ID: 1167424505

View in Genome Browser
Species Human (GRCh38)
Location 19:49423184-49423206
Sequence TGCCAGTCCCAGAACTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 224}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167424505_1167424514 6 Left 1167424505 19:49423184-49423206 CCCTGGGAGTTCTGGGACTGGCA 0: 1
1: 0
2: 0
3: 22
4: 224
Right 1167424514 19:49423213-49423235 TGAGGACCCCGACCGGGGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 118
1167424505_1167424515 7 Left 1167424505 19:49423184-49423206 CCCTGGGAGTTCTGGGACTGGCA 0: 1
1: 0
2: 0
3: 22
4: 224
Right 1167424515 19:49423214-49423236 GAGGACCCCGACCGGGGGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 103
1167424505_1167424520 19 Left 1167424505 19:49423184-49423206 CCCTGGGAGTTCTGGGACTGGCA 0: 1
1: 0
2: 0
3: 22
4: 224
Right 1167424520 19:49423226-49423248 CGGGGGCAGGGCGACTCCCGAGG 0: 1
1: 0
2: 2
3: 15
4: 152
1167424505_1167424521 27 Left 1167424505 19:49423184-49423206 CCCTGGGAGTTCTGGGACTGGCA 0: 1
1: 0
2: 0
3: 22
4: 224
Right 1167424521 19:49423234-49423256 GGGCGACTCCCGAGGCAGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 143
1167424505_1167424510 0 Left 1167424505 19:49423184-49423206 CCCTGGGAGTTCTGGGACTGGCA 0: 1
1: 0
2: 0
3: 22
4: 224
Right 1167424510 19:49423207-49423229 CCTACCTGAGGACCCCGACCGGG 0: 1
1: 0
2: 0
3: 13
4: 102
1167424505_1167424511 1 Left 1167424505 19:49423184-49423206 CCCTGGGAGTTCTGGGACTGGCA 0: 1
1: 0
2: 0
3: 22
4: 224
Right 1167424511 19:49423208-49423230 CTACCTGAGGACCCCGACCGGGG 0: 1
1: 0
2: 0
3: 4
4: 56
1167424505_1167424508 -1 Left 1167424505 19:49423184-49423206 CCCTGGGAGTTCTGGGACTGGCA 0: 1
1: 0
2: 0
3: 22
4: 224
Right 1167424508 19:49423206-49423228 ACCTACCTGAGGACCCCGACCGG 0: 1
1: 0
2: 1
3: 12
4: 63
1167424505_1167424512 2 Left 1167424505 19:49423184-49423206 CCCTGGGAGTTCTGGGACTGGCA 0: 1
1: 0
2: 0
3: 22
4: 224
Right 1167424512 19:49423209-49423231 TACCTGAGGACCCCGACCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167424505 Original CRISPR TGCCAGTCCCAGAACTCCCA GGG (reversed) Intronic
900194797 1:1370806-1370828 TGCCAAGCCCAGAACCTCCAGGG - Intergenic
900647490 1:3715534-3715556 TGACAGTGCCTGACCTCCCAGGG + Intronic
901231771 1:7645679-7645701 TGCCAGCCCCAGAGCTCCGCTGG + Intronic
901940443 1:12657749-12657771 TGGGTGTCCCAGAACTGCCATGG + Intronic
902332604 1:15738003-15738025 TGCCACTCTCAGAGCTCCCTGGG + Intronic
902895200 1:19474951-19474973 TGCGAGGCCCAGAACTGACAAGG + Intronic
903499571 1:23793838-23793860 TGCCAGTGCCTCTACTCCCAAGG + Exonic
906448270 1:45922248-45922270 CGCCAGTCCCAGAAACCGCAAGG - Intronic
907604528 1:55803547-55803569 TGACAGGGCCAGAAATCCCAAGG - Intergenic
910433986 1:87186743-87186765 TGCCAGTTAAATAACTCCCAAGG - Intergenic
911264408 1:95726273-95726295 TCCCAGCCCCAGGACACCCAAGG + Intergenic
911973063 1:104461482-104461504 TGCCAGTACCAGAACTCTGAAGG - Intergenic
912625320 1:111201288-111201310 TGCCAGTGACAGAACTCTCCAGG - Exonic
912698566 1:111859355-111859377 TGCCAGTCCCAGCCCTTCCCTGG - Intronic
914422629 1:147542846-147542868 TGCCAGCCCCAGAAAACACAAGG - Intronic
915018706 1:152760288-152760310 TGCCAGACCCAGGGCTCCTATGG + Exonic
916561174 1:165935092-165935114 ACCCAGGCCCAGGACTCCCAAGG - Intergenic
917218593 1:172703708-172703730 TGTCATGCCCAGAACTGCCATGG - Intergenic
920862488 1:209721890-209721912 TTCCAGTCCCTGAACTCCAGGGG + Intronic
921298021 1:213722844-213722866 TTCCAGTCCCTGAACTCCATGGG + Intergenic
923461505 1:234213407-234213429 ATGCAGCCCCAGAACTCCCAGGG - Intronic
1065684456 10:28270012-28270034 AGCCAGTCCCAGAATCCCCTAGG + Intronic
1067382493 10:45787716-45787738 TGCCACTCCCTGAACACACATGG + Intronic
1067419739 10:46135035-46135057 TGGGACTCCCAGAACCCCCATGG - Intergenic
1067426279 10:46214376-46214398 TGGGACTCCCAGAACCCCCATGG + Intergenic
1067450695 10:46380328-46380350 TGCCAGGCACAGAGCTGCCAGGG + Intronic
1067505090 10:46841632-46841654 TGGGACTCCCAGAACCCCCATGG - Intergenic
1067586548 10:47479423-47479445 TGCCAGGCACAGAGCTGCCAGGG - Intronic
1067890191 10:50128264-50128286 TGCCACTCCCTGAACACACATGG + Intronic
1069830987 10:71282318-71282340 TGCCTGGCCCAGGACACCCAGGG - Intronic
1071505511 10:86229250-86229272 TGCCAGTCCCCCTCCTCCCAGGG + Intronic
1072135468 10:92541769-92541791 AGCCAGTCCCTGAACTGCAAAGG - Intronic
1072804603 10:98416715-98416737 TCCCAGTCCCAGGGCTCTCAGGG + Exonic
1073246013 10:102090679-102090701 TCCTAGCCCCAGATCTCCCAGGG + Intergenic
1074165023 10:110867507-110867529 CTCCATTCCCAGGACTCCCATGG + Intergenic
1075586353 10:123661084-123661106 TGTCATTCCTACAACTCCCAGGG + Intergenic
1075678787 10:124317734-124317756 AGCCACTCCCAGAACTGACAGGG + Intergenic
1075678896 10:124318376-124318398 AGCCACTCCCAGAACTGACAGGG + Intergenic
1075919862 10:126201626-126201648 TGCCAGTTCCCCATCTCCCAGGG - Intronic
1076247943 10:128962143-128962165 GGGCAGCCCCAGACCTCCCAAGG + Intergenic
1078328621 11:10400630-10400652 AGACAGTCCCAGATCTCCTATGG - Intronic
1078904653 11:15672423-15672445 TACCAGTCCAAGAACTTCCAAGG - Intergenic
1080001337 11:27353877-27353899 TGCCAGTCCCAGTTCTGCCATGG + Intronic
1080026983 11:27625590-27625612 TGCAGCTCCCAGAAGTCCCAGGG - Intergenic
1081439622 11:43065811-43065833 TGCCAGTCAGAGCTCTCCCATGG + Intergenic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1083877471 11:65531855-65531877 GGCCATTCCCAAAACTGCCAAGG - Intronic
1085432759 11:76468854-76468876 TGCAAGTCCCAGCACTCTTAAGG + Intronic
1086841666 11:91693056-91693078 TTCCAGACCCAGATTTCCCAGGG + Intergenic
1089325734 11:117655595-117655617 CCCCAGTGCCAGAAATCCCAGGG + Intronic
1090963137 11:131574656-131574678 TGCCAGTCCCAGAGTTCCTTGGG + Intronic
1091920947 12:4304044-4304066 TTTCAGTCCCAGAGCTCCCAGGG - Exonic
1093187187 12:16034118-16034140 TGCCAGACCCAAAACCACCAGGG - Intronic
1095328497 12:40927677-40927699 TGCAAGTCCCACAAATCCAAAGG + Intronic
1095954760 12:47799644-47799666 TGCCAGGCCCAGAGCTGCCATGG - Intronic
1096025829 12:48360195-48360217 TGCCATTCCCAGGACAACCAAGG - Intergenic
1096669055 12:53187552-53187574 TGCCAGTCCAAGACTTCCGACGG + Exonic
1099088715 12:78278838-78278860 ATCCAGTGCCAGTACTCCCATGG + Intergenic
1102959896 12:117085554-117085576 TGCCAGCCCCAGGACACCAAGGG + Intronic
1104348776 12:128026741-128026763 TGCCTCTCCCAGTACTCACAAGG - Intergenic
1108476546 13:50824369-50824391 TGCCAGACCCAGAAGTCCAGGGG - Intronic
1114632268 14:24166717-24166739 TGCCAGGCCCAGGACCCACAGGG - Exonic
1117026153 14:51622122-51622144 AGCCACTCCCAGCACTCACAGGG - Intronic
1118277164 14:64395484-64395506 TGCCTGTACCAGGACTCCGAAGG + Intronic
1118667249 14:68084459-68084481 TGCCAGTAGCAGCACTCCCTTGG + Intronic
1119614454 14:76089677-76089699 TGTCAGTCCCAGAATTTCCCTGG + Intergenic
1119881686 14:78104760-78104782 TGCCAGTCCCAGAAGTACAGTGG - Intergenic
1119919248 14:78430922-78430944 TGCAATTCCCAGAACTCTCTAGG - Intronic
1122353336 14:101110012-101110034 TGCTAGTCCCAGAACAAACAGGG - Intergenic
1122901091 14:104782602-104782624 TGCCCATCCCAGGACTCCCCAGG - Intronic
1123040008 14:105486608-105486630 TGTCAGTCCCCTCACTCCCAAGG - Intergenic
1124006895 15:25801789-25801811 TGCCAGTCTCTGAACCCCAATGG + Intronic
1125759655 15:42088040-42088062 AGCCATTCCCAGAGCTCCCAGGG + Intronic
1126697855 15:51341200-51341222 GGCCAGGACCAGACCTCCCATGG + Intergenic
1126827795 15:52568962-52568984 CGCCCGTCCCAGCTCTCCCAGGG + Intronic
1128717115 15:69916815-69916837 TGGAAGTTCCAGAGCTCCCAAGG - Intergenic
1128837781 15:70825175-70825197 TGCCACTTGCAGAACTCTCAGGG - Intergenic
1129656358 15:77527827-77527849 TTCCAGTCCCAGCTCTGCCATGG - Intergenic
1129908456 15:79206453-79206475 TGCCACACCCAGTACACCCACGG - Intergenic
1130014618 15:80176887-80176909 TGGCAGACCCAGACCTCGCATGG + Intronic
1130801110 15:87264254-87264276 TGCAAATCCAAGAACCCCCATGG + Intergenic
1132312202 15:100865393-100865415 TGCCAGTCCTAGACTGCCCAAGG + Intergenic
1132645773 16:998634-998656 TGCCTGCTCCAGAGCTCCCAGGG - Intergenic
1132747586 16:1443391-1443413 GCCCAGGCCCAGAGCTCCCAGGG - Intronic
1132952970 16:2575007-2575029 GGCCAGTCTCTGAGCTCCCAGGG + Intronic
1132961381 16:2625161-2625183 GGCCAGTCTCTGAGCTCCCAGGG - Intergenic
1132981643 16:2741276-2741298 CCCCAGACACAGAACTCCCAAGG - Intergenic
1134537779 16:15040567-15040589 TGGCAGCCCCAGGACTCCCGCGG - Intronic
1135206038 16:20484688-20484710 TACTAGCTCCAGAACTCCCATGG - Intronic
1135212874 16:20539096-20539118 TACTAGCTCCAGAACTCCCATGG + Intronic
1136346164 16:29677547-29677569 TTCCTGTCCAAGAACTGCCAGGG - Intronic
1139613771 16:68076748-68076770 AGCCAGTCACAGCACTCCCATGG + Intronic
1139847481 16:69931224-69931246 CCCCAGTACCAGAACTCACATGG - Exonic
1141319985 16:82999265-82999287 TGTCAGTCCCAAAGCTCCTATGG + Intronic
1142241991 16:88951736-88951758 TTCCAGTTCAAAAACTCCCAGGG - Intronic
1142242507 16:88954069-88954091 TGCCAGTCAGAGAACTGCCCAGG + Intronic
1143798332 17:9356734-9356756 TGGCAGTCCCAGAACGAGCAAGG + Intronic
1146627503 17:34445496-34445518 TGCCAGCCCCAGGACCTCCATGG - Intergenic
1147429827 17:40364279-40364301 TGCCACTCCCACTCCTCCCATGG - Exonic
1150475679 17:65472633-65472655 TCCCAGTCCCAGTCCTGCCAGGG - Intergenic
1151460088 17:74249236-74249258 TCCCCGTCCCTGAGCTCCCAAGG - Intronic
1151849530 17:76682199-76682221 TGCCAGTTCCAGCACTCCCCAGG - Intronic
1154289356 18:13093554-13093576 TGCCAGTCCCAGACTTCTCCAGG - Intronic
1155498715 18:26466272-26466294 TGCCAGTCTCAGCAAGCCCAGGG - Intronic
1157035074 18:43961883-43961905 AGCAAGTCCCAGAAAGCCCAGGG + Intergenic
1158668897 18:59456921-59456943 TGCCAACCCCAGGTCTCCCATGG - Intronic
1159946376 18:74447267-74447289 TTCCAGTGCCAGGACTACCAGGG - Exonic
1160173049 18:76570236-76570258 CCCCAGGTCCAGAACTCCCACGG - Intergenic
1160921268 19:1521894-1521916 TGCCAGCCCCAGCAGTCCCAGGG - Intergenic
1161047754 19:2145376-2145398 AGCCAGTCCAAGAACTCCTAAGG + Intronic
1163127930 19:15254408-15254430 TGCCACTCCCAGAACCCACGTGG + Intronic
1163593167 19:18205381-18205403 TGGGCGTCCCAGTACTCCCAGGG - Intergenic
1164521628 19:28984118-28984140 AGCTAGGCCCAGGACTCCCAGGG + Intergenic
1166787849 19:45379971-45379993 AGCCCTTCCCAGACCTCCCAAGG + Exonic
1166831695 19:45643325-45643347 TGGCAGACCCAGAAGACCCAAGG + Intronic
1166962765 19:46508924-46508946 AGCCAGTCCCCGAACTCCAGAGG - Intronic
1167423126 19:49415354-49415376 AGCCAGCCTCAGAACTCCCTGGG + Intronic
1167424505 19:49423184-49423206 TGCCAGTCCCAGAACTCCCAGGG - Intronic
927507006 2:23621240-23621262 TTCCAGAGCCAGACCTCCCAGGG + Intronic
927677144 2:25114465-25114487 TGCCAGTCCCCGATCTCCCGTGG - Intronic
928091223 2:28376230-28376252 TGCCAGGCCCAGTGCTCCAAGGG + Intergenic
930369603 2:50486584-50486606 TTACAGTCCCAGAACTCTAAGGG + Intronic
930773837 2:55153772-55153794 TGCCAGGACCAGAATTCCCCAGG - Intergenic
931053572 2:58441653-58441675 TGGTGGTCCCAGGACTCCCAAGG + Intergenic
932565978 2:72909615-72909637 TGCCCATTCCAGAACTCCTAGGG + Intergenic
936042571 2:109160988-109161010 TGCCAGGCTCAGTTCTCCCAGGG - Intronic
937294226 2:120799992-120800014 TTCCAGTCCCAGAAGACCCTTGG - Intronic
937529303 2:122808962-122808984 TGGGGGTCCTAGAACTCCCAAGG - Intergenic
940005809 2:149008506-149008528 TTCCAGTCCCGGTCCTCCCACGG - Intronic
940546515 2:155095530-155095552 TGCCAGTCACAGAATTCAGAAGG - Intergenic
940673107 2:156695241-156695263 TGCTATTCCCAGATCTGCCAAGG - Intergenic
942469619 2:176246105-176246127 TGCCACTCTCTGAACTCCCTTGG - Intergenic
942604264 2:177673871-177673893 TGCCAGTGCAAGACCTTCCAGGG + Intronic
942656056 2:178215134-178215156 TCCCAATCCCAGAAGTACCAAGG - Intronic
944036613 2:195302180-195302202 GGCTAGTGCCAGATCTCCCAGGG - Intergenic
946154920 2:217801026-217801048 GGCCAGTCTCAGAAGACCCAGGG + Exonic
947329610 2:229014913-229014935 TCCTAGTCCGAGAGCTCCCAGGG - Intronic
1169197744 20:3692559-3692581 TGCCAGGCCCAGGATGCCCAGGG - Exonic
1170570514 20:17629730-17629752 TGCCAGTGCCAGAACTCAGTGGG - Intronic
1170883929 20:20321902-20321924 AGCCAGTCCTAGAAGTCACATGG - Intronic
1172578805 20:36030723-36030745 TCCAAGTCCCACAGCTCCCATGG - Intergenic
1172929602 20:38576144-38576166 GGCCAGACCCAGAACATCCAAGG + Exonic
1173208248 20:41011642-41011664 TGGCAGTTCCAGAAATGCCATGG + Intergenic
1173744554 20:45426434-45426456 TGTGATTCCCAGAACTCCCCGGG + Intergenic
1175163984 20:57030027-57030049 TGCCAGTCCACAAAGTCCCAGGG - Intergenic
1176173368 20:63706489-63706511 ACCCAGTCCCAGCTCTCCCAGGG + Intronic
1177151925 21:17463869-17463891 TTCCAGTCCCAGGACTTACATGG - Intergenic
1178916666 21:36708897-36708919 TGCCAGGCCCACAGCTCCCGCGG - Intronic
1180334237 22:11561021-11561043 TGTCAGTCACAGAGCTCACAGGG - Intergenic
1180881691 22:19208623-19208645 TGACAGGCCCACAATTCCCAGGG - Intronic
1181602807 22:23962054-23962076 TTCCAGTTTCAAAACTCCCAAGG - Intergenic
1181605707 22:23979253-23979275 TTCCAGTTTCAAAACTCCCAAGG + Intronic
1182458221 22:30466110-30466132 CTCCAGTCCCAGCTCTCCCAGGG - Intronic
1182778501 22:32849197-32849219 TGCCAGCTCCAGAACTTCCAAGG - Intronic
1183028986 22:35087817-35087839 TGCCTGGCCCAGGGCTCCCATGG - Intergenic
1185241973 22:49751629-49751651 TGCCAGTCCCAGGCCACACATGG + Intergenic
949560982 3:5202438-5202460 TGCCAAGCCCAGAACTCCTCTGG + Intronic
951024524 3:17815648-17815670 TGACAGTTCCAGAACTGTCAGGG - Intronic
951546206 3:23828879-23828901 TGCCTGTCCCAGCACACCTAAGG + Intronic
952616086 3:35276041-35276063 TGCCATTCCATGATCTCCCAGGG - Intergenic
953341749 3:42140297-42140319 TGCCAGTCACTGAGCACCCACGG - Intronic
953800274 3:46017638-46017660 GGCCAGCCCCAGAACTCCAATGG - Exonic
953906842 3:46872625-46872647 TGCCAGTCTCCCCACTCCCATGG + Intronic
954329915 3:49884407-49884429 TGGCAGGCCCAGGCCTCCCATGG + Intergenic
956371889 3:68571666-68571688 TGCCAGTCACAATACTCCAATGG - Intergenic
959039123 3:101400726-101400748 TGCCAATTCCAGCACTACCATGG + Intronic
961632122 3:128308737-128308759 TGGCAGCCCCAGGACTCCCTGGG + Intronic
961636834 3:128338561-128338583 TGCCAGTGGAAGAAATCCCAGGG + Intronic
961819188 3:129566573-129566595 TCCCAGACCCTCAACTCCCAGGG - Exonic
961821324 3:129577173-129577195 GGCCCGTCCCAGAGCTCCCCAGG + Intronic
965361906 3:167752073-167752095 TGCCAGACCCTGAGCTCTCAAGG + Intronic
967669259 3:192212980-192213002 TGCCAGTCCCAGAAGTGCAATGG + Intronic
969371356 4:6733393-6733415 TGCCACTCACTGAACTCCCCTGG - Intergenic
969547514 4:7841235-7841257 TTCCAGCCCCAGAGCTCTCATGG - Intronic
973107391 4:46357166-46357188 TGCAGGCCCCAGAACTCCTAGGG + Intronic
975437126 4:74365688-74365710 TGCCAGTCCTAGAAATCTAAAGG + Intronic
977578575 4:98700578-98700600 TTCCAGCCCCAGAGCTCCAAGGG - Intergenic
978984221 4:114989297-114989319 TGTCAGTCACAGAACTCCAAAGG - Intronic
980233317 4:130071881-130071903 TGCCAGGCCCCCAAGTCCCATGG + Intergenic
982178657 4:152729834-152729856 TGAAAGTCCCAGCACTCACATGG - Intronic
982366675 4:154586480-154586502 CTCCAGTCCCAGAGCTCCCAGGG + Exonic
983287512 4:165758716-165758738 TGCCATTCCCAGCACACACATGG + Intergenic
985877014 5:2607570-2607592 TGCCATTCCCAGAACACTCTGGG - Intergenic
987548310 5:19343015-19343037 TGCCATTCCTAGAATTTCCACGG + Intergenic
987946877 5:24621243-24621265 AGCCAGTCCCAGAGATCTCAGGG - Intronic
988169822 5:27639189-27639211 TGCAAGTCCCCGAAGTCCCCAGG + Intergenic
990124464 5:52497220-52497242 TGAAAGTCCCCGAACTTCCAAGG + Intergenic
992439853 5:76788584-76788606 TGCCAGTGCCCCAACTACCAAGG + Intergenic
992615650 5:78543659-78543681 TGCAGGTCCCAGAAATCCCCAGG + Intronic
997590887 5:135071524-135071546 TGCGGGACCCAGAACTCACACGG - Intronic
997604532 5:135164587-135164609 TGCAGATCACAGAACTCCCAGGG + Intronic
1002127836 5:177060091-177060113 TCCCAGTCCCAGTGCTCTCAGGG - Intronic
1002641518 5:180632833-180632855 TTCCAGACCCAGACCTCCCCTGG - Intronic
1003392982 6:5729332-5729354 TGACTGTCCCAGCCCTCCCACGG + Intronic
1004820925 6:19367083-19367105 TGCCAAGCCCAGAACTTCCCAGG + Intergenic
1006033331 6:31193577-31193599 TGCAATTCCCGGGACTCCCAAGG + Intergenic
1010084778 6:71904392-71904414 AGCTAGTCTCAGAACTCCCAAGG - Intronic
1011565660 6:88669224-88669246 TGCCAATACCAGAACTGCCAGGG + Intronic
1014915935 6:127148263-127148285 TACCAGTCCCCAATCTCCCAGGG + Intronic
1015742585 6:136472973-136472995 TCCCATTCCCAGATATCCCATGG + Intronic
1018928613 6:168224323-168224345 TGCCACTCCAAGCACTCCCTGGG - Intergenic
1019348085 7:540170-540192 CCCCAGTCCCAGAGCACCCAGGG + Intergenic
1020687303 7:11311480-11311502 TGCCTGTCCCAGACTTCCCTAGG + Intergenic
1021359078 7:19689440-19689462 TGCTGGTCCCAGAATTCCTATGG + Intergenic
1022516538 7:30978276-30978298 TGCCCCTCCCAGGACCCCCAGGG - Intronic
1023864776 7:44233481-44233503 AGCCAGCCCCAGACCGCCCACGG - Intronic
1024612596 7:51080410-51080432 TGCCACTGCAGGAACTCCCAGGG - Intronic
1024944511 7:54795081-54795103 TGCTGGTCACAGAATTCCCAAGG + Intergenic
1027990550 7:85354831-85354853 TGCAAGTCCCAGAACTGCAATGG - Intergenic
1030284211 7:107808958-107808980 GGCCAGTCCCAGAAGTCCAGTGG - Intergenic
1031621805 7:123942684-123942706 TGACAGTCCCAGGAGCCCCAAGG - Intronic
1032215386 7:129953048-129953070 TACAACTCCCAGAACTCCCCGGG - Intergenic
1034292054 7:149940768-149940790 TGCAAGTCCCAGAGCTCCTCAGG + Intergenic
1034814023 7:154156129-154156151 TGCAAGTCCCAGAGCTCCTCAGG - Intronic
1037613954 8:20500452-20500474 TGCCAGTGCCATAAATGCCATGG + Intergenic
1037748227 8:21663039-21663061 TGCCTGCCCCACAGCTCCCAGGG + Intergenic
1039517989 8:38148909-38148931 AGCCAGGCCCTCAACTCCCATGG + Intronic
1040303723 8:46201436-46201458 TGCCCATCCCAGAAGCCCCAAGG + Intergenic
1040630950 8:49209781-49209803 TCCTACTCTCAGAACTCCCAGGG - Intergenic
1041398255 8:57414667-57414689 TACCAGTCCCATAAATGCCATGG - Intergenic
1044747598 8:95385705-95385727 TGTCAGTCCAAGATCTCCCCTGG - Intergenic
1044897164 8:96904779-96904801 TGCCAGTTGCACAACTCCAAGGG + Intronic
1048196427 8:132335517-132335539 TGTCAGACCAAGAACCCCCAGGG - Intronic
1049696084 8:143984964-143984986 TGCCTGTCCCAGAGACCCCATGG + Exonic
1049733373 8:144190687-144190709 TGCCCCTTCCAGAAATCCCACGG - Intronic
1049751934 8:144289023-144289045 TGGCAGTCTCAGAAAGCCCAAGG + Intronic
1050684130 9:8147788-8147810 TGCCAGTGAAAGAACTCTCATGG - Intergenic
1057034816 9:91804365-91804387 TGCCAGCCCCACAGCTGCCAAGG + Intronic
1057077525 9:92146521-92146543 TGCAAGTCCCAAAACTTCCCTGG + Intergenic
1057279079 9:93697585-93697607 TGCCTGTCCTAAAACTGCCAGGG + Intergenic
1058801103 9:108545218-108545240 AGCCTGTCCCAGATCCCCCATGG + Intergenic
1058889461 9:109348463-109348485 TTCCAGTTTCAGAACTCCCCAGG - Intergenic
1059433592 9:114263950-114263972 TGCCATTCCCAGAGCACACACGG - Intronic
1060768530 9:126313111-126313133 TTCCAGTCCCTGAAATCCCAAGG - Intergenic
1062019024 9:134307514-134307536 TGCCTGCCCCAGAACTGCCCTGG + Intergenic
1186552902 X:10525737-10525759 AGCCAGACACAGAACTCTCATGG - Intronic
1189480943 X:41391734-41391756 TGCCCGTCTGAGCACTCCCACGG - Intergenic
1190680320 X:52821026-52821048 TGCCAGTCACAACACTTCCATGG + Intergenic
1190728981 X:53212171-53212193 TTCCAGTCTCACAACTTCCAGGG + Intronic
1192177148 X:68893213-68893235 TGCCAGTCCCAGATTTGCCGAGG - Intergenic
1192189687 X:68983311-68983333 TGCCAGTCCCAGATTTTCCAGGG + Intergenic
1193736232 X:85159927-85159949 TGCTGGTCCCAGAACGCCAATGG - Intergenic
1194345943 X:92765841-92765863 TTCCAGTCCCTGAATTCTCAGGG + Intergenic
1195569796 X:106385399-106385421 TGCCCCTCCCAGAACTCTGAGGG - Intergenic
1200654289 Y:5882489-5882511 TTCCAGTCCCTGAATTCTCAGGG + Intergenic
1200925548 Y:8651215-8651237 TGCCAGTACCAGGGCTCCCAGGG + Intergenic
1202152235 Y:21853977-21853999 TGCCCGTACCAGAGTTCCCAGGG - Intergenic