-129516236 CAGTCTGTGTGTGTGTGCAGAGG - Intronic
961810002 3:129516316-129516338 CAGTCTCTGTGTGTGTGCAGGGG - Intronic
961810012 3:129516414-129516436 CAGTCTGTGTGTGTGTGCAGGGG - Intronic
961810036 3:129516589-129516611 CAGTCTCTGTGTGTGTGCAGGGG - Intronic
961810073 3:129516936-129516958 CAGTCTCTGTGTGTGTGCAGGGG - Intronic
961810096 3:129517144-129517166 CAGTCTCCGTGTGTGTGCAGGGG - Intronic
961810099 3:129517167-129517189 CAGTCTCTGTGTGTGTGCAGAGG - Intronic
961810100 3:129517190-129517212 CAGTCTGTGTGTGTGTGTAGGGG - Intronic
961818022 3:129561294-129561316 GGGCGTCTGAGGGTGTGGAGGGG + Intronic
962676703 3:137763329-137763351 CAGCCTCCCTGGGTGGGAAGAGG + Intergenic
964406148 3:156351587-156351609 CAGCCTGTTTGGAGGTGGAGAGG + Intronic
965740231 3:171866554-171866576 CAGCAACAGTGGGTATGGAGAGG + Intronic
965945024 3:174230676-174230698 CAGCTACTGAGGGGGTGGAGGGG + Intronic
968230016 3:197000012-197000034 CTCCCTCTGTGGGTGGGGTGTGG + Intronic
968698410 4:2043495-2043517 CAGGCTCTGTGAGTGGGGAGAGG - Intronic
968736670 4:2300828-2300850 CAGCCCCTGTGGTTGTGGCGTGG - Intronic
969155110 4:5203391-5203413 CAGCTACAGTGGGTGTGGAGGGG - Intronic
969371501 4:6734159-6734181 CACCATGTGTGGGTGTGGATTGG + Intergenic
969498116 4:7537648-7537670 GAGCCTCTGAGGGTCTGGTGGGG + Intronic
969593418 4:8134423-8134445 GAGGGGCTGTGGGTGTGGAGAGG - Intronic
970870873 4:20815554-20815576 AAGGCTCTGTGGGCTTGGAGGGG - Intronic
975718357 4:77227278-77227300 CAGCCACTGTGGGAGGGGATAGG + Intronic
976129491 4:81870006-81870028 CTGCCTCTGTGGGTGAAGAGTGG + Intronic
976428617 4:84936228-84936250 CATACTCTTTGGGTGGGGAGTGG + Intronic
978062229 4:104352158-104352180 CAGCCTCTTTGGGGGTCTAGGGG - Intergenic
979279510 4:118849567-118849589 CATCTTCTCTGGGTGTAGAGAGG + Intergenic
980663988 4:135904426-135904448 CAGCCTCTCTGGGTGTTCTGTGG + Intergenic
981693856 4:147539455-147539477 CTGCCTGTGTGTGTGTGTAGTGG - Intronic
982033775 4:151325739-151325761 CAGCGTGTGTGGCTGTGGGGCGG - Intergenic
983007089 4:162496554-162496576 CAGCCTCTCTGGGGGTGAGGAGG - Intergenic
984353166 4:178621762-178621784 CTGCCTCTGTGGCTTTGCAGGGG + Intergenic
985485541 5:146353-146375 GAACCACTGTGGGGGTGGAGAGG - Intronic
985868635 5:2536444-2536466 CTGCTGCTGTGGGTGAGGAGAGG - Intergenic
985889895 5:2707187-2707209 CAGCCTCTGGGAGTGATGAGTGG - Intergenic
985996943 5:3602353-3602375 CAGCATCAGTGGGTTCGGAGCGG + Intergenic
986064502 5:4222666-4222688 CAGCTTCTGGAGGTGTGCAGAGG - Intergenic
986077616 5:4354278-4354300 CAGCCTCGATGGGAGGGGAGGGG - Intergenic
986247075 5:6018645-6018667 CAGCCACTGTGGGTGGGAATGGG + Intergenic
987109110 5:14668197-14668219 CAGCATCTGGGGGTGGGGTGGGG - Intronic
989468509 5:41786236-41786258 CTCTCTCTGTGTGTGTGGAGTGG - Intronic
993703425 5:91144025-91144047 CAGGCACTGGGAGTGTGGAGAGG + Intronic
994058472 5:95446972-95446994 CAGACTCTCTGGGTCTGGGGTGG - Intronic
995179544 5:109218189-109218211 CAGTGTGTGTGAGTGTGGAGTGG - Intergenic
996198893 5:120645386-120645408 CTGCCTGTGTGTGTGTGGGGGGG - Intronic
996646488 5:125824387-125824409 TTAGCTCTGTGGGTGTGGAGGGG + Intergenic
997228761 5:132228165-132228187 CAGCCCCTGGGCGTCTGGAGAGG + Intronic
997437042 5:133883130-133883152 CAGCCGCTGTGGCTGAGAAGGGG + Intergenic
998416689 5:141951409-141951431 CAGCCTCTGTGAGTGAGGAAGGG - Intronic
998598839 5:143563196-143563218 CAGCCTCTGGGACTGAGGAGAGG - Intergenic
999277256 5:150339421-150339443 CAGAATATGTGGGGGTGGAGGGG + Intergenic
999460495 5:151753733-151753755 CTGACTCTGTGGATGTGGAGCGG + Intronic
999758430 5:154682572-154682594 CTGCCTCTGTGGGATGGGAGGGG - Intergenic
1001931647 5:175677531-175677553 CAGCCACTCTGGGCTTGGAGAGG + Intronic
1002172900 5:177385272-177385294 CAGCCTGTTTGGGGCTGGAGGGG - Intronic
1002327877 5:178421475-178421497 CAGACTTTGATGGTGTGGAGTGG - Intronic
1005252284 6:23961318-23961340 CTGCCTCTGTGGCTGTTGTGAGG - Intergenic
1005851988 6:29829023-29829045 AAGTCTCTGAGGGAGTGGAGGGG + Intronic
1005875591 6:30007800-30007822 AAGTCTCTGAGGGAGTGGAGGGG + Intergenic
1006361036 6:33587289-33587311 GAGCCTATGTGTGTTTGGAGTGG - Intergenic
1006683702 6:35815003-35815025 TAGCCTCTGAGAGTGTAGAGGGG - Intronic
1006986358 6:38178318-38178340 CTGTCTCTGTTGGTGTGCAGAGG - Intronic
1007048500 6:38801692-38801714 AAGAGTCGGTGGGTGTGGAGAGG + Intronic
1007211523 6:40196586-40196608 AAGGCTATGTGGGGGTGGAGTGG + Intergenic
1007513154 6:42390292-42390314 CAAGTTCTGTGTGTGTGGAGGGG + Intronic
1007599488 6:43072936-43072958 ATGCTTCTGTGGCTGTGGAGTGG + Exonic
1007745283 6:44039674-44039696 CTGCCTGTGTGTGTGTGGTGGGG - Intergenic
1007751674 6:44075196-44075218 CATCCTCTGTGTATGTGGGGTGG - Intergenic
1007783747 6:44268749-44268771 GATCCTCTGTGGGTTTGGAAAGG + Intergenic
1008235201 6:49038100-49038122 AAGCCTCTTTGGGTTTGCAGAGG + Intergenic
1010422070 6:75687707-75687729 CAGCCTCTGCTGGTCTGGAGTGG - Intronic
1011965890 6:93156907-93156929 CAGGCTGTGTGGGGGTGGGGTGG - Intergenic
1013146939 6:107403329-107403351 CAGCCCCTGTGGCTTTGCAGAGG + Intronic
1014633942 6:123821663-123821685 AAACCACTGTGGGTGTGTAGAGG + Intronic
1014750077 6:125245586-125245608 CAGCCACTGTGGGGGTTGGGGGG + Intronic
1014777629 6:125528875-125528897 CAGACACTGTGGGTCTGAAGTGG + Intergenic
1016986290 6:149898132-149898154 CAGTCTCTCTGGGTGTGGAGAGG + Intergenic
1017077388 6:150631712-150631734 AAGCATCTGTAGGTGGGGAGCGG - Intronic
1018381191 6:163259847-163259869 CAGCCTCTGGGGGTGGAGCGGGG - Intronic
1018397206 6:163387615-163387637 CACTCTGTGTGTGTGTGGAGCGG - Intergenic
1018670197 6:166170552-166170574 CTGCCTCTCTGGGAGTCGAGTGG - Intergenic
1018995811 6:168709750-168709772 CAGCCTCTGCGGGAGGGCAGGGG - Intergenic
1019042449 6:169118419-169118441 CTGCAACTGTGGGGGTGGAGTGG - Intergenic
1019158911 6:170056673-170056695 CAGGCTCTGTTGGTGTAGGGGGG + Intergenic
1019509212 7:1408944-1408966 CAGCCTCTGTAGATGGGGCGAGG + Intergenic
1019733694 7:2640388-2640410 CCGCCTGTGTGTGTGTGGGGGGG + Intronic
1019764877 7:2843287-2843309 CAGCTTCTGGGGATGGGGAGTGG - Intronic
1019893035 7:3962392-3962414 GAGCCTGTGTGGGTTCGGAGTGG + Intronic
1020277182 7:6631851-6631873 GAGCCTCTGTGTGCCTGGAGTGG - Intergenic
1023453955 7:40318474-40318496 TTGCCTATGTGGGTGTGCAGTGG + Intronic
1023520335 7:41044126-41044148 CTGATTCTGTAGGTGTGGAGAGG - Intergenic
1023817325 7:43961217-43961239 CAGCCTCATTGGTTGTGGAAAGG + Intergenic
1024233976 7:47384212-47384234 CTGCCCATGTGGGTGGGGAGGGG - Intronic
1024252415 7:47516569-47516591 CAGTCACTGTGGGTGTAGAACGG - Intronic
1024532866 7:50407569-50407591 CATGCTCTGTGGGGCTGGAGGGG - Intergenic
1025023554 7:55498105-55498127 TAGCCTCAGTGGATGTGGTGGGG - Intronic
1025069208 7:55884310-55884332 CAACCTTTGTGGGTTTGGAGAGG - Intergenic
1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG + Intergenic
1026850034 7:73718624-73718646 AAGCCTCTCTGGGTGTGTCGGGG - Intronic
1027620359 7:80477737-80477759 CAGCTTCTGTTGGCGGGGAGAGG + Intronic
1029526181 7:101095416-101095438 CCGCTTCTGTGCATGTGGAGGGG + Intergenic
1030928401 7:115487288-115487310 CAGAGTGTGTGGGTGTGGGGTGG + Intergenic
1033237435 7:139649327-139649349 CAGCATCTGCGGGTGTGCACCGG - Intronic
1033499712 7:141935749-141935771 CAGCCTCAGTGGGTGGGATGGGG - Intronic
1033742363 7:144284768-144284790 CCTCCTCTGTGGGGGAGGAGGGG + Intergenic
1033751539 7:144364846-144364868 CCTCCTCTGTGGGGGAGGAGGGG - Exonic
1034700788 7:153094006-153094028 CAGACTGTGTGTGTGTAGAGTGG - Intergenic
1035288261 7:157819844-157819866 CTGCATGTGTGGGTGTGGGGGGG - Intronic
1035310409 7:157964273-157964295 GATCCTCTGTGCGTGTGGGGCGG - Intronic
1035759971 8:2061962-2061984 CAGCAGCTGTGGGTGAGGGGAGG + Intronic
1035785980 8:2261544-2261566 TGGCCTCTGAGGGTATGGAGTGG + Intergenic
1035806827 8:2460172-2460194 TGGCCTCTGAGGGTATGGAGTGG - Intergenic
1037837030 8:22220565-22220587 CAGCCACTGGGGTTGAGGAGGGG - Exonic
1038558126 8:28542683-28542705 TAGCGTGTGTGGGTGTGGTGTGG - Intronic
1038766737 8:30435678-30435700 AAGCCTATGTGGGGGTGGATGGG + Intronic
1039470382 8:37809775-37809797 CAGCCTCTGTGTGTGCTGGGAGG - Intronic
1039881851 8:41630117-41630139 CAGTGACAGTGGGTGTGGAGTGG - Intergenic
1041256145 8:55981040-55981062 GAGTCTCTCTGGGTGTGGTGGGG - Intronic
1042670266 8:71254847-71254869 CAGACTCTGTGTGTGTGGTGGGG - Intronic
1044557439 8:93579045-93579067 CACCATCTGGGGGTGTGCAGGGG + Intergenic
1047229210 8:122981614-122981636 TATCTGCTGTGGGTGTGGAGTGG - Intergenic
1047251635 8:123185437-123185459 AAGCCTCACTGGGTGTGGAGTGG - Intronic
1047624232 8:126639588-126639610 TAGCCTCTAGGGATGTGGAGTGG + Intergenic
1047925129 8:129675398-129675420 CAGCCCCTGTGGGGGTAGAAGGG + Intergenic
1048398064 8:134033834-134033856 CAGCCACTGTGAGGGTGGAATGG - Intergenic
1049433613 8:142576360-142576382 CAGGCTCTGGGGGTGCAGAGGGG - Intergenic
1052691375 9:31820665-31820687 CAGGCACTGGGGGTGGGGAGAGG - Intergenic
1053150284 9:35738898-35738920 CATCATCTGTGGGAGAGGAGGGG + Exonic
1053389872 9:37726914-37726936 AGGCCTCTGGGGGAGTGGAGTGG + Intronic
1053544611 9:39009785-39009807 CTGGGTCTGTGGGTGTGGACTGG - Intergenic
1053809048 9:41833267-41833289 CTGGGTCTGTGGGTGTGGACTGG - Intergenic
1054621544 9:67354161-67354183 CTGGGTCTGTGGGTGTGGACTGG + Intergenic
1055197202 9:73610925-73610947 CAGCCTCAATGGGTGAAGAGAGG + Intergenic
1055818935 9:80238775-80238797 CATCCCCTGTTGGTGTGGGGAGG - Intergenic
1056125214 9:83529939-83529961 CATCCTAAGTGGGTGTGGAGTGG - Intronic
1056461386 9:86812780-86812802 CAGCCTATTTGGGTGTTGACAGG + Intergenic
1057762763 9:97889959-97889981 CAGCCTCAGAGGCTGTGGACCGG - Intergenic
1057892736 9:98881547-98881569 CAGCCCCAGTGGGTGAGGATGGG + Intergenic
1058727929 9:107821338-107821360 AAGCCTCTGTGTGTGGTGAGCGG - Intergenic
1059300435 9:113308233-113308255 CTGCCTCCGTAGGTCTGGAGTGG - Intergenic
1059432681 9:114259568-114259590 GTGCCTCTCTGGGAGTGGAGTGG - Intronic
1060507963 9:124212593-124212615 CAGCGTTTGTGGGGGTGGAGAGG - Intergenic
1060862021 9:126962336-126962358 CAGCCTCAGTACCTGTGGAGTGG - Exonic
1061033650 9:128101678-128101700 GAGCACCTGTGCGTGTGGAGGGG + Intronic
1062023929 9:134331873-134331895 CAGCCTCTGAGGATGCTGAGAGG - Intronic
1062137169 9:134935313-134935335 CAGCCTCCCTGGGACTGGAGGGG + Intergenic
1062216540 9:135392543-135392565 CTGCCTCTGTGGGTGGGCGGCGG - Intergenic
1062463621 9:136671909-136671931 CAGCTTCTGTGGGTGCAGAAGGG - Exonic
1062464002 9:136673292-136673314 CAGGCTCTCTGGGAGAGGAGGGG - Exonic
1203744699 Un_GL000218v1:35351-35373 CAGCCTGTGTGGGAGGGGAGTGG + Intergenic
1203565405 Un_KI270744v1:84133-84155 CAGCCTGTGTGGGAGGGGAGTGG - Intergenic
1185649326 X:1637232-1637254 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649385 X:1637557-1637579 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649414 X:1637722-1637744 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649458 X:1637970-1637992 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649502 X:1638218-1638240 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649531 X:1638383-1638405 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649590 X:1638711-1638733 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649620 X:1638876-1638898 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649648 X:1639041-1639063 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649678 X:1639206-1639228 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649734 X:1639534-1639556 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649764 X:1639699-1639721 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649792 X:1639864-1639886 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649822 X:1640029-1640051 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649851 X:1640194-1640216 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649882 X:1640359-1640381 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649940 X:1640687-1640709 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649970 X:1640852-1640874 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185649999 X:1641017-1641039 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185650030 X:1641182-1641204 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185650059 X:1641347-1641369 CAGCCTCTGTGTGTGTGATAGGG + Intronic
1185650090 X:1641512-1641534 CAGCCTCTGTGTGTGTGTTGGGG + Intronic
1185650106 X:1641595-1641617 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185650230 X:1642257-1642279 CAGCCTCTGTGTGTGTGATGGGG + Intronic
1185650273 X:1642501-1642523 CAGCCTCTGTGTGTGTGTGATGG + Intronic
1185650291 X:1642586-1642608 CAGCCTCTATGTGTGTGATGGGG + Intronic
1185650305 X:1642668-1642690 CAGCCTCTGAGTGTGTGATGGGG + Intronic
1185938554 X:4286934-4286956 CTGTCTCTGTGTGTGTGGGGGGG - Intergenic
1186189647 X:7056179-7056201 CAGCCTCTGCAAGTGGGGAGTGG + Intronic
1186717674 X:12269741-12269763 CTGGCTGTGTGTGTGTGGAGTGG - Intronic
1187485808 X:19702282-19702304 CAACTTTTGTGGGTGTGGATAGG - Intronic
1188177319 X:27007044-27007066 AAGGGTGTGTGGGTGTGGAGAGG + Intergenic
1189010567 X:37042724-37042746 CAGGATCTGCGGGGGTGGAGGGG - Intergenic
1189030239 X:37442353-37442375 CAGGATCTGTGGGGGTGGAGGGG + Intronic
1189037322 X:37506143-37506165 CAGGATCTGCGGGGGTGGAGGGG + Intronic
1189349197 X:40264396-40264418 CCGGCTTTGTGGGTGTTGAGAGG + Intergenic
1189600492 X:42619676-42619698 CTGACTCTGTAGGTCTGGAGTGG + Intergenic
1190056851 X:47186162-47186184 CAGCCTCTGTGTGAGTGGCTGGG + Exonic
1190269995 X:48854990-48855012 CAACCACTGTGTGTGTGGGGGGG - Intergenic
1190806641 X:53844203-53844225 CGGGGTCTGTGGGAGTGGAGAGG - Intergenic
1193057429 X:77168493-77168515 CAGCCCCTGTGGGTGTTTGGGGG + Intergenic
1194112683 X:89854423-89854445 CACCCTCTGTGGATGTGTGGAGG + Intergenic
1194199470 X:90937185-90937207 CATCCTGGGTGGGTGTGAAGTGG + Intergenic
1194214444 X:91110969-91110991 CAGCCACTGTGGGTGTTGGGAGG + Intergenic
1194702991 X:97137226-97137248 CAACCTCTGTGTGTGTGGTGGGG + Intronic
1198561867 X:137858919-137858941 CTGCCTCTGAGAGTGAGGAGAGG - Intergenic
1199975789 X:152894261-152894283 CAGCCTCTCAGCATGTGGAGTGG - Intergenic
1200397288 X:155998703-155998725 CAGCCTCTGCAGGTGGGGCGGGG + Intronic
1200465336 Y:3509234-3509256 CACCCTCTGTGGATGTGTGGAGG + Intergenic
1200545463 Y:4513605-4513627 CATCCTGGGTGGGTGTGAAGTGG + Intergenic
1201158041 Y:11150392-11150414 CAGCCTGTGTGGGAGGGGAGTGG + Intergenic