ID: 1167423671

View in Genome Browser
Species Human (GRCh38)
Location 19:49418322-49418344
Sequence CAGAGTCAGGATCCTATCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167423671_1167423676 -4 Left 1167423671 19:49418322-49418344 CCCCCGATAGGATCCTGACTCTG No data
Right 1167423676 19:49418341-49418363 TCTGTCCTGCCACCCCTCCACGG No data
1167423671_1167423677 -3 Left 1167423671 19:49418322-49418344 CCCCCGATAGGATCCTGACTCTG No data
Right 1167423677 19:49418342-49418364 CTGTCCTGCCACCCCTCCACGGG No data
1167423671_1167423682 9 Left 1167423671 19:49418322-49418344 CCCCCGATAGGATCCTGACTCTG No data
Right 1167423682 19:49418354-49418376 CCCTCCACGGGTAGCAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167423671 Original CRISPR CAGAGTCAGGATCCTATCGG GGG (reversed) Intergenic
No off target data available for this crispr