ID: 1167427358

View in Genome Browser
Species Human (GRCh38)
Location 19:49436363-49436385
Sequence GGAAACGGAGGCGGCCCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167427347_1167427358 24 Left 1167427347 19:49436316-49436338 CCCCTGGAAATAAGGGCGGGACT No data
Right 1167427358 19:49436363-49436385 GGAAACGGAGGCGGCCCCTAAGG 0: 1
1: 0
2: 0
3: 3
4: 73
1167427348_1167427358 23 Left 1167427348 19:49436317-49436339 CCCTGGAAATAAGGGCGGGACTT No data
Right 1167427358 19:49436363-49436385 GGAAACGGAGGCGGCCCCTAAGG 0: 1
1: 0
2: 0
3: 3
4: 73
1167427349_1167427358 22 Left 1167427349 19:49436318-49436340 CCTGGAAATAAGGGCGGGACTTC No data
Right 1167427358 19:49436363-49436385 GGAAACGGAGGCGGCCCCTAAGG 0: 1
1: 0
2: 0
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167427358 Original CRISPR GGAAACGGAGGCGGCCCCTA AGG Intronic