ID: 1167427067

View in Genome Browser
Species Human (GRCh38)
Location 19:49434773-49434795
Sequence CGTGAGGATCCTGCAGGGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167427067_1167427073 4 Left 1167427067 19:49434773-49434795 CCAACCCCTGCAGGATCCTCACG 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1167427073 19:49434800-49434822 TGACACAGCCATAGTGGACGCGG 0: 1
1: 0
2: 2
3: 8
4: 97
1167427067_1167427072 -2 Left 1167427067 19:49434773-49434795 CCAACCCCTGCAGGATCCTCACG 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1167427072 19:49434794-49434816 CGAAGATGACACAGCCATAGTGG 0: 1
1: 0
2: 1
3: 8
4: 171
1167427067_1167427078 16 Left 1167427067 19:49434773-49434795 CCAACCCCTGCAGGATCCTCACG 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1167427078 19:49434812-49434834 AGTGGACGCGGGCAGCTGAGGGG 0: 1
1: 0
2: 0
3: 12
4: 151
1167427067_1167427076 14 Left 1167427067 19:49434773-49434795 CCAACCCCTGCAGGATCCTCACG 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1167427076 19:49434810-49434832 ATAGTGGACGCGGGCAGCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 65
1167427067_1167427074 5 Left 1167427067 19:49434773-49434795 CCAACCCCTGCAGGATCCTCACG 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1167427074 19:49434801-49434823 GACACAGCCATAGTGGACGCGGG 0: 1
1: 0
2: 0
3: 9
4: 85
1167427067_1167427077 15 Left 1167427067 19:49434773-49434795 CCAACCCCTGCAGGATCCTCACG 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1167427077 19:49434811-49434833 TAGTGGACGCGGGCAGCTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167427067 Original CRISPR CGTGAGGATCCTGCAGGGGT TGG (reversed) Exonic
900336740 1:2167963-2167985 CGTGGGTGTCCTCCAGGGGTTGG + Intronic
900599160 1:3495806-3495828 CGTGGGGACACTGGAGGGGTGGG - Intronic
902241918 1:15095187-15095209 CGTGAGGTTCCCGCATTGGTTGG - Intronic
902873253 1:19326623-19326645 CGTGAGCCTCCAGCAGGGGCTGG + Exonic
903869093 1:26419312-26419334 ACTGAGGTACCTGCAGGGGTGGG + Intronic
904947420 1:34209657-34209679 AGGGAAGAGCCTGCAGGGGTAGG + Intronic
911597785 1:99816559-99816581 CTTGAGGATACTGGAGGGGTGGG - Intergenic
913206587 1:116544859-116544881 CGTGAGGCTCCTGGAGGGCCTGG - Intronic
915943792 1:160135602-160135624 GGTGAGGAGGCTGCATGGGTTGG + Exonic
917154625 1:171983405-171983427 CTTGAGGATCCTTCAGGAGGAGG - Intronic
919781597 1:201224819-201224841 GCTGAGGACCCTGCAGGGGAAGG + Exonic
919973232 1:202594193-202594215 AGTGAGGAGCCTTGAGGGGTGGG - Exonic
922434897 1:225594544-225594566 AGTGAGGATCATGCCGTGGTAGG - Intronic
923011979 1:230095448-230095470 GCTGAGGAGCCCGCAGGGGTGGG - Intronic
923243397 1:232107934-232107956 CATGAGGTTCCTGAAGTGGTAGG - Intergenic
923815654 1:237374828-237374850 AGAGAGAACCCTGCAGGGGTTGG + Intronic
1062971997 10:1655090-1655112 GGTGAGGTTCCAGCAGGGGCAGG + Intronic
1067038772 10:42937287-42937309 CTGGTGGTTCCTGCAGGGGTGGG - Intergenic
1069692750 10:70364533-70364555 CATCAGGTCCCTGCAGGGGTTGG + Intronic
1069821139 10:71229471-71229493 CCTGAGGAGCCTGCAGAGGGCGG + Intronic
1070987780 10:80702998-80703020 CCTGAGGAGCCTGGAGGGGAAGG + Intergenic
1073060602 10:100731229-100731251 CGTGGGGATTCTGCAGGCGGGGG - Intergenic
1074214980 10:111375350-111375372 GGTGAGGATCCAGCAGGGCTGGG - Intergenic
1074235250 10:111578327-111578349 GGAGAGGTTCCTGGAGGGGTGGG + Intergenic
1074704164 10:116116558-116116580 AGTGAGGGTCCTGCATGTGTGGG - Intronic
1076765218 10:132629696-132629718 CGTGAGCATCCATGAGGGGTGGG + Intronic
1082883537 11:58061119-58061141 CCTGAGGAGCCTGTAGGGGAAGG - Intronic
1087240701 11:95774135-95774157 CCTGAGGAACCTGAAGTGGTGGG + Intronic
1088840629 11:113624674-113624696 CCTGAGGAGCCTGCAGGTGGTGG + Intergenic
1089659419 11:119976213-119976235 CGGGGGGCTCCTCCAGGGGTGGG + Intergenic
1089933395 11:122337795-122337817 TGTGAGGATTCTGCAAGGCTTGG - Intergenic
1090072776 11:123558870-123558892 CATGATGAGCCTGCAGGGGCTGG + Intronic
1090668826 11:128931963-128931985 TCTGTGGATACTGCAGGGGTAGG - Intergenic
1091632940 12:2176094-2176116 CATGAGGATGCTAGAGGGGTGGG + Intronic
1092136286 12:6149943-6149965 CTTCAGGATCCCGCAGAGGTTGG + Intergenic
1092149512 12:6237555-6237577 CGTGAGGAATCTGGGGGGGTTGG - Intronic
1102505883 12:113384433-113384455 GCTGAGGAGCCTGCAGGGGAGGG - Intronic
1103893470 12:124257029-124257051 TGTGAGGAGGCTGCAGGGGATGG - Intronic
1104381991 12:128315284-128315306 CGGGATGAGGCTGCAGGGGTAGG + Intronic
1104928923 12:132328337-132328359 GTTGAGGATCATGCAGGGCTTGG - Intronic
1105849148 13:24319007-24319029 CGGGGGGATTCTGCAGGGATTGG + Intronic
1108525098 13:51279724-51279746 CCTGCGGATCCTGCAGGGGTTGG - Intronic
1118265987 14:64295078-64295100 CCTGGGGCTCCTGCTGGGGTGGG - Intronic
1120075806 14:80157070-80157092 AGTGAGGATCCTTCAGGGAATGG + Intergenic
1121940752 14:98068371-98068393 CATGAGGATCCTGGAAAGGTTGG - Intergenic
1121965010 14:98295832-98295854 GGGGAGGATCCTGCATGGTTTGG + Intergenic
1127912311 15:63427711-63427733 CTTCAGGAAGCTGCAGGGGTTGG + Intergenic
1129253312 15:74320378-74320400 GGAGGGGATCCTGCAGGGGAGGG - Intronic
1130105445 15:80925405-80925427 TGTGAGGAGCCTGCATGGGCTGG + Intronic
1131165892 15:90141997-90142019 CCTGTGGAATCTGCAGGGGTGGG - Intergenic
1131511667 15:93052482-93052504 CTTGAGGATCTTGCACGGGGAGG + Exonic
1132656824 16:1044911-1044933 CGGGAGGAGCCTGGAGGGGCGGG + Intergenic
1132744713 16:1431841-1431863 TGGGAGGTCCCTGCAGGGGTGGG - Intergenic
1132939737 16:2500788-2500810 CCTGAGCATCCTGCAGGGGGAGG + Exonic
1133744554 16:8676347-8676369 CTTAAGGGTCCTGGAGGGGTTGG - Intronic
1136592704 16:31226968-31226990 CCTGAGGATCTGGCAGGGGAAGG + Intergenic
1138460661 16:57145898-57145920 CATGAGAGGCCTGCAGGGGTGGG + Intronic
1138497058 16:57415314-57415336 TGTGGGGAGCCTGCAGGGGTTGG - Intronic
1141167788 16:81671921-81671943 GGTGAGAAGCCTGCAGGAGTGGG - Intronic
1141430922 16:83969753-83969775 AGCGAGGGTCCTGCTGGGGTGGG + Intronic
1144945189 17:18966137-18966159 CGTGGGGGTCCTGCATGGGGAGG + Intronic
1146277224 17:31523499-31523521 CATGAGCTGCCTGCAGGGGTGGG - Exonic
1148699693 17:49580074-49580096 CCAGAGGAGCCAGCAGGGGTTGG - Exonic
1150196794 17:63307085-63307107 TGTGAGATGCCTGCAGGGGTAGG + Intronic
1151557693 17:74854856-74854878 GGTGAGGAGGCTGCTGGGGTTGG + Exonic
1151618910 17:75233045-75233067 CCTGAGGAACCTGCAGGGCCCGG - Exonic
1153293633 18:3525178-3525200 AGTAAGGCTCCTGGAGGGGTTGG - Intronic
1156591205 18:38490673-38490695 TGTGAGGTTACTGCAAGGGTAGG + Intergenic
1160950350 19:1663974-1663996 AGTGCGGATCCTGCAGGAGGAGG - Intergenic
1160992535 19:1865559-1865581 GGTGAGCAGCCTCCAGGGGTGGG + Intergenic
1163592761 19:18203715-18203737 GGTGAGGATCAGGCAGGAGTGGG + Intronic
1163804604 19:19387833-19387855 TGTGAGGAGCCTACAGGAGTGGG - Intronic
1166764677 19:45245605-45245627 CGTGAAGAGCATGCAGGAGTGGG - Intronic
1167427067 19:49434773-49434795 CGTGAGGATCCTGCAGGGGTTGG - Exonic
1167631723 19:50629873-50629895 GGTGAGGATCCTGCAGGCCCTGG - Exonic
925811714 2:7707885-7707907 GGTAAAGAGCCTGCAGGGGTGGG - Intergenic
925927243 2:8679161-8679183 CGGGAGGAGCCTGCGGGGGCGGG - Exonic
928363239 2:30682224-30682246 CTGAAGGATCCTGCAGGAGTGGG - Intergenic
928435838 2:31253902-31253924 AGTGAGGATGCAGCAGGAGTGGG + Intronic
929950436 2:46405865-46405887 CATGAAGATCAAGCAGGGGTTGG + Intergenic
930886609 2:56333518-56333540 GGTGAGGCTACTGCAGGGGTTGG + Intronic
935265200 2:101387560-101387582 CCCGGGGATCCTGCAGGGGCGGG - Exonic
935266558 2:101400010-101400032 ACTGAGGATCTTGAAGGGGTTGG - Intronic
935496771 2:103792031-103792053 CACCAGGATCCTTCAGGGGTCGG + Intergenic
935649723 2:105371949-105371971 CATGTGGATCCTGCAGAGGCTGG - Intronic
937551328 2:123095832-123095854 CACCAGGATCCTGCAGGGGAGGG - Intergenic
938464482 2:131517316-131517338 TGTGAGGATCAAGCAGGGGATGG - Intergenic
948505355 2:238424153-238424175 GGTGAGGATCCTGCTGGGCCTGG - Intergenic
948777582 2:240297675-240297697 AGAGAAGATGCTGCAGGGGTGGG - Intergenic
1168958059 20:1848586-1848608 GGTGAGGAGCCTACAGGGCTGGG - Intergenic
1169187785 20:3633216-3633238 AGTGACGATCCTGGGGGGGTTGG + Intronic
1170585658 20:17732299-17732321 AGTGAGGTTCCTCCAGGGGCCGG - Intronic
1175801703 20:61804663-61804685 TGTGGGGATCCTCCAGGGGAGGG + Intronic
1176246573 20:64100089-64100111 TGTGAGGACACTGCGGGGGTTGG + Exonic
1179416035 21:41199416-41199438 GCTGAGGATGCTGCAGGGGGTGG + Intronic
1180065995 21:45412712-45412734 CGTGAGGGTCCTGCAAGTGAAGG + Intronic
1181725276 22:24806724-24806746 CGTGAGGGCCCTCCAGGTGTGGG + Intronic
1184034720 22:41913019-41913041 CTTCTGGATGCTGCAGGGGTAGG - Intronic
1184880993 22:47304172-47304194 CTTGCTGATCCTGGAGGGGTGGG - Intergenic
1185342225 22:50296809-50296831 CATGAGGATCCCGGTGGGGTGGG - Intronic
952731700 3:36643604-36643626 CATGGGGATCCTGCAGGAATAGG - Intergenic
954784945 3:53085653-53085675 TGTGTGGAGCCTGCAGAGGTAGG + Intronic
957307440 3:78476019-78476041 CTTGAGGCTTCTGAAGGGGTGGG + Intergenic
959242033 3:103808645-103808667 GGTGAGGTGCTTGCAGGGGTGGG - Intergenic
968654195 4:1771640-1771662 TGTGAGGACCCTGCGGGGGCTGG + Intergenic
974928331 4:68329336-68329358 CTTGATGAGCCTGAAGGGGTCGG - Intronic
981635505 4:146874158-146874180 CCTGAGGATCCTGCTGCAGTAGG + Intronic
984788641 4:183592934-183592956 TGTGCGGATGCTGCAGGGATGGG - Intergenic
985570893 5:644101-644123 CCTGAGGGTGCTGCAGGGCTGGG + Intronic
987313258 5:16700893-16700915 CTTGAGGATGCAACAGGGGTGGG + Intronic
990330311 5:54719350-54719372 CGGCAGGATCTTCCAGGGGTTGG + Intergenic
997490038 5:134267447-134267469 AGTGGGGATCCTGCAGCGATAGG - Intergenic
998199421 5:140107851-140107873 CGAGCGGATCCCGCAGGGGAAGG + Intronic
998973219 5:147615269-147615291 GGAGAGGATCCTGAATGGGTTGG + Intronic
999179956 5:149662589-149662611 CGGGAGGATGTGGCAGGGGTGGG - Intergenic
999684337 5:154088881-154088903 CCTGGGGACCCTGCAGAGGTAGG + Intronic
1001066026 5:168535791-168535813 CATGAGGCCCCTCCAGGGGTGGG - Intergenic
1001808503 5:174609238-174609260 TGTGAGGATGCTGCAGGGGCAGG + Intergenic
1004001765 6:11602763-11602785 GGTGAGGCTTCTGCAGGTGTGGG - Intergenic
1004926639 6:20422258-20422280 GGTGAGGAAGCTGCAGAGGTTGG - Intronic
1006351461 6:33524289-33524311 CTGGAGGTTCCTGGAGGGGTGGG + Intergenic
1013608974 6:111776242-111776264 CCTGAGGATCACCCAGGGGTTGG + Intronic
1016243392 6:141957071-141957093 AGTGAGGATCATGCAGGGACTGG - Intergenic
1016504160 6:144759486-144759508 TGTGAGCATCTTTCAGGGGTTGG - Intronic
1022951415 7:35341880-35341902 GGTGAGGAACCTGCAGAAGTTGG + Intergenic
1024963374 7:55001794-55001816 AGTGAGGGTACTGAAGGGGTGGG - Intergenic
1026480961 7:70779343-70779365 AGTAAGGAACCTGCAGGCGTAGG - Intronic
1034399912 7:150855428-150855450 TGTGAGCCTCCTGCAGGGCTGGG - Intronic
1037839876 8:22237034-22237056 AATGAGGATCCTGCAGTTGTAGG + Intergenic
1047607321 8:126488260-126488282 AGGGAGGATCATGCAGGGGGTGG + Intergenic
1048580971 8:135729547-135729569 CGTGGGGTTGCTGCAGGGCTCGG - Intergenic
1049234726 8:141506921-141506943 CAGGAGCAGCCTGCAGGGGTTGG - Intergenic
1049824710 8:144661329-144661351 CGTGACACTCCTGCAGAGGTGGG + Intergenic
1055605416 9:77965238-77965260 CGTGAGGATTCTGTGGGTGTGGG - Intronic
1059379699 9:113913470-113913492 TGTGAGGAACCTGCAGGAGGGGG + Intronic
1060192670 9:121603033-121603055 GGTGAGGACCCTGGAGGGGTTGG + Intronic
1061005834 9:127928043-127928065 CGTGAGCTTGCGGCAGGGGTGGG - Exonic
1061013855 9:127970937-127970959 CTGGAGGGCCCTGCAGGGGTGGG + Intronic
1187527293 X:20065774-20065796 CTTTAGGGTTCTGCAGGGGTTGG - Intronic
1187607815 X:20905625-20905647 GATGGGGAGCCTGCAGGGGTTGG + Intergenic
1188986033 X:36769137-36769159 GGGGAGGATCCTGCAGGGAGTGG - Intergenic
1192218076 X:69177772-69177794 TGAGCGGAACCTGCAGGGGTTGG - Intergenic
1198989417 X:142494343-142494365 TGTGAGGATACAGCTGGGGTGGG + Intergenic
1199943712 X:152649170-152649192 GCTGAGGAAACTGCAGGGGTGGG - Intronic
1200056449 X:153463854-153463876 GCTGAGGGTCCTGCAGGGCTTGG - Intronic
1201304303 Y:12537441-12537463 CGTGAGCCTCCTGCACGGTTTGG + Intergenic