ID: 1167425329

View in Genome Browser
Species Human (GRCh38)
Location 19:49427230-49427252
Sequence AAAATGCAACAGATGTACCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 270}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167425322_1167425329 7 Left 1167425322 19:49427200-49427222 CCCAAACAGAATTCCCCACAACC 0: 1
1: 0
2: 2
3: 24
4: 185
Right 1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG 0: 1
1: 0
2: 0
3: 18
4: 270
1167425323_1167425329 6 Left 1167425323 19:49427201-49427223 CCAAACAGAATTCCCCACAACCT 0: 1
1: 0
2: 2
3: 16
4: 255
Right 1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG 0: 1
1: 0
2: 0
3: 18
4: 270
1167425316_1167425329 26 Left 1167425316 19:49427181-49427203 CCCAGCCCCACCGAAATTTCCCA 0: 1
1: 0
2: 1
3: 12
4: 154
Right 1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG 0: 1
1: 0
2: 0
3: 18
4: 270
1167425318_1167425329 21 Left 1167425318 19:49427186-49427208 CCCCACCGAAATTTCCCAAACAG 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG 0: 1
1: 0
2: 0
3: 18
4: 270
1167425325_1167425329 -7 Left 1167425325 19:49427214-49427236 CCCACAACCTACTACCAAAATGC 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG 0: 1
1: 0
2: 0
3: 18
4: 270
1167425320_1167425329 19 Left 1167425320 19:49427188-49427210 CCACCGAAATTTCCCAAACAGAA 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG 0: 1
1: 0
2: 0
3: 18
4: 270
1167425321_1167425329 16 Left 1167425321 19:49427191-49427213 CCGAAATTTCCCAAACAGAATTC 0: 1
1: 0
2: 7
3: 57
4: 301
Right 1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG 0: 1
1: 0
2: 0
3: 18
4: 270
1167425317_1167425329 25 Left 1167425317 19:49427182-49427204 CCAGCCCCACCGAAATTTCCCAA 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG 0: 1
1: 0
2: 0
3: 18
4: 270
1167425319_1167425329 20 Left 1167425319 19:49427187-49427209 CCCACCGAAATTTCCCAAACAGA 0: 1
1: 0
2: 1
3: 15
4: 117
Right 1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG 0: 1
1: 0
2: 0
3: 18
4: 270
1167425326_1167425329 -8 Left 1167425326 19:49427215-49427237 CCACAACCTACTACCAAAATGCA 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG 0: 1
1: 0
2: 0
3: 18
4: 270
1167425324_1167425329 -6 Left 1167425324 19:49427213-49427235 CCCCACAACCTACTACCAAAATG 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG 0: 1
1: 0
2: 0
3: 18
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167425329 Original CRISPR AAAATGCAACAGATGTACCC AGG Exonic
900501432 1:3007116-3007138 AAAATGCTTGAGATGTAGCCTGG + Intergenic
903213364 1:21830527-21830549 AAAATGCAAAAAATTTAGCCAGG + Intronic
905148930 1:35911436-35911458 TAGATTCAACAAATGTACCCAGG + Intronic
907614412 1:55909671-55909693 AACATGCACAAAATGTACCCTGG - Intergenic
907888388 1:58615144-58615166 AAAATACAAAAAATGTAGCCGGG - Intergenic
908053289 1:60256154-60256176 AAAAAGCAAGAGGTGAACCCAGG + Intergenic
908452207 1:64267120-64267142 AAAATGACACAGATGAGCCCAGG + Intronic
908986872 1:70034812-70034834 AACAAGTAACAGATATACCCAGG + Intronic
909006004 1:70277295-70277317 AAAATGCAAAAGAATTATCCGGG + Intronic
910273315 1:85420438-85420460 AAAGTGCTCCAGATGTGCCCTGG - Intronic
911831870 1:102560455-102560477 AAAAAACCACACATGTACCCAGG - Intergenic
912438187 1:109676644-109676666 AAAAAGCAAAAGATATAGCCAGG - Intronic
912916565 1:113821480-113821502 AAAATACAAAAAATTTACCCAGG - Intronic
912967966 1:114252989-114253011 ACAATGCACCAGAGCTACCCAGG + Intergenic
913610506 1:120505569-120505591 AAAATGCAAGAGCTGTATCAGGG - Intergenic
914580684 1:149016670-149016692 AAAATGCAAGAGCTGTATCAGGG + Intronic
915338858 1:155165423-155165445 AAAATGCAACAAAATTAGCCAGG + Intergenic
915398999 1:155608982-155609004 AAAATACAAAACATGTAGCCGGG - Intergenic
915578980 1:156802025-156802047 AATATGCTACAGATGCAGCCCGG + Intergenic
917888747 1:179415698-179415720 AAAAAAAAAAAGATGTACCCTGG - Intronic
918550001 1:185731812-185731834 AAAATGTAGCATATTTACCCAGG - Intergenic
918943410 1:191029376-191029398 AAAATACAAAAAATGTAGCCAGG + Intergenic
921607993 1:217177589-217177611 AACAAGCTACAGATGTCCCCTGG - Intergenic
921621133 1:217327537-217327559 AAAATGCAACAGTGGAATCCTGG - Intergenic
924279259 1:242419554-242419576 AAAATGCAAAAAATTTAGCCGGG - Intronic
1062781255 10:210865-210887 CAAATGTAACAGATGTGGCCAGG + Intronic
1063343444 10:5290249-5290271 AAAATGCAAAAAATTTAGCCGGG - Intergenic
1063673663 10:8120386-8120408 AAAATACAAAAAATGTAGCCAGG - Intergenic
1064094824 10:12416575-12416597 AAAATCCCACAGTTGTGCCCTGG + Intronic
1064577446 10:16760630-16760652 AAAATACAACAGATGGAGACAGG - Intronic
1066559716 10:36656831-36656853 AAAATACAAAAGAATTACCCAGG + Intergenic
1067682006 10:48447322-48447344 AAAATCCAGCATATGTTCCCAGG - Intronic
1067778732 10:49182174-49182196 AAAATAAAACAAATGTACCAAGG + Intronic
1067807680 10:49404486-49404508 AACATTCAGCAGATGTACCTGGG + Intergenic
1068263199 10:54610838-54610860 GAAATGAAAAAGGTGTACCCTGG + Intronic
1068902582 10:62286346-62286368 ACAAACCTACAGATGTACCCCGG + Intergenic
1070181054 10:74014582-74014604 AAAATCCCAAAGAGGTACCCAGG + Intronic
1070973074 10:80583371-80583393 AAAAGACAACAGATGGAGCCGGG + Intronic
1075297819 10:121293557-121293579 CAAAAGCCACAGATGTCCCCAGG + Intergenic
1076498751 10:130917532-130917554 ATAATCCAACAGAAGGACCCAGG - Intergenic
1077563356 11:3280164-3280186 AAAAACCAACAGATGTGGCCAGG - Intergenic
1077569248 11:3325979-3326001 AAAAACCAACAGATGTGGCCAGG - Intergenic
1078847555 11:15133683-15133705 AACATTCAACAGATGTTCTCAGG + Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1080102778 11:28478616-28478638 AGAATGCAAGAGATGTTCCCAGG - Intergenic
1080128561 11:28766565-28766587 AAAAACCATCAGAAGTACCCAGG + Intergenic
1080540688 11:33261574-33261596 AATATGCTACATATGTACCATGG - Intronic
1080966097 11:37216980-37217002 AAAATACAAAAGATCTAGCCAGG + Intergenic
1083696293 11:64444918-64444940 AAAATGAACCAGATTTAGCCAGG - Intergenic
1083820280 11:65166696-65166718 AAAATTAATCAAATGTACCCGGG - Intergenic
1084108397 11:66996539-66996561 AAAATACAAAAAATGTAGCCCGG + Intergenic
1087267848 11:96080371-96080393 AAAATGCAAAAGCTATTCCCTGG - Intronic
1087826273 11:102768065-102768087 AAAAAGTAACATGTGTACCCGGG - Intergenic
1088685478 11:112281301-112281323 AAAATGCAAAACAATTACCCAGG - Intergenic
1088713567 11:112529213-112529235 AAAATGAAAAAGATGGAGCCAGG + Intergenic
1089237230 11:117040533-117040555 TAAATGCTACAGATGTGCCAAGG + Intronic
1091599515 12:1909350-1909372 AAAATGCAAAAAATTTAGCCGGG - Intronic
1092411082 12:8253292-8253314 AAAATGCAAAAAATGTAGCTGGG - Intergenic
1094874552 12:34626350-34626372 ACAATACAACAAATGTCCCCTGG - Intergenic
1096188005 12:49595822-49595844 AAAATACAACAAAATTACCCGGG + Intronic
1097623389 12:61969349-61969371 AAAAAGCAACAGTTGAACACAGG + Intronic
1099741107 12:86635582-86635604 AAAATGGACCAGATATACCATGG + Intronic
1100220543 12:92500393-92500415 AAGAGGCAAGAGATGTACCCTGG + Intergenic
1100243834 12:92736696-92736718 AAAATGCAAGAGAGGAACCCAGG + Intronic
1102799840 12:115722518-115722540 AACAGGCTACAGATGTAGCCAGG - Intergenic
1102975808 12:117206487-117206509 AAAATACAAAAAATGTAGCCGGG + Intergenic
1106234057 13:27846509-27846531 AAAATGCAAAAGAGTTAGCCAGG + Intergenic
1107373811 13:39780772-39780794 AAAATGCCACACAAGGACCCGGG + Intronic
1107720031 13:43238691-43238713 AAAATACAAAAAATGAACCCTGG + Intronic
1109175697 13:59152564-59152586 AGAATGCAAAAGAAGTGCCCAGG + Intergenic
1109416658 13:62049702-62049724 AAAATACAAAAAATGTAGCCAGG + Intergenic
1111154727 13:84307872-84307894 AAAATGCAAAAAATTTAGCCGGG + Intergenic
1111306784 13:86424474-86424496 AAAATGCAAAAATTGTACCTAGG + Intergenic
1112119919 13:96398572-96398594 AAAATGCAACAGATGGGGCTGGG - Intronic
1112784282 13:102934718-102934740 AAAATGCAACAAAATTAGCCTGG + Intergenic
1116261480 14:42633957-42633979 AAATTGCAACAAATTTAACCAGG + Intergenic
1116767508 14:49090759-49090781 ATAATGGAACATATATACCCTGG + Intergenic
1117563823 14:56972821-56972843 AAAATACAACAAAATTACCCAGG + Intergenic
1118104927 14:62647639-62647661 AAAAAGCAACTGATGTCCTCAGG + Intergenic
1120356395 14:83439927-83439949 AAAAAGCCACAGATGTTTCCAGG - Intergenic
1120396819 14:83977950-83977972 AAAATGAAACAGAAGGACACTGG + Intergenic
1121213049 14:92223643-92223665 AAAATGCAAGAGTTTTACCCAGG + Intergenic
1122361127 14:101165264-101165286 AAACTGCTATAGATGTACACTGG - Intergenic
1123781553 15:23633732-23633754 AAAATGCAAAAAAAGTAGCCGGG - Intergenic
1123867355 15:24534485-24534507 AAATTGAGACAGAAGTACCCCGG + Intergenic
1126285006 15:47000325-47000347 AAAATCCAACAGATGTAAGTAGG + Intergenic
1126386650 15:48100365-48100387 AGAATGTAACTGATGGACCCAGG + Intergenic
1128557300 15:68640574-68640596 CAAATGCAACACATGAACCTAGG + Intronic
1129602096 15:77005223-77005245 AAAATACAAAAAATGTAGCCAGG + Intronic
1133119377 16:3596780-3596802 AAAATGCCTCAGATGGAGCCCGG - Intronic
1134790467 16:16984891-16984913 AAAAAGCAAGAGATCTAGCCAGG - Intergenic
1135396000 16:22132086-22132108 AAAATTAACCAGATGTAGCCAGG + Intronic
1136684284 16:31984945-31984967 AAAATACAATAAAAGTACCCGGG + Intergenic
1136690144 16:32023061-32023083 AAAATACAAAAAATGTAGCCAGG + Intergenic
1136784914 16:32928497-32928519 AAAATACAATAAAAGTACCCGGG + Intergenic
1136884869 16:33925309-33925331 AAAATACAATAAAAGTACCCGGG - Intergenic
1137654542 16:50148905-50148927 AAAATACAAAAAATGTAGCCGGG - Intergenic
1138062135 16:53902947-53902969 AAAATGCAAAAGACTTAGCCAGG + Intronic
1138359743 16:56418002-56418024 AAAACACAACAAATGTAGCCAGG + Intronic
1140563443 16:76011122-76011144 AAAATGCATGACAAGTACCCAGG + Intergenic
1141492362 16:84382733-84382755 AAAATGCAAAACATTTAGCCAGG + Intronic
1141560642 16:84865534-84865556 AAAAGGCAACAGATGTATTTGGG - Intronic
1141956328 16:87374079-87374101 AAAATACAAAAAATGTAGCCAGG + Intronic
1142169989 16:88616747-88616769 AAAATGACACAGTTTTACCCAGG + Intronic
1203087573 16_KI270728v1_random:1192503-1192525 AAAATACAATAAAAGTACCCGGG + Intergenic
1143398996 17:6628567-6628589 AAAATGAAACAGAACTGCCCAGG + Exonic
1144907874 17:18651415-18651437 AAAATGGAACAGATTTATCCGGG + Intronic
1147145220 17:38480641-38480663 AAAATACAATAAAAGTACCCGGG + Intronic
1147748962 17:42715645-42715667 AAAAAACAACAGATGAATCCAGG + Intronic
1148060935 17:44835928-44835950 AAAATACAAAAGAAGTAGCCGGG + Intergenic
1148513612 17:48195040-48195062 AAAATGCCTCAAATGTACCAAGG + Intronic
1151402682 17:73866151-73866173 AAAAGGTAATAGAAGTACCCAGG + Intergenic
1153921071 18:9790580-9790602 AAAATGCAATATATGAACCTTGG - Intronic
1153982788 18:10326076-10326098 AAAATACAAAAAAAGTACCCAGG - Intergenic
1156118468 18:33815897-33815919 AAAATGGTACATATGTAACCAGG + Intergenic
1157713448 18:49865839-49865861 GAAATGTCACAGATGTGCCCTGG - Intronic
1158871529 18:61692919-61692941 AAAATGCAAAAAAAGTAGCCAGG + Intergenic
1160769631 19:824667-824689 AAAATACAAAAGAATTACCCGGG - Intergenic
1163214837 19:15868841-15868863 AAAATACAAAATATGTAGCCAGG - Intergenic
1163215395 19:15872781-15872803 AAAATACAAAATATGTAGCCAGG - Intergenic
1164646852 19:29864588-29864610 AAAATTCAACTGATAAACCCAGG + Intergenic
1165291799 19:34891553-34891575 AGACTGTAACAGATGTGCCCTGG - Intergenic
1165641355 19:37390322-37390344 AAAAAGTAACAGATGTGGCCAGG - Exonic
1166710303 19:44932666-44932688 AAAATACAACAAAAGTAGCCAGG - Intergenic
1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG + Exonic
925119475 2:1406358-1406380 AAAATGTAACACAGGTGCCCTGG - Intronic
926730576 2:16032968-16032990 AAAATGCAAAAAATTAACCCAGG - Intergenic
926820020 2:16841686-16841708 TAGATGCAGGAGATGTACCCTGG - Intergenic
927830307 2:26344670-26344692 AAAATGCAAAAAATTTAGCCGGG + Intronic
928809931 2:35211346-35211368 AAAATACAAAAAATGTAGCCAGG - Intergenic
930713600 2:54572310-54572332 AAAATGTTAAAAATGTACCCTGG + Intronic
930827801 2:55711874-55711896 AAAATGCAAAAAATTTAGCCAGG - Intergenic
931347641 2:61461230-61461252 AAAATGCAAAAGAATTAGCCAGG + Intronic
932004667 2:67916212-67916234 AAAATGCAAAAGGTGTAGTCTGG + Intergenic
933600037 2:84319671-84319693 AAATCCCAACTGATGTACCCTGG - Intergenic
934108256 2:88716281-88716303 AATATGTATCAGATGTACCTAGG - Intronic
935099137 2:99975966-99975988 AGAAGGTGACAGATGTACCCAGG + Intronic
937020608 2:118648909-118648931 AAAATGGAAAAGATTTACCAGGG - Intergenic
938587763 2:132708041-132708063 AAAATGCAGCAGCAGTACCCAGG + Intronic
939582812 2:143970635-143970657 AAAATTCAACAGAGGTACCTGGG + Exonic
940428624 2:153560085-153560107 AAAATGCAAAAGATGATCCTAGG - Intergenic
941425394 2:165338418-165338440 AAAATGCAACAAAATTAGCCAGG - Intronic
943017556 2:182531894-182531916 ACAATGCAACACATGGACACAGG - Intergenic
944501527 2:200365114-200365136 ATAATGCAAAAGCTGTTCCCTGG - Intronic
944686527 2:202122660-202122682 AAAATACAACAAATTTAGCCAGG - Intronic
945189751 2:207175199-207175221 AAAATGCAAAAAAAGTAGCCGGG + Intergenic
1170851989 20:20013246-20013268 AAAATGCAAAAAAAGTAGCCAGG + Intergenic
1172341715 20:34163070-34163092 AAAATGCAACAAAATTAGCCGGG - Intergenic
1174314771 20:49690162-49690184 AAAATACAAAAGAAGTAGCCAGG - Intronic
1174319748 20:49731992-49732014 AAAATGCAAAAAAATTACCCGGG + Intergenic
1174718671 20:52787359-52787381 AAGATGCCACAGAGGTACCAAGG + Intergenic
1176251403 20:64122243-64122265 AAAATACAAAAAATGTAGCCAGG + Intergenic
1177330106 21:19648269-19648291 AAAATGAAATAGATATTCCCAGG - Intergenic
1177468621 21:21524435-21524457 AAAATGGAATACATGAACCCAGG + Intronic
1177476495 21:21630788-21630810 CAATTGCAACAAATATACCCCGG + Intergenic
1177740638 21:25148844-25148866 AAAATTCAACAGTAATACCCAGG - Intergenic
1177974845 21:27835324-27835346 ACAATGCCACAGATGTACATTGG - Intergenic
1178075314 21:29010447-29010469 AAAATACAACAAAATTACCCGGG + Intronic
1179622582 21:42627011-42627033 AAAAGGCATGAAATGTACCCAGG - Intergenic
1180399549 22:12397847-12397869 AAAATGCTCCAAATATACCCTGG - Intergenic
1182221655 22:28763528-28763550 AAAATACTACAGATGTTCCCTGG - Intergenic
1182714951 22:32350665-32350687 AAACTGCAACCGATCTACTCTGG + Intergenic
1182729581 22:32476018-32476040 AAAATGAAAAAGATGTTCCCTGG + Intronic
949681138 3:6515732-6515754 AAAGTGTAACAGATGGACCTAGG - Intergenic
952057066 3:29460476-29460498 AAAATGCCACTGATGTATCTGGG + Intronic
953156128 3:40375826-40375848 AAAATGAAACAGAATTACACAGG - Intergenic
953298933 3:41751900-41751922 AAAATGCAACAGACAAACCATGG + Intronic
953765062 3:45733620-45733642 AAAATGCAACAGATTCATCAAGG - Intronic
954337655 3:49929273-49929295 AAAAAGCAACAGAGGTAACTGGG - Intronic
955640583 3:61078824-61078846 AAAGTGATACAGCTGTACCCAGG + Intronic
959881897 3:111453461-111453483 AAAATGTAACATATATACCATGG + Intronic
961588939 3:127960373-127960395 CAAATGCAAAATATATACCCTGG - Intronic
961776426 3:129289669-129289691 AGAATGCAACAGAAGTAGGCCGG - Intronic
962529990 3:136270479-136270501 AAAAAACAACAGATGTGGCCGGG - Intronic
963001309 3:140684414-140684436 AAAGTGCACCAGATCAACCCAGG + Intronic
965756872 3:172036409-172036431 AAAATGCAACAGTAGTACACAGG - Intergenic
966790686 3:183666807-183666829 AAAATACAACAGTTGTACCAAGG + Intronic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968185238 3:196628746-196628768 AAAATGCAAAAGAATTAGCCAGG - Intergenic
968396081 4:239762-239784 AAAATGCAGCAGTTATGCCCTGG - Intergenic
968929433 4:3570726-3570748 AAAGGGCCACACATGTACCCAGG + Intergenic
970127201 4:12828195-12828217 AAAATGCAGCTGATGTGGCCAGG - Intergenic
971139724 4:23911137-23911159 GAAATGCAACAGAGAAACCCAGG + Intergenic
971761186 4:30767477-30767499 AATATCCAACAGACATACCCGGG - Intronic
971929921 4:33068274-33068296 AAAATACACAAGATGTACCCAGG - Intergenic
972096609 4:35354859-35354881 AAAATGCAAAAAATTTAGCCGGG + Intergenic
973579695 4:52331140-52331162 AAGATGCAAAGGGTGTACCCAGG + Intergenic
973626713 4:52779821-52779843 AATATGCAACAGAATTACCCTGG + Intergenic
974817507 4:67024229-67024251 AAAATGCAACAGAAGAGCCTGGG - Intergenic
975088183 4:70368106-70368128 AAAATACAACAGAATTAGCCAGG - Intergenic
976894965 4:90098302-90098324 ACAATGCCAGAGATGTGCCCAGG + Intergenic
977453507 4:97227818-97227840 AACATGCAACATATGTACTGGGG + Intronic
980235901 4:130106427-130106449 GAAATGGAACAGAAGAACCCAGG - Intergenic
981130039 4:141148599-141148621 AAAATACAAAAGAAGTAGCCGGG - Intronic
983990624 4:174115001-174115023 AAAATACAAAAAATGTAGCCAGG + Intergenic
984173065 4:176384331-176384353 AGAAGGAAACAGATGTACCCAGG + Intergenic
984806255 4:183754620-183754642 AAAATACAAAAAATGTAGCCGGG - Intergenic
985112903 4:186564262-186564284 AAAATGCAAAAAATTTAGCCGGG - Intergenic
985233032 4:187842246-187842268 AAAATGCAAAAAATTTAGCCAGG + Intergenic
986547228 5:8911669-8911691 AAAATGCAACATAAGAACCAGGG + Intergenic
988545243 5:32150367-32150389 AAATAGCAACAGATTTTCCCTGG + Intronic
989635614 5:43529797-43529819 AAAATGGAACAGATTTATCCGGG - Exonic
990573780 5:57105286-57105308 AACATGCAACAGATGGGGCCAGG - Intergenic
991270409 5:64772464-64772486 AAAATGCAAAAAAAGTAGCCGGG + Intronic
992085588 5:73275354-73275376 AAAATGGAACAGCTGTAGCTGGG + Intergenic
992796543 5:80258865-80258887 AAAATACAAAAGAAGTAGCCGGG + Intergenic
992931500 5:81652197-81652219 ACACAGCCACAGATGTACCCTGG - Intronic
995651738 5:114377253-114377275 AAAACACAGCAGATGTTCCCAGG - Intronic
995857277 5:116606569-116606591 AAAATCCACCAGAAATACCCAGG - Intergenic
996613304 5:125410353-125410375 AAAATGAAACAGAAGGAGCCAGG + Intergenic
999742133 5:154564153-154564175 AAAATACAAAAGAAGTAGCCAGG + Intergenic
1000089273 5:157916149-157916171 AAACGGCAAAAGATGTAGCCTGG - Intergenic
1002991987 6:2246318-2246340 CAAATCCAACAGATGTAAGCCGG - Intergenic
1003043241 6:2708772-2708794 AAAAGGCAGAAGATGAACCCAGG - Intronic
1003490480 6:6616900-6616922 GAAATACAACAGGTGTATCCTGG + Intronic
1003617575 6:7669500-7669522 AAAATGAAAAAAATGTAGCCGGG + Intergenic
1007144207 6:39611145-39611167 AAAATGCAAAAGAATTAGCCAGG + Intronic
1007590045 6:43015499-43015521 AAAAAACCTCAGATGTACCCAGG + Intronic
1008395591 6:51003097-51003119 AAAATGCAAGAAAAGTAACCAGG + Intergenic
1009793975 6:68442271-68442293 AAATTGCAAGTGATGTAGCCAGG + Intergenic
1009864012 6:69374064-69374086 AAATTGCAACACAAGAACCCCGG + Intronic
1010830898 6:80527775-80527797 AAATCTCTACAGATGTACCCTGG + Intergenic
1011220498 6:85049893-85049915 AAAATGGAACAGAGGAACACAGG - Intergenic
1012289378 6:97434032-97434054 AAAAAGAAAGAGATGTACCTTGG - Intergenic
1013779380 6:113713211-113713233 AAAATGCAAAAGAATTAGCCAGG - Intergenic
1015619549 6:135116771-135116793 AAAATGTAACAAATGTTTCCTGG + Intergenic
1017944310 6:159081138-159081160 AAAATACAAAAAATGTAGCCGGG + Intergenic
1018631962 6:165829250-165829272 AAAATCCAGCAGCTGTGCCCAGG - Intronic
1018642151 6:165914534-165914556 AACATGCAACAGCTGTACAAAGG + Intronic
1018914770 6:168126311-168126333 AAAATAGAACAGAAGTTCCCAGG - Intergenic
1019797042 7:3057972-3057994 AAAATGCAAAAAATTTAGCCAGG + Intergenic
1021093398 7:16508890-16508912 AAATTGCACCATATGTAGCCCGG + Intronic
1021227302 7:18043181-18043203 AAAATGACACTGATGAACCCTGG + Intergenic
1021700378 7:23314001-23314023 AAAATGCAACTGATGTCTCATGG - Intronic
1021737227 7:23651765-23651787 AGAATGCAACAGATGATCCTTGG + Intergenic
1022020635 7:26397475-26397497 AAACCCCAACAGATGTCCCCTGG + Intergenic
1022686606 7:32603098-32603120 AGAATGCAGCAGAAGTAGCCGGG - Intergenic
1026352356 7:69528564-69528586 AAAATGCAAAAAAATTACCCGGG - Intergenic
1026419234 7:70216217-70216239 AAGATGAAACATATGTACACTGG - Intronic
1026579804 7:71605678-71605700 AAAATAAAACTGATGTGCCCAGG + Intronic
1027988054 7:85320408-85320430 AAAATGCAAAAGAACTAGCCAGG - Intergenic
1030040515 7:105445822-105445844 AAAATGCAAAAAAAGTAGCCGGG - Intronic
1031097491 7:117438365-117438387 AAAAAGAGACAGATGTACCCAGG - Intergenic
1032352133 7:131174467-131174489 AAAATGCAACATATGAAATCAGG - Intronic
1032566264 7:132949527-132949549 AAAATGTACGAGATGTACTCTGG + Intronic
1033933391 7:146552028-146552050 AAAATGCAACTGATATAAGCTGG + Intronic
1034878341 7:154744686-154744708 AAAAGGCAACAGATGCAAGCAGG + Intronic
1035430681 7:158818497-158818519 GAAATGGAACAGATGAGCCCTGG - Intronic
1036617716 8:10401872-10401894 AAAATGGAATAGAGGTTCCCAGG + Intronic
1036723371 8:11199615-11199637 AAGAGGGCACAGATGTACCCAGG + Intronic
1036851463 8:12204464-12204486 AAAATGCAAAAAATGTAGCTGGG - Intergenic
1036872828 8:12446738-12446760 AAAATGCAAAAAATGTAGCTGGG - Intergenic
1041834441 8:62195936-62195958 AATATGCTAAAAATGTACCCAGG - Intergenic
1041962709 8:63637072-63637094 AAAATACAAAAAATGTAGCCAGG + Intergenic
1042543019 8:69925785-69925807 AAAATACAAAAAATGTAGCCGGG + Intergenic
1043064535 8:75550832-75550854 ATAAAGCAAAAGATGTACCATGG - Intronic
1045144063 8:99319225-99319247 AATATGCAACACATATACACAGG - Intronic
1045800634 8:106097023-106097045 AATAAGCATCAGAGGTACCCAGG + Intergenic
1048942144 8:139409536-139409558 AAAATGCAAAAAAAGTAGCCAGG - Intergenic
1048966024 8:139615164-139615186 AAATAGCAACAGAAGTAGCCAGG + Intronic
1052043943 9:23773002-23773024 AAAAAGTCACAGATGTACCTAGG - Intronic
1052910474 9:33876753-33876775 AAAATACAAAAAATGTAGCCGGG + Intronic
1053804126 9:41784163-41784185 AAAGGGCCACACATGTACCCAGG + Intergenic
1054141155 9:61531296-61531318 AAAGGGCCACACATGTACCCAGG - Intergenic
1054192433 9:61995659-61995681 AAAGGGCCACACATGTACCCAGG + Intergenic
1054460845 9:65461732-65461754 AAAGGGCCACACATGTACCCAGG - Intergenic
1054645973 9:67593032-67593054 AAAGGGCCACACATGTACCCAGG - Intergenic
1054774986 9:69117579-69117601 AAAATGCAACACATGAATGCTGG - Intergenic
1054969539 9:71069335-71069357 AAAATGCAAAAAATTTAGCCAGG - Intronic
1056690969 9:88808433-88808455 AAATTGCAAGACATGTATCCTGG + Intergenic
1057511547 9:95683849-95683871 AAGGTGCAACAGGTGGACCCTGG + Intergenic
1057548157 9:96033403-96033425 AAAATGCAAAAAATTTAGCCAGG - Intergenic
1058485005 9:105434984-105435006 AAAATACAAAAAATGTAACCAGG + Intronic
1058889698 9:109350849-109350871 AAAATGTAACAGATGGACTTAGG - Intergenic
1060066630 9:120507652-120507674 CAAATAAAACAGATGCACCCGGG - Intronic
1060441441 9:123643527-123643549 GAACTGCAACATATGAACCCTGG + Intronic
1203380778 Un_KI270435v1:37221-37243 AAAATGCTCCAAATATACCCTGG - Intergenic
1185508939 X:648383-648405 AAAATGCAAAAAAATTACCCAGG - Intronic
1185553576 X:1002911-1002933 AAATGGGAACAGATGTAGCCGGG - Intergenic
1188371616 X:29376528-29376550 AAAATGCAAAAAAAGTAGCCAGG - Intronic
1188727184 X:33600402-33600424 AAAGTGCAACATATGTACAATGG - Intergenic
1196849225 X:119922000-119922022 AAAATACAAAAAATGTAGCCGGG - Intergenic
1197885287 X:131211424-131211446 AAAATACAAAAAATTTACCCGGG - Intergenic
1197960603 X:132001492-132001514 AAAAAGCAACAGTTGTAACTTGG + Intergenic
1197960740 X:132003433-132003455 AAAAAGCAACAGCTGTAACTTGG - Intergenic
1199470843 X:148193934-148193956 AAAAAGAAACACTTGTACCCTGG - Intergenic
1201514438 Y:14803805-14803827 AAAGTGCATCAGTTGTAACCAGG - Intronic
1202360030 Y:24097937-24097959 AAATTCCAACAGATACACCCAGG - Intergenic
1202510747 Y:25572177-25572199 AAATTCCAACAGATACACCCAGG + Intergenic