ID: 1167426567

View in Genome Browser
Species Human (GRCh38)
Location 19:49432690-49432712
Sequence GGGCAGAGACGCCGAGCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167426567_1167426576 11 Left 1167426567 19:49432690-49432712 CCGCCGGCTCGGCGTCTCTGCCC 0: 1
1: 0
2: 2
3: 6
4: 146
Right 1167426576 19:49432724-49432746 CACCGGCTCCTCCCTGCCTCGGG 0: 1
1: 0
2: 7
3: 51
4: 585
1167426567_1167426570 -6 Left 1167426567 19:49432690-49432712 CCGCCGGCTCGGCGTCTCTGCCC 0: 1
1: 0
2: 2
3: 6
4: 146
Right 1167426570 19:49432707-49432729 CTGCCCGGTCCGTGCACCACCGG 0: 1
1: 0
2: 2
3: 8
4: 54
1167426567_1167426575 10 Left 1167426567 19:49432690-49432712 CCGCCGGCTCGGCGTCTCTGCCC 0: 1
1: 0
2: 2
3: 6
4: 146
Right 1167426575 19:49432723-49432745 CCACCGGCTCCTCCCTGCCTCGG 0: 1
1: 0
2: 2
3: 40
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167426567 Original CRISPR GGGCAGAGACGCCGAGCCGG CGG (reversed) Intronic
900513050 1:3069409-3069431 GGGCCGCGCGGCCGAGCCGGGGG - Intronic
900738962 1:4318956-4318978 GGGCAGTGAAGCCGAGATGGGGG - Intergenic
901063850 1:6485695-6485717 GGGCAGAGGCGGGGAGGCGGGGG - Intronic
901064009 1:6486150-6486172 GGGCTGAGGCTCCGAGGCGGGGG - Intronic
901506641 1:9689600-9689622 GGGCAGCGGCGCGGGGCCGGCGG - Intronic
901769605 1:11523612-11523634 GCACAGAGACGGCGAGCAGGGGG + Intronic
902059419 1:13629662-13629684 GGGCAGAGACTAGGAGCCAGGGG - Intergenic
902509532 1:16958662-16958684 GGGCAGAGAAGGAGAGCAGGCGG + Exonic
903032892 1:20476311-20476333 GGGCAGGGAGGCCGCGCGGGAGG + Intergenic
905412702 1:37782679-37782701 GGGCCCACACGCTGAGCCGGCGG - Intergenic
907278089 1:53327956-53327978 GGGCTGAGACGCGGCGGCGGCGG - Exonic
916792346 1:168136145-168136167 GGGCAGAGCCGCCCATCCGGCGG + Intronic
922558189 1:226548916-226548938 GCACAAAGACGCCGAGACGGCGG + Exonic
922674265 1:227541399-227541421 GGCCAGAGACACCAAGCAGGGGG - Intergenic
922739591 1:228007715-228007737 GGGGAGTGGCGCAGAGCCGGCGG + Intronic
923550432 1:234958973-234958995 GGGAAGAGAGGCAGAGCCTGCGG + Intergenic
1063424177 10:5938540-5938562 GGGCCGAGAAGCAAAGCCGGCGG + Intronic
1064973474 10:21089536-21089558 GGGCAGAGAGACCGAGAAGGAGG + Intronic
1075139485 10:119818562-119818584 GGGCACAGACCCCGGCCCGGCGG - Intronic
1077131178 11:973530-973552 GAGCAGAACCACCGAGCCGGGGG + Intronic
1080628516 11:34052157-34052179 GGGCTGGTAGGCCGAGCCGGCGG + Intronic
1081578452 11:44334549-44334571 GGGCAAAGAGGCCCAGCCAGGGG + Intergenic
1081781921 11:45719020-45719042 AGGCAGAGAAACCCAGCCGGTGG - Intergenic
1081969402 11:47187300-47187322 GGGCGGAGAGGCCGAGCAGGTGG - Intergenic
1082835765 11:57649224-57649246 CAGCAGAGGCGCCGAGGCGGAGG + Exonic
1083571804 11:63765176-63765198 AGGCGCAGACGCCGAGCCCGGGG + Exonic
1083780784 11:64916280-64916302 AGGCAGGGACACTGAGCCGGGGG + Intronic
1084549620 11:69833424-69833446 GGGCAGAGAGGCTGAGCCACCGG + Intergenic
1084849887 11:71930115-71930137 GGGCAGAGAAGCAGAGACAGAGG + Intronic
1086575725 11:88337457-88337479 GGGCAGAAAGGACGACCCGGAGG + Intronic
1087205255 11:95387362-95387384 GAGCAGAGACTCCCAGCCTGAGG - Intergenic
1087761815 11:102110665-102110687 GGGCGGAGGCGCCGGGGCGGGGG + Exonic
1091222063 11:133935624-133935646 GGTCAGGTACGCCGAGGCGGAGG + Exonic
1091381788 12:66736-66758 TGGCAGTGACGCGGCGCCGGCGG + Intergenic
1095407784 12:41887028-41887050 GGGCAGAGAAGCCTACCTGGGGG - Intergenic
1095980042 12:47967345-47967367 GGGCAGAGGCACCTAGCCCGAGG + Intronic
1100330001 12:93572935-93572957 GGGAAGGGACGCGGAGCCAGTGG + Exonic
1101659496 12:106753281-106753303 GGGAAGAGACACCCAGCCAGAGG - Intronic
1103918237 12:124386781-124386803 GGGCAGACAGGCCGAGACCGGGG - Intronic
1104740191 12:131166209-131166231 GGGCAGAGACGTCACGCTGGAGG + Intergenic
1110860538 13:80341143-80341165 AGGCAGCGAGGCCGAGGCGGGGG + Intergenic
1114499029 14:23154410-23154432 GGGCAGGGAAGCCGGGCCTGTGG + Intronic
1118289096 14:64504148-64504170 GGCCAGGGAGGCCGAGCCGCGGG + Intronic
1121716645 14:96080823-96080845 GGGCAGGGACCCCAAGCCTGGGG + Intronic
1122470989 14:101965431-101965453 GGGCAGACCCGCGGAGCTGGGGG + Intronic
1122922688 14:104886504-104886526 GGGCCGAGGCCCCGAGCCAGGGG + Exonic
1122939242 14:104973870-104973892 GGGCAGGGACCCGCAGCCGGAGG + Intronic
1123045084 14:105508272-105508294 AAGCAGAGTAGCCGAGCCGGTGG + Intergenic
1123574808 15:21656163-21656185 GGGCAGGGCCTCCGAGCCTGGGG + Intergenic
1123611423 15:22098652-22098674 GGGCAGGGCCTCCGAGCCTGGGG + Intergenic
1124372400 15:29111147-29111169 GGGCAGAGACACCGAGCCGTGGG - Intronic
1131060304 15:89400188-89400210 GGGCACAGGCGCCGCGCCGGCGG - Intergenic
1202983675 15_KI270727v1_random:390408-390430 GGGCAGGGCCTCCGAGCCTGGGG + Intergenic
1132685742 16:1161387-1161409 GGGCAGAGCCCCCTGGCCGGAGG + Intronic
1134509369 16:14834040-14834062 GCGCCGAGTCGCCGGGCCGGTGG + Intronic
1134697074 16:16232855-16232877 GCGCCGAGTCGCCGGGCCGGTGG + Intronic
1134974769 16:18561830-18561852 GCGCCGAGTCGCCGGGCCGGTGG - Intronic
1136498427 16:30658125-30658147 GGGCGGAGACGCGGGGCCTGAGG - Intergenic
1138527277 16:57616381-57616403 GAGCAGAGAGGCTGAGCCCGCGG + Intronic
1142225695 16:88876648-88876670 GGGCAGAGCCGCCGCGCCTGCGG + Exonic
1143461813 17:7108849-7108871 GAGCAGAGACGCTGTGCCAGGGG + Exonic
1143487121 17:7261275-7261297 GCGAAGAGAAGCCGAGACGGTGG + Intronic
1144953001 17:19004138-19004160 GGGCAGAGAAGCAGAGGCCGCGG - Exonic
1145214677 17:21042784-21042806 GGCCATGGACGCCGAGCTGGCGG - Exonic
1150904866 17:69326870-69326892 GGGCAGAGGCGGCGAGCTGAGGG - Intronic
1152758747 17:82097804-82097826 GCGCGGGGAGGCCGAGCCGGGGG + Intronic
1157867503 18:51198345-51198367 CGGCAGAGAAGCCGGGCCAGCGG - Intronic
1160873655 19:1287651-1287673 GGGCAGGGACCCCGGGCCGCTGG + Intronic
1161072389 19:2269416-2269438 GGGCAGAGCCGCGGGGCCGCCGG - Intronic
1161168843 19:2802997-2803019 GGGCTCAGAGGCCGAGCCTGCGG - Intronic
1161168853 19:2803044-2803066 GGGCTCAGAGGCCGAGCCTGCGG - Intronic
1161283213 19:3456675-3456697 GGGCAGAGGGGCCGGCCCGGGGG + Intronic
1161388172 19:4007895-4007917 GGGCCGGGACGGCGAGCCGCGGG - Intronic
1161818588 19:6515598-6515620 GGGGAGAGGTGCCGAGCCTGAGG + Intergenic
1163082552 19:14954314-14954336 GGGCAGCGTTGCCGAGCTGGGGG + Exonic
1166322249 19:42025662-42025684 GGGCAGTGACTCCGTTCCGGAGG - Intronic
1166748928 19:45155621-45155643 GGCCAGAGAAGCAGAGCCCGGGG + Intronic
1166873888 19:45885885-45885907 CGGCGGGGAGGCCGAGCCGGAGG - Exonic
1167075061 19:47243383-47243405 GGTCAGAGGTGCCGAGCTGGAGG - Intergenic
1167295513 19:48646737-48646759 GGGCAGAGGCGGAGAGCGGGAGG + Intergenic
1167426567 19:49432690-49432712 GGGCAGAGACGCCGAGCCGGCGG - Intronic
1168050231 19:53824282-53824304 GGGCGGAGAGGCTGAGCCAGTGG + Exonic
925580077 2:5401399-5401421 GGGCAGAGAGGCCGGGCTGTGGG + Intergenic
928313685 2:30230923-30230945 TGGCAGAGACGCGGAGCCGGGGG - Intergenic
929789760 2:45014001-45014023 GGGCGGGGACGCAGGGCCGGGGG - Intergenic
931539393 2:63313493-63313515 GGGCTGAGGCGCAGAGCCTGTGG + Intronic
935820259 2:106886781-106886803 GGGCCGAGCTGCCGGGCCGGGGG - Intronic
937993108 2:127675027-127675049 TGGCAGCGACGCCGAGCCCTGGG + Intronic
942323111 2:174753293-174753315 GGGCAGACACCCCGAGCGGCAGG - Intronic
942947319 2:181684299-181684321 GGGCGGAGGCGCCGCGTCGGCGG - Intergenic
946702202 2:222424800-222424822 GCGCAGAGCCGCGGCGCCGGAGG + Exonic
947533228 2:230925805-230925827 GGACAGAGAAGCCGAGGCTGGGG - Intronic
947631409 2:231655752-231655774 GTGCAGAGACGCCCAGGCAGGGG - Intergenic
948831639 2:240601178-240601200 GGGCAGAGCTGCCCAGCAGGAGG - Intronic
1169015050 20:2285089-2285111 GGACAGAGACTCTGAGCCAGAGG + Intergenic
1171981580 20:31632800-31632822 GGGCAGAGCCAGCGAGCCGATGG - Intergenic
1172644892 20:36462828-36462850 GGGCAGGGATGCCCAGCCCGTGG - Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1173734263 20:45348321-45348343 AGGCGGAGTCGCCGAGTCGGTGG - Exonic
1173942906 20:46927105-46927127 GGGCAGACACGCCCAGCACGAGG - Intronic
1175395145 20:58652387-58652409 GCGCAGTGACGCCAAGGCGGGGG - Intronic
1175920681 20:62449307-62449329 GGGCAGAGACCCAGTGCCGGGGG + Intergenic
1176163594 20:63661381-63661403 GGGCAGAGATGCCGTCTCGGAGG - Exonic
1176207132 20:63895273-63895295 GAGCGGAGCCGCGGAGCCGGCGG + Exonic
1176283416 20:64328097-64328119 TGGCAGTGACGCGGCGCCGGCGG - Intergenic
1176376634 21:6089937-6089959 CAGCAGAGACCCCGAGCCGAGGG + Intergenic
1179746841 21:43448307-43448329 CAGCAGAGACCCCGAGCCGAGGG - Intergenic
1179819811 21:43930239-43930261 GGGCAGAGACGCCGCACGGTGGG + Intronic
1180949546 22:19714931-19714953 GGGCAGTGCCGCCGCGCCTGGGG + Intronic
1180971607 22:19819009-19819031 GGGCTGAGACACCAGGCCGGAGG - Intronic
1181745525 22:24952923-24952945 GGGAAGAGGCGGGGAGCCGGAGG + Intronic
1182512321 22:30828092-30828114 GGGCAGAACCTCCGAGCCTGGGG + Intronic
1183027533 22:35076984-35077006 GGGCAGAGAAGCCGAGAAGCAGG - Intronic
1183332456 22:37228806-37228828 GGGCAGGGACGAGGAGCCTGAGG + Intronic
1184035164 22:41914721-41914743 GAGCGGAGGAGCCGAGCCGGAGG - Intergenic
1184045255 22:41969167-41969189 GGGCACAGAGGCAGAGCCAGAGG + Intergenic
1184247851 22:43244763-43244785 GGGCAGAGGCTCTGATCCGGTGG + Intronic
1184723834 22:46331759-46331781 GGCCAGAGTCGCCGGGCCCGTGG + Intronic
951223657 3:20095995-20096017 GGGAAGAGACTCCGAGGCAGAGG + Intronic
951728233 3:25783343-25783365 GGCCGGGGACGCCGAGCCTGAGG + Exonic
954615720 3:51967819-51967841 CGGCAGAGGCGCCGGGCGGGCGG - Intronic
955246236 3:57227698-57227720 GGGCAGGGAGGCCGAGGGGGCGG + Intergenic
963040520 3:141066503-141066525 AGGCAGTGACGCCGAGTCGTGGG + Exonic
968584677 4:1410691-1410713 GGTCAGAGACGGCGGGCTGGAGG - Intergenic
968671956 4:1856649-1856671 GGGCAGAGCCACAGAGCAGGGGG - Intergenic
968909299 4:3469459-3469481 GGCAAGAGACCCCCAGCCGGAGG + Intronic
975710608 4:77157337-77157359 GGGCTGTGAGGCCGAGGCGGCGG + Exonic
977607257 4:98995655-98995677 GGGGAGAGAGACCGAGTCGGGGG - Exonic
985966289 5:3340894-3340916 GGGCAGGGAGGCAGAGCTGGTGG + Intergenic
997430011 5:133831030-133831052 GGGCCGAGACGCTTAGCAGGTGG + Intergenic
999462622 5:151770678-151770700 GGGGAGAGAGGCCGAGCTGAAGG - Exonic
1001530001 5:172454705-172454727 GTGCTGAGCCGCCGCGCCGGGGG + Intergenic
1001580205 5:172792958-172792980 GGGGAGAGATGCCCAGCCTGAGG - Intergenic
1002335523 5:178475426-178475448 AGGCAGAGACCCCGAGGCAGAGG + Intronic
1004236555 6:13879662-13879684 GGAAAGAGAGGCAGAGCCGGGGG + Intergenic
1004913945 6:20313826-20313848 GGGCAGAGACTCTGATCCGAAGG - Intergenic
1007557930 6:42782501-42782523 GGGCGGCGAGGCCGGGCCGGGGG + Intronic
1007622147 6:43221802-43221824 GGGCAGAGGCCCAGAGCCGTCGG + Intronic
1019589482 7:1823667-1823689 GGGCACAGAGGCCGGGCCTGTGG + Intronic
1027195211 7:76025360-76025382 GGGCAGAGGCCCAGAGCAGGAGG + Intronic
1038006282 8:23433138-23433160 GGGCAGAGACATCCAGCAGGAGG - Exonic
1049214927 8:141403114-141403136 GGTCAGAGACGCAGAGCCCTGGG + Intronic
1049508978 8:143018422-143018444 GGGCGGAGTCGGCGAGCCCGCGG - Intronic
1049551967 8:143264198-143264220 GGTCAGAGACCCCGAGCCACTGG - Intronic
1056793201 9:89639492-89639514 GGGCAGAGAAGCAAAGCTGGGGG - Intergenic
1057164707 9:92916494-92916516 GGGCAGAGAGGCTGAGGCAGAGG + Intergenic
1057916850 9:99063308-99063330 GGGCAGAGACGTCTACCTGGAGG + Intronic
1059413474 9:114148986-114149008 GGGAAGAGAGGCAGAGCTGGGGG - Intergenic
1060481859 9:124021073-124021095 GGGAGGAGACACAGAGCCGGTGG - Intronic
1061726046 9:132582558-132582580 GCGCCGAGCCGCCGAGCCGAGGG - Exonic
1062542634 9:137048417-137048439 GGGCAGAGACGCTGAGGGTGGGG + Exonic
1193536898 X:82727723-82727745 GGGTAGAGACACCGAGAAGGGGG - Intergenic
1198312615 X:135436582-135436604 AGGCAGAGAAGGAGAGCCGGCGG + Intergenic
1200149129 X:153942890-153942912 GGGCAAATACGCAGAGCTGGGGG - Exonic
1200238080 X:154478759-154478781 GGGCAGAGACGCCGCGTCTGCGG - Exonic