ID: 1167427073

View in Genome Browser
Species Human (GRCh38)
Location 19:49434800-49434822
Sequence TGACACAGCCATAGTGGACG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167427066_1167427073 10 Left 1167427066 19:49434767-49434789 CCTCTACCAACCCCTGCAGGATC 0: 1
1: 0
2: 1
3: 21
4: 251
Right 1167427073 19:49434800-49434822 TGACACAGCCATAGTGGACGCGG 0: 1
1: 0
2: 2
3: 8
4: 97
1167427067_1167427073 4 Left 1167427067 19:49434773-49434795 CCAACCCCTGCAGGATCCTCACG 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1167427073 19:49434800-49434822 TGACACAGCCATAGTGGACGCGG 0: 1
1: 0
2: 2
3: 8
4: 97
1167427069_1167427073 -1 Left 1167427069 19:49434778-49434800 CCCTGCAGGATCCTCACGAAGAT 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1167427073 19:49434800-49434822 TGACACAGCCATAGTGGACGCGG 0: 1
1: 0
2: 2
3: 8
4: 97
1167427068_1167427073 0 Left 1167427068 19:49434777-49434799 CCCCTGCAGGATCCTCACGAAGA 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1167427073 19:49434800-49434822 TGACACAGCCATAGTGGACGCGG 0: 1
1: 0
2: 2
3: 8
4: 97
1167427070_1167427073 -2 Left 1167427070 19:49434779-49434801 CCTGCAGGATCCTCACGAAGATG 0: 1
1: 0
2: 0
3: 19
4: 109
Right 1167427073 19:49434800-49434822 TGACACAGCCATAGTGGACGCGG 0: 1
1: 0
2: 2
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167427073 Original CRISPR TGACACAGCCATAGTGGACG CGG Exonic
900223393 1:1521470-1521492 GGACACAGCCATGTGGGACGTGG - Intronic
900566551 1:3335034-3335056 GGGCACAGCCAGAGAGGACGGGG + Intronic
903800795 1:25966717-25966739 TTACACAGCTATATTGCACGTGG - Intronic
904326637 1:29730782-29730804 TGACACACCCATTGTGAAGGGGG + Intergenic
905203173 1:36327622-36327644 TGACTCAGCCCTAGTGGAGCAGG + Intronic
906208873 1:44001256-44001278 GGTCACAGCCATTGTGGATGAGG - Exonic
906270123 1:44470976-44470998 TGCCTCAGCCTTAGTGGAGGTGG - Intronic
907528173 1:55066304-55066326 GAACACAGCCGTAGTGGGCGGGG - Intergenic
909253005 1:73381960-73381982 TGACCAAGACATAGTGGAAGAGG + Intergenic
912112624 1:106362170-106362192 TGGTACAGCCATTGTGGAAGTGG - Intergenic
913547336 1:119882195-119882217 TGACTCAGCCATAGAGGAGAAGG + Intergenic
913556869 1:119976144-119976166 TGACTCAGCCATAGAGGAGAAGG - Intronic
917679484 1:177351256-177351278 GGACCCAGCCATATTGGACTGGG + Intergenic
920250379 1:204618864-204618886 TGACACAGTCACAGCGGATGGGG + Exonic
920851438 1:209630717-209630739 AGACACAGACATCGTGGACCTGG + Exonic
1064107604 10:12513237-12513259 GGACACAGCCACCCTGGACGCGG + Intronic
1079732875 11:23957802-23957824 TGAAACAGCCAGAGTGGTTGTGG - Intergenic
1081652960 11:44837386-44837408 TGATAAAGCCTTAGTGGATGAGG + Intronic
1084164743 11:67370346-67370368 GGACACAGCCCCAGTGGCCGGGG - Intronic
1084971027 11:72772135-72772157 TGGCACTGCCATAGTGGGCATGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1085475690 11:76787454-76787476 TCACACAGCCAGAGAGGACAGGG - Intronic
1087873458 11:103326966-103326988 TCACACATCCATGGTGGATGCGG + Intronic
1089489396 11:118872438-118872460 TGACACAGCAGTAGGGGACAGGG - Intergenic
1090725773 11:129526119-129526141 TTACACGGCCAGAGTGGATGTGG + Intergenic
1092335487 12:7629073-7629095 AGACCCAGCCAGAGTGGACAGGG - Intergenic
1092446680 12:8564507-8564529 AGACCCAGCCAGAGTGGACAGGG + Intergenic
1102879930 12:116476663-116476685 TGACACAGCCATTGGGAATGAGG + Intergenic
1104679781 12:130741503-130741525 TGACACAGGCAAAGGGGACTTGG + Intergenic
1107761774 13:43687332-43687354 TGACACAGTCATATTGGACGGGG + Intronic
1112097269 13:96147991-96148013 TGACACAGTCACAGTGGTGGTGG - Intronic
1118796979 14:69152810-69152832 TGACACAGCCGAAGTGGCCGAGG + Exonic
1120185750 14:81392199-81392221 TGAGACAGCCAGAGGGGAGGGGG + Intronic
1121340280 14:93100945-93100967 TGACGCAGCCATCTGGGACGTGG - Intronic
1125717641 15:41828115-41828137 TGACGCAGCCATGGCGGAGGCGG + Exonic
1129944510 15:79527287-79527309 GGACACAGCCATATTGGATTAGG + Intergenic
1132609754 16:809521-809543 AGACACTGTCCTAGTGGACGAGG - Intronic
1138206243 16:55127248-55127270 TGAGTCAGCCATATTGGAAGAGG - Intergenic
1152118071 17:78400937-78400959 TGCCACAGGCATAGGGGACTTGG + Intronic
1156474179 18:37395162-37395184 TGGCAGAGCCTTAGTGGACAGGG + Intronic
1158512884 18:58107141-58107163 GGACACAGCCATATTGGATTAGG + Intronic
1159653793 18:71007953-71007975 TTACAAAGACATAGTGGAGGAGG - Intergenic
1162334192 19:10050121-10050143 GGAGACAGGCAAAGTGGACGTGG + Intergenic
1162376010 19:10305693-10305715 TGACTCAGCCCAAGTGGAGGGGG + Intronic
1162475518 19:10897179-10897201 TCACACAGCAAGAGTGGCCGAGG - Intronic
1165164468 19:33841856-33841878 TGAAACAGTCATTGTGGGCGGGG - Intergenic
1167426150 19:49430752-49430774 TGACACCTCCATAGTGCACCAGG + Exonic
1167427073 19:49434800-49434822 TGACACAGCCATAGTGGACGCGG + Exonic
925966297 2:9069815-9069837 TGACACAGCCTCAGAGGAGGTGG - Intergenic
927839775 2:26432692-26432714 TGACACAGCCAAAGTGGCCTAGG - Intronic
932101281 2:68901257-68901279 TCACACAGCCTTGGTGGACTTGG - Intergenic
933446004 2:82380451-82380473 AGACACAGCCATAGTTGGCGTGG - Intergenic
934538577 2:95157049-95157071 TGTCACAGCCACAGTGGAAGAGG - Intronic
936092141 2:109508242-109508264 TGACTCAGCCATTTTGGACAGGG + Intergenic
936117043 2:109710805-109710827 TGACACAGCTAAAGTGCCCGGGG - Intergenic
936526771 2:113246770-113246792 TGACGCAGCCATGGCTGACGCGG + Exonic
937325226 2:120986263-120986285 TGACACAGCTGCAGGGGACGAGG - Exonic
940221317 2:151355013-151355035 TGACCCAGAGATAGTGGAAGGGG + Intergenic
947009606 2:225551215-225551237 GGCCAAAGCCAGAGTGGACGTGG - Intronic
948087527 2:235263981-235264003 TCACACAGCCCTGGTGGATGGGG - Intergenic
948747991 2:240109747-240109769 TGACACAGCCAAAGGAGACGAGG - Intergenic
1168848531 20:961124-961146 GGGCACAGCCAGAGTGGAGGTGG - Intronic
1174574288 20:51525780-51525802 TGACAGAGCCACAGAGGAAGTGG - Intronic
1180961035 22:19762435-19762457 TGGCACAGCAGTAGTGGCCGTGG - Intronic
1184035870 22:41917814-41917836 TGACACAGGCTTAGTGGTAGTGG - Intergenic
1184820119 22:46903726-46903748 TGAGACAGCCCCAGTGGACGGGG + Intronic
1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG + Intergenic
953215016 3:40909852-40909874 TGCCACTGCCATAGTGGGCCAGG + Intergenic
957346189 3:78964186-78964208 GGACACAGCCATATTGGATTAGG + Intronic
957952135 3:87141103-87141125 TGAGACAGCCATGTTGGAGGGGG + Intergenic
959261457 3:104087261-104087283 TGACACAGAGATAGTGAAGGGGG + Intergenic
964622799 3:158732934-158732956 TGGCACAGCCACTGTGGAGGTGG + Intronic
965877896 3:173350690-173350712 AGACACAGCCATGGTGGCAGTGG + Intergenic
967091037 3:186134923-186134945 TGCCACAGCCATAGGAGAGGAGG - Intronic
968961242 4:3744703-3744725 TGACACAGCCATACGGGATACGG + Intergenic
971616396 4:28795442-28795464 TGAGACAGCCATATGGGAGGGGG + Intergenic
976523932 4:86064265-86064287 TGACCCAGCCGAAGTGGAGGCGG - Exonic
976747566 4:88419234-88419256 TGACACAGCCATAGAGAACGTGG - Intronic
979106070 4:116688127-116688149 TGACACAGCCAGTGGGGAGGGGG - Intergenic
980771396 4:137378109-137378131 TGAGGCAGTCATAATGGACGAGG + Intergenic
981584292 4:146284486-146284508 TGACACAGGCACAGGGGATGAGG - Intronic
983000152 4:162404247-162404269 TTACACAGCCATAGGGAACCTGG + Intergenic
985130082 4:186730009-186730031 AGACACACCCATAGTGGAGTAGG + Intergenic
986706386 5:10457733-10457755 TGACACAGCCACTGTGGAGCTGG + Intronic
991360569 5:65815615-65815637 TGTCACAGCAATAATGGACCTGG + Intronic
998184944 5:139971247-139971269 TGACACAGGCAGAGTGATCGTGG - Intronic
1000455040 5:161438125-161438147 TAACACAGTCATAGTGGTGGTGG + Intronic
1001136947 5:169110572-169110594 TGACACAGTCATATTGGATTAGG + Intronic
1002360748 5:178668797-178668819 GGACACAGTCATAGTGGATGAGG + Intergenic
1003601394 6:7520567-7520589 TGACACAGCCATATTTGACCTGG + Intergenic
1006421029 6:33934298-33934320 GGACACAGCCAGAGAGGGCGTGG - Intergenic
1006577542 6:35057311-35057333 TGACAGAGCCAGAGTGGCCTGGG - Intronic
1007616270 6:43181405-43181427 TGACCCAGGAATAGTGGACATGG + Exonic
1010311751 6:74394540-74394562 TGCCACAGCCATAATTCACGAGG + Intergenic
1016820643 6:148343058-148343080 GGACACGGCCATGGAGGACGCGG + Exonic
1019082052 6:169440874-169440896 TGAAAAAGCCATAGAGGAAGTGG - Intergenic
1022348358 7:29539799-29539821 TGGCACAGTCATAGTGGTGGTGG + Intergenic
1027426082 7:78062609-78062631 TGACAAAGCCACATTGGACAGGG - Intronic
1031123929 7:117751905-117751927 TTCCACAGCAATAGTGGAAGAGG - Intronic
1034760546 7:153668281-153668303 TGACACAGCTATTGTGGAGTTGG + Intergenic
1034991354 7:155549787-155549809 GGAGACAGCCATAGTGGCAGGGG - Intergenic
1049256052 8:141614457-141614479 TGGTACAGCCAGAGTGGACAAGG + Intergenic
1061169787 9:128945971-128945993 GGACACCGGCATAGGGGACGAGG + Exonic
1061849797 9:133407713-133407735 TGACACAGACATGGGGGAGGTGG - Intronic
1185445220 X:254272-254294 AGACACAGACACAGTGGATGAGG - Intergenic
1185616889 X:1427467-1427489 AGACACAGACACAGTGGATGAGG + Intronic
1186331134 X:8535558-8535580 TGACACAGACATAGTACAAGAGG + Intronic
1196494267 X:116306358-116306380 TGACACAGTCCTAGTGGTGGTGG - Intergenic