ID: 1167427073

View in Genome Browser
Species Human (GRCh38)
Location 19:49434800-49434822
Sequence TGACACAGCCATAGTGGACG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167427068_1167427073 0 Left 1167427068 19:49434777-49434799 CCCCTGCAGGATCCTCACGAAGA 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1167427073 19:49434800-49434822 TGACACAGCCATAGTGGACGCGG 0: 1
1: 0
2: 2
3: 8
4: 97
1167427069_1167427073 -1 Left 1167427069 19:49434778-49434800 CCCTGCAGGATCCTCACGAAGAT 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1167427073 19:49434800-49434822 TGACACAGCCATAGTGGACGCGG 0: 1
1: 0
2: 2
3: 8
4: 97
1167427070_1167427073 -2 Left 1167427070 19:49434779-49434801 CCTGCAGGATCCTCACGAAGATG 0: 1
1: 0
2: 0
3: 19
4: 109
Right 1167427073 19:49434800-49434822 TGACACAGCCATAGTGGACGCGG 0: 1
1: 0
2: 2
3: 8
4: 97
1167427066_1167427073 10 Left 1167427066 19:49434767-49434789 CCTCTACCAACCCCTGCAGGATC 0: 1
1: 0
2: 1
3: 21
4: 251
Right 1167427073 19:49434800-49434822 TGACACAGCCATAGTGGACGCGG 0: 1
1: 0
2: 2
3: 8
4: 97
1167427067_1167427073 4 Left 1167427067 19:49434773-49434795 CCAACCCCTGCAGGATCCTCACG 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1167427073 19:49434800-49434822 TGACACAGCCATAGTGGACGCGG 0: 1
1: 0
2: 2
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167427073 Original CRISPR TGACACAGCCATAGTGGACG CGG Exonic