ID: 1167427814

View in Genome Browser
Species Human (GRCh38)
Location 19:49438453-49438475
Sequence GGCGAGGGAGACTGGGACGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 543}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167427803_1167427814 3 Left 1167427803 19:49438427-49438449 CCCAGGAAGGGGCTGGAACAGAT 0: 1
1: 0
2: 2
3: 20
4: 256
Right 1167427814 19:49438453-49438475 GGCGAGGGAGACTGGGACGGGGG 0: 1
1: 0
2: 3
3: 51
4: 543
1167427797_1167427814 22 Left 1167427797 19:49438408-49438430 CCAGGGGATCGGGCTGGATCCCA 0: 1
1: 0
2: 2
3: 9
4: 132
Right 1167427814 19:49438453-49438475 GGCGAGGGAGACTGGGACGGGGG 0: 1
1: 0
2: 3
3: 51
4: 543
1167427804_1167427814 2 Left 1167427804 19:49438428-49438450 CCAGGAAGGGGCTGGAACAGATG 0: 1
1: 0
2: 3
3: 22
4: 260
Right 1167427814 19:49438453-49438475 GGCGAGGGAGACTGGGACGGGGG 0: 1
1: 0
2: 3
3: 51
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167427814 Original CRISPR GGCGAGGGAGACTGGGACGG GGG Intronic
900303550 1:1990371-1990393 GGAGAGGGAGACAGTGGCGGGGG + Intronic
900614400 1:3558233-3558255 GACGAGAGAGGCAGGGACGGTGG - Intronic
900948489 1:5844446-5844468 GGCGAGGGAGAGAGGGGTGGGGG + Intergenic
901796061 1:11680511-11680533 GGCGGGGGCGTCTGGGCCGGCGG - Intronic
901904335 1:12394691-12394713 GATTAGGGAGACTGGGATGGTGG - Intronic
902114116 1:14106993-14107015 GGGGAGGGAGACAGGGAGGGAGG - Intergenic
902553845 1:17235236-17235258 AGGGAGGGAGAGTGGGAGGGAGG + Intronic
902585305 1:17435526-17435548 GGCCAGGGAGACTGGGCAGGAGG + Intronic
902612163 1:17603632-17603654 GGGGAGGGAGGCTGGGACTGGGG + Intronic
904491323 1:30861344-30861366 GGTGAGGGAGGCTGGCAGGGTGG - Intergenic
905812086 1:40920114-40920136 GGCCTGGGTGACTGGGAAGGGGG - Intergenic
906789972 1:48650513-48650535 GGGGAGGGAGAGAGGGAAGGAGG - Intronic
907105484 1:51878736-51878758 CGAGAGGGAGACTGGGTTGGGGG - Exonic
908260966 1:62339016-62339038 GGTGGGGGAGACTGGGTGGGTGG - Intergenic
908751634 1:67429948-67429970 TGTGGGGGAGACTGGGATGGAGG - Intronic
909393120 1:75137148-75137170 GGCGAGGACGACGGGGACAGCGG - Exonic
910153246 1:84180414-84180436 GGTGGGGGAGAATGGGAGGGAGG + Intronic
910948163 1:92616146-92616168 GCTTAGGGAGACTGGGATGGTGG + Intronic
911073671 1:93851975-93851997 GGGGAGGGAGAGAGGGAGGGAGG + Intergenic
911189136 1:94930324-94930346 GGTAAGGAAGACTGGGAGGGAGG - Intergenic
914245156 1:145880105-145880127 TGCCAGGGAAACTGGGAGGGAGG - Intronic
914790760 1:150875973-150875995 GGGGACGGAGACGGGGACGGGGG + Intronic
914988740 1:152480518-152480540 GGAGAGAGAGACTGGGAAAGGGG - Intergenic
916495863 1:165346020-165346042 GGGGAGGGAGAAGGGGACAGAGG + Intronic
918087860 1:181260727-181260749 GGCTAGTGAGGCTGGGAAGGTGG + Intergenic
918616841 1:186553749-186553771 GGCAAGGGAGACTGTGACAGAGG + Intergenic
919069470 1:192735406-192735428 GGAGAGGGAGAGAGGGAGGGAGG + Intergenic
919809561 1:201399884-201399906 AGCGAGGCCTACTGGGACGGTGG - Intergenic
920197157 1:204236347-204236369 GCTCAGGGAGACTGGGATGGTGG + Intronic
920436959 1:205953292-205953314 GCCCAGGGAGACTGGGGTGGGGG + Intergenic
920703062 1:208232224-208232246 GGAGAGGGAGACTGGCACAGTGG - Intronic
921482683 1:215680845-215680867 AGAGAGGGAGACTGGGAAGATGG - Intronic
922005996 1:221531236-221531258 GGCAAGGGAGAGTGTGACAGAGG - Intergenic
922402786 1:225277114-225277136 GGGGAGGGGGACGGGGAAGGGGG + Intronic
923143363 1:231180478-231180500 GGAGAGGGAGACTAGCACGCTGG - Intronic
923592238 1:235328825-235328847 GGCGGGGGAGGCTGGGAGGCGGG + Intronic
924198963 1:241640208-241640230 GGCCACGGCTACTGGGACGGCGG - Exonic
1062922904 10:1293227-1293249 GGGGAGGGAGAGAGGGACGGGGG + Intronic
1063448683 10:6136606-6136628 GGCAAGGGAGCCTGGGGTGGTGG + Intergenic
1065413280 10:25454657-25454679 GGCGAGGCAGACAGGGTGGGTGG - Intronic
1067404473 10:46009266-46009288 GGCAAGTGAGGGTGGGACGGGGG - Intronic
1067460295 10:46453227-46453249 GGGGAAGGAGACAGGGAAGGAGG - Intergenic
1067626895 10:47931376-47931398 GGGGAAGGAGACAGGGAAGGAGG + Intergenic
1068830678 10:61491280-61491302 GGAGAGGGAGGCAGGGAGGGAGG + Intergenic
1069192585 10:65508385-65508407 GCTTAGGGAGACTGAGACGGTGG - Intergenic
1069658103 10:70105407-70105429 GGCGAGGGAGTCAGGGACAAAGG + Intronic
1070367618 10:75751341-75751363 GGAGAGGGAGACTGGGGAGAGGG + Intronic
1070766242 10:79058088-79058110 GGGGAGGGAGAGTGGGAAGCTGG - Intergenic
1071156816 10:82699294-82699316 AGGGAGGGAGACAGGGAGGGAGG + Intronic
1071378128 10:85031411-85031433 GCTTAGGGAGACTGGGATGGTGG + Intergenic
1072897171 10:99376972-99376994 AGGGAGGGAGACAGGGAAGGAGG - Intronic
1072900553 10:99403209-99403231 GGAGAGGAAGACTGGGTGGGGGG + Intronic
1072979991 10:100092183-100092205 GGAGACGGAGACAGAGACGGAGG - Intergenic
1073103767 10:101020727-101020749 GGAGAGTGAGAATGGGGCGGGGG + Intronic
1073215618 10:101834478-101834500 TGGGAGGGAGAGTGGGAGGGAGG - Intronic
1073249953 10:102115083-102115105 AGGGAGGGAGGCTGGGACGGAGG + Intronic
1073288016 10:102399993-102400015 AGCGAGGGAGACTATGAGGGCGG + Intronic
1073943955 10:108729887-108729909 GGAGAGGGAGAGAGGGAGGGAGG + Intergenic
1074524668 10:114253245-114253267 GAGGGGGGAGACGGGGACGGGGG - Intronic
1076371606 10:129959301-129959323 GGCGAGGGAGGCCGGGGCCGGGG + Intronic
1076505781 10:130971736-130971758 GGAGAGGGAGAGAGGGAGGGAGG - Intergenic
1076891176 10:133284243-133284265 GACGGTGGAGACTGGGACGCGGG + Intronic
1076948272 10:133665875-133665897 CGGGAGGGAGCCGGGGACGGGGG + Intergenic
1076949261 10:133669185-133669207 CGGGAGGGAGCCGGGGACGGGGG + Intronic
1076950245 10:133672484-133672506 CGGGAGGGAGCCGGGGACGGGGG + Intergenic
1076951230 10:133675783-133675805 CGGGAGGGAGCCGGGGACGGGGG + Intergenic
1076952220 10:133679093-133679115 CGGGAGGGAGCCGGGGACGGGGG + Intergenic
1076953208 10:133682403-133682425 CGGGAGGGAGCCGGGGACGGGGG + Intergenic
1076955176 10:133742054-133742076 CGGGAGGGAGCCGGGGACGGGGG + Intergenic
1076956166 10:133745364-133745386 CGGGAGGGAGCCGGGGACGGGGG + Intergenic
1076957154 10:133748673-133748695 CGGGAGGGAGCCGGGGACGGGGG + Intergenic
1076958143 10:133751983-133752005 CGGGAGGGAGCCGGGGACGGGGG + Intergenic
1076959127 10:133755282-133755304 CGGGAGGGAGCCGGGGACGGGGG + Intergenic
1076960116 10:133758592-133758614 CGGGAGGGAGCCGGGGACGGGGG + Intergenic
1077061654 11:620236-620258 GGGGATGGAGACAGGGACAGAGG + Intronic
1077162732 11:1121107-1121129 GGCCCGGGAGACTTGGAAGGGGG + Intergenic
1077210555 11:1369252-1369274 TGCCAGGGAGAACGGGACGGAGG + Intergenic
1077225089 11:1436147-1436169 GGGGAGGGAGGCGGGGCCGGCGG + Intronic
1077306096 11:1869255-1869277 GGCCAGGGATGCTGGGAGGGGGG + Intronic
1078196356 11:9140080-9140102 GGCGAGGGAGGCAGGGGAGGAGG - Intronic
1078845372 11:15114850-15114872 GGCGGGGGAGAACGGGGCGGGGG + Intronic
1080886659 11:36374469-36374491 AATGAGGGAGACTGGGAGGGAGG + Intronic
1081628724 11:44672529-44672551 GGCAAGGGAGAGTGGGGCAGGGG - Intergenic
1083322795 11:61857563-61857585 GAGGAGGGTGACTGGGACAGGGG + Intronic
1083628785 11:64085413-64085435 GGCGGGGGAGACTGGCAGGGAGG + Intronic
1083803676 11:65060969-65060991 GGTGAAGGAGGGTGGGACGGAGG - Intergenic
1083883226 11:65558399-65558421 GGCGAGGGGGGCTGGGACGCTGG + Intronic
1084549791 11:69834481-69834503 GGCGAAGCTGACTGGGCCGGGGG - Intergenic
1084624643 11:70296736-70296758 GGAGAGGGAGAGAGGGAGGGAGG + Intronic
1084674477 11:70626055-70626077 GGGATGGGAGGCTGGGACGGAGG - Intronic
1084735688 11:71103849-71103871 GGAGAGGGAGAAGGGGAGGGGGG - Intronic
1085232993 11:74989006-74989028 GGCTGGGGAGACTGAGACAGAGG - Exonic
1085517680 11:77121066-77121088 GGCCAGGGATGCTGGGACAGGGG - Intronic
1085655310 11:78309386-78309408 GGGGAGGGGGACAGGGACTGGGG - Intronic
1085697130 11:78714669-78714691 GGGGAGGGAGGATGGGAGGGTGG - Intronic
1089170170 11:116506354-116506376 GGCAAGGGAGAGTGGGAGGGAGG - Intergenic
1090664448 11:128905475-128905497 GGGGAGGGAGGCTGGGACGGGGG - Intronic
1091051472 11:132376712-132376734 GCTTAGGGAGACTGGGATGGTGG + Intergenic
1091197319 11:133742877-133742899 GGAGAGAGAGAGTGGGAGGGGGG + Intergenic
1091381800 12:66759-66781 GGGGAGGGAGGCTGGGCCGGTGG + Exonic
1092065879 12:5589341-5589363 GGAGAGGGAGACAGGGAAGGAGG + Intronic
1092093008 12:5819601-5819623 GGTTAGGGAGATTGGGATGGTGG + Intronic
1092267697 12:6995545-6995567 GGTGAGAGAGACTGGAAAGGAGG - Intronic
1093038339 12:14354046-14354068 GGAGAGGGAGAGGGGGAGGGAGG - Intergenic
1093093725 12:14949197-14949219 GAGGAGAGAGACTGGGAAGGGGG - Intronic
1093778956 12:23111881-23111903 GGAGAGGGAGAGAGGGAGGGAGG - Intergenic
1094085177 12:26582934-26582956 GGAGAGGGAGATGGGGATGGAGG - Intronic
1094103921 12:26788647-26788669 GGCTAGGGAGACTGGAATAGAGG - Intronic
1096870138 12:54587953-54587975 GGAGAGGGAGCCTGGAAGGGTGG - Intronic
1096982913 12:55738569-55738591 TGCCAGGGAGACTAGGACAGTGG + Intergenic
1097076598 12:56399460-56399482 GCTTAGGGAGACTGGGATGGTGG + Intergenic
1097218290 12:57430875-57430897 AGCAGGGGGGACTGGGACGGGGG + Exonic
1097333170 12:58354431-58354453 GGCGAGAGGGACTGTGACTGTGG + Intergenic
1097576435 12:61399167-61399189 GGAGAGCGAGAATGGGATGGGGG + Intergenic
1098774056 12:74588936-74588958 GGAGAGGGAGAGGGGGACGGGGG + Intergenic
1099091391 12:78314548-78314570 GGCGAGAGAGAGGGGGAAGGTGG + Intergenic
1099375075 12:81889111-81889133 GCCCAGGGAGACTGGGAGGTGGG - Intergenic
1100444732 12:94650285-94650307 GGCGAGGCGGGCTGGGGCGGCGG - Intronic
1100490402 12:95073141-95073163 GGCGGGGGCGACAGGGGCGGCGG - Intronic
1100982583 12:100173068-100173090 TTGGAGGGAGCCTGGGACGGTGG + Intergenic
1101209714 12:102523834-102523856 GGAGAGGGAGAGGGGGAAGGAGG + Intergenic
1101842884 12:108340573-108340595 GGAGAGGGAGATGGGGAGGGAGG + Intergenic
1101877182 12:108603582-108603604 GGCCAGGGAGGCAGGGAGGGTGG - Intergenic
1102180816 12:110911209-110911231 GGGGAGGGGAACTGAGACGGAGG + Intronic
1103804601 12:123562677-123562699 GGTGAGGGAGAAAGGGAAGGAGG + Intergenic
1104676767 12:130716359-130716381 GGAGAGGGAGAGAGGGAGGGAGG + Intergenic
1105011946 12:132761918-132761940 GGCGCGGGGGACACGGACGGCGG + Intergenic
1105773122 13:23631746-23631768 GAGGAGGGAGTCTGGGAGGGAGG + Intronic
1105964520 13:25372307-25372329 GGCGAGGGAGGGTGGGCCCGGGG + Intronic
1106143897 13:27035034-27035056 GGCGAGCGGGACAGGGACAGAGG + Intergenic
1106323731 13:28667280-28667302 GGCGTGGGAGGCTGAGGCGGGGG + Intronic
1106475275 13:30093087-30093109 GGAGTGCGAGACTGGGAGGGTGG - Intergenic
1106539973 13:30681703-30681725 GGTGAGGGAGGCTGGGTGGGAGG + Intergenic
1107165634 13:37279586-37279608 GGAGAGGGAGACGGAGACCGTGG - Intergenic
1107234213 13:38149264-38149286 AGAGAGGGAGGCTGGGAGGGAGG - Intergenic
1107458370 13:40576626-40576648 AGCGAGGGAGACAGGGAGGAGGG - Intronic
1107780091 13:43890969-43890991 GGCGAGGGAGCCAGGCACAGTGG + Intronic
1107863728 13:44683477-44683499 GGGGAGGGAGAGGGGGAGGGGGG + Intergenic
1110665212 13:78108850-78108872 GGTGAGGGAGACTGGGACTTGGG - Intergenic
1110779638 13:79449958-79449980 GGGGAGGGAGGCAGGGAGGGAGG - Intergenic
1112572808 13:100608948-100608970 GGCGAGGAAGCCTGGGTGGGCGG + Intronic
1112795018 13:103047527-103047549 GGGGAGGGAGAGAGGGAGGGAGG - Intronic
1112973586 13:105289854-105289876 GGGGAGTGAGACAGGGACAGAGG + Intergenic
1113589941 13:111491427-111491449 GGAGAGGGAGAAAGGGAGGGAGG - Intergenic
1113617227 13:111689414-111689436 GGCGAGGGAGGCTGGCAGAGGGG + Intergenic
1113622757 13:111774685-111774707 GGCGAGGGAGGCTGGCAGAGGGG + Intergenic
1113950793 13:114069913-114069935 GGGGTGGGAGACTGGGGGGGTGG + Intronic
1114536978 14:23429173-23429195 GGGTAGGGAGACTGGCATGGTGG - Intronic
1115498248 14:34027365-34027387 GGGGAGGGAGAGGGGGAGGGAGG + Intronic
1116501959 14:45634507-45634529 GGAGAGGGAGACGGAGAGGGAGG - Intergenic
1116945218 14:50830438-50830460 GGCGAGGGCGGCGGGGCCGGGGG - Intronic
1119559412 14:75578497-75578519 GGCAAGAGACACTGGGTCGGGGG + Intergenic
1119639604 14:76304882-76304904 GGAGAGGGAGTCTGGGCCTGGGG + Intergenic
1119786926 14:77320920-77320942 GGCGGGGGGGACTGGGCAGGAGG + Exonic
1119865583 14:77970835-77970857 GGCCAGGGTGACTGGTAAGGCGG + Intergenic
1120193932 14:81463187-81463209 GGAGAGGGAGAGGGAGACGGGGG + Intergenic
1120193940 14:81463206-81463228 GGGGAGGGAGAGGGAGACGGGGG + Intergenic
1120193948 14:81463225-81463247 GGGGAGGGAGAGGGAGACGGGGG + Intergenic
1120193956 14:81463244-81463266 GGGGAGGGAGAGGGAGACGGGGG + Intergenic
1120193964 14:81463263-81463285 GGGGAGGGAGAGGGAGACGGGGG + Intergenic
1120416278 14:84221832-84221854 AGGGAGGGAGACAGGGAGGGAGG + Intergenic
1120666398 14:87311318-87311340 TGGGAGGGAGAGTGGGAGGGAGG - Intergenic
1121312819 14:92944338-92944360 GGTGAGGGAGCCTGGTACTGAGG - Intronic
1121553579 14:94820180-94820202 GGTGAGGAATACTGTGACGGGGG - Intergenic
1121697770 14:95927722-95927744 GGGGAGGGAGAGAGGGACGGAGG - Intergenic
1121697781 14:95927750-95927772 GGAGAGGGAGAGAGGGACGGAGG - Intergenic
1121697790 14:95927778-95927800 GGAGAGGGAGAGAGGGATGGAGG - Intergenic
1121697797 14:95927800-95927822 GGAGAGGGAGAGAGGGATGGAGG - Intergenic
1121697806 14:95927828-95927850 GGAGAGGGAGAGAGGGACGGAGG - Intergenic
1121697815 14:95927856-95927878 GGAGAGGGAGAGAGGGACAGAGG - Intergenic
1121697823 14:95927884-95927906 GGAGAGGGAGAGAGGGACGGAGG - Intergenic
1121697848 14:95927960-95927982 GGAGAGGGAGAGAGGGATGGAGG - Intergenic
1121697867 14:95928016-95928038 GGAGAGGGAGAGAGGGATGGAGG - Intergenic
1121697876 14:95928044-95928066 GGAGAGGGAGAGAGGGATGGAGG - Intergenic
1121697925 14:95928222-95928244 GGAGAGGGAGAGAGGGATGGAGG - Intergenic
1121697932 14:95928244-95928266 GGAGAGGGAGAGAGGGATGGAGG - Intergenic
1122002101 14:98667077-98667099 AGGGAGGGAGACAGGGAAGGAGG - Intergenic
1122523496 14:102363241-102363263 GGCGAGGGAGACGGGGCGGACGG - Intronic
1122592796 14:102867498-102867520 GTTGAGAGAGACTGGGAGGGTGG + Intronic
1122658717 14:103279788-103279810 GGGGAGGGAGGCTAGGACTGGGG + Intergenic
1122773276 14:104106489-104106511 GACGGGGGAGTCTGGGAGGGTGG + Intronic
1122892950 14:104741485-104741507 GGCCAGGGAGCCTGGCAAGGTGG + Intronic
1123917682 15:25048947-25048969 AGGGAGGGAGACAGGGAGGGAGG - Intergenic
1127469183 15:59275412-59275434 GGGAAGGGAGACAGGGAGGGAGG - Intronic
1127649701 15:60995108-60995130 GGCAGTGGAGACTGGGAGGGTGG + Intronic
1128226618 15:66006184-66006206 GGAGAGGCAGGCTGGGACTGGGG + Intronic
1128608239 15:69054354-69054376 GGGGAAGGAGACTGGGACGAAGG - Intronic
1129020553 15:72513806-72513828 GGGGAGGGAGAGGGGGAGGGAGG - Intronic
1129120518 15:73393676-73393698 GGGGAGAGGGACTGGGATGGGGG + Intergenic
1129712165 15:77825952-77825974 GGAGAGGGAGAGAGGGAGGGAGG + Intergenic
1130255356 15:82323421-82323443 GGCGGGGGAGACCGAGCCGGGGG - Intergenic
1130599609 15:85266565-85266587 GGCGGGGGAGACCGAGCCGGGGG + Intergenic
1131093568 15:89641859-89641881 GACAAGGGAGAATGGGATGGAGG + Intronic
1131366468 15:91846193-91846215 GGAGAGGGAGAGAGGGAGGGAGG - Intergenic
1131366492 15:91846276-91846298 GGAGAGAGAGACAGGGAGGGAGG - Intergenic
1131479563 15:92769378-92769400 GGAGAGGGAGACGGAGACCGTGG + Intronic
1131479570 15:92769401-92769423 GGAGAGGGAGACGGAGACCGTGG + Intronic
1132668216 16:1091387-1091409 TGCGTGGGAGGCTGGGCCGGAGG + Intronic
1132890159 16:2199814-2199836 GGGGCAGGAGGCTGGGACGGTGG - Intergenic
1133006381 16:2883733-2883755 GGCGTGAGATACTGGGGCGGGGG + Intronic
1133240520 16:4411753-4411775 GGCCAGAGAGACTGGGCCCGCGG + Intronic
1133485351 16:6214483-6214505 GGAGAGGGAGACAGGGAGAGAGG + Intronic
1133744092 16:8674423-8674445 GGCGGGGGAGACGGGGGCTGGGG - Intergenic
1133771473 16:8869094-8869116 CGGGAGGGAGCCCGGGACGGTGG + Intergenic
1133883828 16:9807379-9807401 GGGGAGGGAGAGAGGGAGGGAGG + Intronic
1134066624 16:11232515-11232537 GGCGAGGGGGAGGGGGAGGGAGG + Intergenic
1134881372 16:17747506-17747528 AGGGAGGGAGGCAGGGACGGAGG + Intergenic
1135122817 16:19781109-19781131 GGAGAGGGAGACTGGGGAGTAGG + Intronic
1135607604 16:23836971-23836993 TGGGAGGGGGACTGGGAAGGAGG - Intronic
1137413307 16:48247817-48247839 GGTGAGGGAGACTGAGAAGTCGG - Intronic
1137568366 16:49548625-49548647 GGGGAGAGAGACGGGGAAGGCGG + Intronic
1138195905 16:55051933-55051955 GGGGAGTGAGACAGGGAAGGTGG - Intergenic
1138591241 16:58000693-58000715 GGCCAGGGAGGCGGGGCCGGGGG + Intronic
1139550855 16:67672279-67672301 GGAGAGGGAGAGAGGGAGGGAGG + Intergenic
1139592530 16:67941541-67941563 GGCCAGGGAGATTGAGACTGCGG + Intronic
1140257483 16:73349669-73349691 GGAGAGGGAGAGAGGGAAGGAGG - Intergenic
1140257499 16:73349712-73349734 GGAGAGGGAGAGAGGGAAGGAGG - Intergenic
1140457632 16:75114283-75114305 GGCCAGGGAAACTGGGCCCGAGG - Intronic
1141094120 16:81150596-81150618 GGGGGGGGAGCCGGGGACGGTGG - Intergenic
1141313652 16:82939460-82939482 GGAGAGGGAGAGAGGGAGGGAGG + Intronic
1141445095 16:84052519-84052541 GGCGAGGGTGACTGGGAAGGAGG - Intergenic
1141605625 16:85151877-85151899 GCTGAGGGAGGCTGGGAGGGTGG - Intergenic
1141972505 16:87492931-87492953 GGCGACGGCGACGGCGACGGCGG + Intergenic
1142110137 16:88326938-88326960 GGGGAGGGAGACAGGGACACAGG - Intergenic
1142132692 16:88438124-88438146 GGGAAGGGAGACAGAGACGGCGG - Exonic
1142407686 16:89900186-89900208 GGCAAGAGAAACTGGCACGGTGG + Intronic
1142667327 17:1470476-1470498 GGCGTGGAACACTGGGCCGGAGG - Exonic
1143491155 17:7285916-7285938 GGTGTGGGAGGCTGGGGCGGGGG - Intronic
1144726218 17:17503979-17504001 GGCTGGGGAGACAGGGAAGGAGG + Intergenic
1146281651 17:31549157-31549179 AGAGAGGGAGCCTGGGACTGGGG - Intergenic
1146488405 17:33262316-33262338 GGAGAGGGAGAAAGGGAGGGAGG + Intronic
1146674163 17:34761365-34761387 GGGGAGGGAGACAGGGACTGGGG + Intergenic
1146757915 17:35449333-35449355 GGAGAGAGAGATAGGGACGGAGG - Intergenic
1147061215 17:37880041-37880063 AGGGAGGGAGACAGGGAGGGAGG + Intergenic
1147168536 17:38605529-38605551 GGCGAGGGATGCTGGGGCGCAGG - Intronic
1147421112 17:40322607-40322629 GGCGAGGGACAGAGGGAAGGAGG - Intronic
1147708874 17:42448466-42448488 GGAGAGGGAGAGTGAGACCGTGG - Intergenic
1147967101 17:44199460-44199482 GGAGACGGGGACGGGGACGGGGG - Intronic
1147994708 17:44354412-44354434 GGCGAGGGCGGCGGGGGCGGCGG - Exonic
1148201839 17:45754237-45754259 GGCTGGGGACACTGGGAAGGGGG + Intergenic
1148410502 17:47462481-47462503 AGAGAGGGAGACAGGGAGGGAGG + Intergenic
1148462590 17:47847040-47847062 GGCGAGGGAAACTGTGAGGCAGG + Exonic
1148557013 17:48584865-48584887 GACGAGGGAGCCTGGGATGCTGG - Intronic
1148602075 17:48901776-48901798 AGAGAGGGAGACGGGGGCGGGGG - Intergenic
1148616377 17:49003784-49003806 GGGGAGGGAGAGAGGGAGGGAGG + Intronic
1148686527 17:49504029-49504051 GGAGGGGGAGACAGGGAAGGAGG - Intronic
1148790379 17:50169296-50169318 GGGAAGGGGGACTGGGATGGGGG - Intronic
1149389680 17:56176198-56176220 GGCTAGGGAGTCAGGGACTGAGG + Intronic
1150146560 17:62774232-62774254 GGGGTGGCAGAGTGGGACGGAGG + Intronic
1150269034 17:63850503-63850525 GGAGAGGGAGAGAGGGAGGGAGG + Intergenic
1150477771 17:65487780-65487802 GGAGAGGGAGAGAGGGAGGGAGG + Intergenic
1151451121 17:74198941-74198963 GGCCAGGCAGACTGGAACAGGGG - Intergenic
1151464538 17:74276066-74276088 AGCGTGGGAGACTGGGAAGGAGG - Intronic
1151525312 17:74661727-74661749 GGGGAGGGAGAGAGGGAGGGAGG + Intergenic
1152550501 17:81027676-81027698 GGCGAGTGGGCCTGGGACTGGGG + Intergenic
1152645917 17:81468463-81468485 GGAGGGGGAGAGTAGGACGGCGG - Intergenic
1152673645 17:81624919-81624941 GGCGAGGCAGACAGGGCCGTGGG + Intronic
1152678483 17:81653612-81653634 GGCGAGGGAGGCCAGGACAGGGG - Intronic
1153515341 18:5895960-5895982 GGGGAGGGAGGCAGGCACGGAGG - Intergenic
1153654792 18:7272939-7272961 GGCGAGGGAGGCTGAGTCTGAGG + Intergenic
1156326520 18:36078667-36078689 GGAGAGGGAGACGGAGACCGTGG + Intergenic
1156483268 18:37449304-37449326 GGCCAGTGTGACTGGGACAGCGG + Intronic
1157597724 18:48874103-48874125 GGAGAGGGAGGCAGGAACGGAGG + Intergenic
1158893297 18:61893113-61893135 GGCGGGGGAGACTGCGGAGGAGG - Exonic
1158931491 18:62328221-62328243 GGGGAGGGAGAGAGGGAGGGAGG + Intronic
1159086343 18:63795935-63795957 GGCAAGGGAGACTGGTTAGGAGG + Intronic
1159989111 18:74881578-74881600 GGGGAGGGAGACAGGGAGGTAGG - Intronic
1160201664 18:76801611-76801633 GGCGAGGGAGGCAGGGAGAGGGG - Intronic
1160205086 18:76824839-76824861 GGAGAGGGAGGCTGGGTCAGAGG - Intronic
1160404826 18:78638154-78638176 GGGGAGGGCGGCTGGGAAGGAGG + Intergenic
1160415500 18:78707002-78707024 GGGGTTGGGGACTGGGACGGAGG - Intergenic
1160730786 19:640804-640826 GGCGGGGGGCACTGGGAAGGGGG + Intronic
1160894514 19:1396311-1396333 GGCCCGGGAGACTGGGGCGGGGG + Intergenic
1160940510 19:1618511-1618533 GGAGAGGGAGAGAGGGAAGGGGG - Intronic
1160953400 19:1678549-1678571 GGAGAGGGAGACAGAGACAGTGG - Intergenic
1161101833 19:2425325-2425347 GGCGAGCGAGACGGGGCGGGTGG - Intronic
1161131614 19:2592969-2592991 AGGGAGGGAGAGAGGGACGGAGG + Intronic
1161251771 19:3284636-3284658 GGAGAGGGAGATGGGGACGATGG + Intronic
1161491589 19:4565051-4565073 GGGGAGGGAGCCGGGGAGGGGGG + Intergenic
1161730484 19:5957539-5957561 GGGGAGGGAGTCAGGGAGGGAGG - Intronic
1161802644 19:6424574-6424596 GGCGCGGGGGACCGGGGCGGCGG - Exonic
1161878046 19:6927176-6927198 AGGGAGGGAGAGTGGGAGGGAGG - Intronic
1162017027 19:7851525-7851547 GGCGACGGGGAGTGGGAAGGTGG - Exonic
1162922031 19:13908894-13908916 GGGGAGGGAGAGAGGGAGGGAGG - Intronic
1163035699 19:14567668-14567690 GGCTAGGGAGGCTGGGTCTGAGG - Intronic
1163282230 19:16324998-16325020 GGTGAGGGCGGCGGGGACGGCGG + Exonic
1163306538 19:16483205-16483227 GGAGAGGGACACTGGGACAGGGG - Intronic
1164581628 19:29438699-29438721 GGAGAGGGAGAGAGGGAGGGTGG + Intergenic
1164956683 19:32392403-32392425 GGGGAGGGAGAGAGGGAGGGAGG + Intergenic
1165325852 19:35114438-35114460 GGAGAGGGAAACTGGGAGGCTGG - Intergenic
1165428217 19:35757089-35757111 GCCCAGGGACACTGGGACCGTGG + Intronic
1165902154 19:39174053-39174075 GGGGAGGGAGGGTGGGAGGGAGG - Intronic
1166079314 19:40433947-40433969 GGGGAGGGAGGCAGGGAGGGGGG + Intergenic
1166088085 19:40490054-40490076 GGCTAGGGCGACAGGGGCGGTGG - Exonic
1166113929 19:40641081-40641103 GGAGAGAGAGACTGGGAGGGAGG - Intergenic
1166218303 19:41350778-41350800 GGGGAGGGAGACTGGGGAGGAGG - Intronic
1166329103 19:42068640-42068662 GCCGAGGGAGACTTGGAAAGAGG + Intronic
1167103977 19:47419764-47419786 GGAGAGAGAGACTGGGAAAGAGG - Intergenic
1167390972 19:49194735-49194757 GGGGAGGGAGAGAGGGAGGGAGG - Intronic
1167427814 19:49438453-49438475 GGCGAGGGAGACTGGGACGGGGG + Intronic
1168143686 19:54406813-54406835 GGTCAGGGTGACTGGGAAGGGGG - Intergenic
1168373064 19:55852360-55852382 GGTGAGGGAGTCTGGGAAGGGGG + Exonic
1168414657 19:56160501-56160523 GGAGAGGGAGGCTGGGCCGCAGG - Exonic
925130161 2:1488808-1488830 GGTGAGGAAGACAGGGATGGGGG - Intronic
925227619 2:2199461-2199483 GGGGAAGGAGAGTGTGACGGGGG - Intronic
925781467 2:7385959-7385981 GGTGAGGGAGACAGAGATGGAGG + Intergenic
927019118 2:18999327-18999349 AGGGAGGGAGACAGGGAGGGAGG - Intergenic
928219493 2:29391663-29391685 GAGGAGGGAGACAGGGAGGGAGG - Intronic
928551722 2:32378367-32378389 TGAGAGGGAGACTGGGAAAGAGG + Intronic
931102564 2:59018905-59018927 GGCGGGGGAGCCGGGGAGGGAGG - Intergenic
931274881 2:60735767-60735789 GGCGAGGGCAGCGGGGACGGGGG + Intergenic
931274889 2:60735791-60735813 GGCGAGGGCAGCGGGGACGGAGG + Intergenic
932674575 2:73768045-73768067 GGCTAGGGAGACTGGGCCATGGG - Intronic
934527230 2:95059438-95059460 GGGGAGGGAGCCTGGGAGGCGGG - Intergenic
934715085 2:96538432-96538454 GGCGAGAGAGACAGGGTCTGGGG - Intronic
935979892 2:108616319-108616341 TACGAGGGAGACTGAGATGGGGG - Intronic
936013752 2:108942535-108942557 CGGGAGGGAGACGGGGACGCTGG - Intronic
937458881 2:122068424-122068446 GGCCAGTGAGACTGGGAGGGAGG - Intergenic
937686422 2:124703118-124703140 AGGGAGGGAGACAGGGAGGGAGG - Intronic
937778095 2:125805037-125805059 GGGTAGGGAGACTGGGTCTGGGG + Intergenic
937859334 2:126695964-126695986 GAGGAGGGAGACTAGGACGATGG - Exonic
938322076 2:130372359-130372381 GGGGACGGGGACGGGGACGGGGG + Exonic
939213557 2:139209879-139209901 GCTTAGGGAGACTGGGATGGTGG + Intergenic
939692166 2:145276841-145276863 GGAGAGGGAGAGAGGGAGGGAGG + Intergenic
940556927 2:155240589-155240611 GGAGAGGGAGAAGGGGAAGGAGG - Intergenic
940606182 2:155926395-155926417 GGTTAGGGAGATTGGGATGGTGG - Intergenic
942241343 2:173965574-173965596 GGCGAGGGAGGCGGGCACAGCGG - Exonic
942558272 2:177194593-177194615 GGAGAAGGAGACTGGGAGAGTGG - Intergenic
945641907 2:212441819-212441841 GCTTAGGGAGACTGGGATGGTGG + Intronic
946157692 2:217817946-217817968 GGCAGGGGAGACAGGGAAGGAGG + Exonic
947082958 2:226419360-226419382 TGGGATGGAGACTGGGACAGGGG + Intergenic
947549776 2:231037820-231037842 GGCGAGGGCGGCTGGGGCGGCGG + Exonic
948563174 2:238867246-238867268 GGAGAGGGAGGCAGGGAGGGAGG + Intronic
1169945012 20:10978963-10978985 GGAGAGGGAGACGGGGCAGGGGG - Intergenic
1171249497 20:23637560-23637582 GCGGGGGGAGGCTGGGACGGCGG + Intronic
1172006195 20:31820305-31820327 GGAGAGGGTGACAGGGGCGGGGG + Exonic
1172051801 20:32123160-32123182 GGAGAGGGAGAGGGGGAGGGGGG + Intronic
1172180805 20:33002378-33002400 GGAGAGGGGAACTGGGAGGGAGG - Intronic
1172200910 20:33125370-33125392 GGCCTGAGAGACTGGGAGGGAGG - Intergenic
1172740326 20:37161426-37161448 GGAGAGGGAGACGGGGTGGGGGG + Intronic
1172764437 20:37343813-37343835 GGCGAGGTAGCCAGGGACAGGGG + Intergenic
1172852597 20:37977333-37977355 GGGGGGGGAGACGGGGGCGGGGG + Intergenic
1173461491 20:43246770-43246792 GGTAAGACAGACTGGGACGGAGG - Intergenic
1173487000 20:43448387-43448409 GGAGAGGGAGAGAGGGAGGGAGG + Intergenic
1173540009 20:43844101-43844123 GGAGAGGGTGGCTGGGACCGGGG + Intergenic
1174758395 20:53182279-53182301 AGGGAGGGAGGCAGGGACGGAGG - Intronic
1175261686 20:57678551-57678573 GGCGAGGGAGGCTGCGAGAGAGG - Intronic
1175795108 20:61766189-61766211 GGCGAGGGAGACTGAGGGTGGGG - Intronic
1175831009 20:61965643-61965665 GGCCAGGGAGGCTGGGGAGGCGG - Intronic
1175921295 20:62451653-62451675 GGGGAGGGAGAGAGGGAGGGAGG + Intergenic
1175950162 20:62579189-62579211 GGAGAGGGAGACAGAGACAGAGG - Intergenic
1175950180 20:62579321-62579343 GGAGAGGGAGACAGAGACAGAGG - Intergenic
1175950191 20:62579409-62579431 GGAGATGGAGACAGGGACAGAGG - Intergenic
1175950209 20:62579572-62579594 GGAGAGGGAGACAGAGACAGAGG - Intergenic
1175950217 20:62579644-62579666 GGAGAGGGAGACAGGGACAGAGG - Intergenic
1175950223 20:62579666-62579688 GGAGATGGAGACAGGGACAGAGG - Intergenic
1176005791 20:62861695-62861717 GGCGAGGGCGACGCGGGCGGCGG + Exonic
1176034875 20:63031368-63031390 GGCGTGGGAGCCTGGGGCTGGGG + Intergenic
1176128921 20:63488065-63488087 GGCGCGGAAGCCTGGGGCGGGGG + Exonic
1176234838 20:64049388-64049410 GGCGAGGGCGGCGGGGCCGGCGG + Exonic
1176283404 20:64328074-64328096 GGGGAGGGAGGCTGGGCCGGTGG - Intergenic
1176429092 21:6565052-6565074 GGGGAGGGAGACTCGGCCTGGGG + Intergenic
1178357848 21:31923500-31923522 GGGGAGGGAGAGAGGGAAGGAGG + Intronic
1178873285 21:36393211-36393233 GGAGAGGGAGAGGGAGACGGTGG + Intronic
1179704582 21:43173368-43173390 GGGGAGGGAGACTCGGCCTGGGG + Intergenic
1180095301 21:45553656-45553678 GGTGTGGGGGACTGGGAAGGGGG - Intergenic
1180095425 21:45553917-45553939 GGCACGGGGGACTGGGAGGGGGG - Intergenic
1180095436 21:45553938-45553960 GGCGTGGGGGACTGGGAGGGGGG - Intergenic
1180095514 21:45554101-45554123 GGTGTGGGGGACTGGGAAGGGGG - Intergenic
1180095649 21:45554382-45554404 GGCGTGGGGGACTGGGAAGGGGG - Intergenic
1180095678 21:45554443-45554465 GGCATGGGGGACTGGGATGGGGG - Intergenic
1180979955 22:19873759-19873781 GGCAAGGGAGACCGGGAGAGCGG + Intergenic
1181630217 22:24147260-24147282 AGGGAGGGAGGCAGGGACGGAGG - Intronic
1181902758 22:26169601-26169623 GGCGAGGGAGCTGGGGAAGGAGG - Exonic
1182022911 22:27096191-27096213 GGCGAGAGAGAGTGTGAAGGAGG + Intergenic
1182031342 22:27161663-27161685 GGAGAGGGAGAGTGAGAAGGAGG + Intergenic
1184325734 22:43782914-43782936 GGTGAGGGAGAATGGGAATGAGG - Intronic
1184530370 22:45051606-45051628 GGCCATGGAGCCTGGGAAGGAGG - Intergenic
1184615173 22:45633045-45633067 GGCGGGGGAGACAGGGTTGGGGG + Intergenic
1184694512 22:46131963-46131985 GGCCAGGGTGACTGGGACAGGGG + Intergenic
1185066316 22:48633294-48633316 GGCCTGGGAGACTGGGCAGGTGG + Intronic
1185229840 22:49673616-49673638 GGGGAGGGAGAGGGGGAAGGGGG + Intergenic
950011731 3:9728926-9728948 GGGGAGGGAGACTGGAAAGGAGG - Intronic
950139696 3:10606939-10606961 GGAGAGGGAGAGGGGGAGGGGGG + Intronic
950404749 3:12797349-12797371 GGGGAGGGAGACGGGGAGGGAGG - Intronic
950748232 3:15107845-15107867 GGGGAGGGAAACTGGAATGGTGG + Intergenic
950840843 3:15966945-15966967 GGAGAGGGAGACTGACACTGAGG + Intergenic
951981079 3:28567840-28567862 GGCAAGGGGGATTGGGACGTGGG + Intergenic
952255452 3:31691324-31691346 GGCGAAGGACACTTGGAAGGAGG + Intronic
952345119 3:32476622-32476644 GGCAAGGGAGACATGGAGGGAGG + Intronic
952977633 3:38709625-38709647 GACAAGGGAGAGTGGGAAGGAGG + Intronic
953099583 3:39810989-39811011 GGGGAGGAAGACTGAGACTGGGG + Intronic
953885592 3:46712822-46712844 GGGGAGGGAGAGCGGAACGGTGG - Intronic
955298626 3:57756655-57756677 GGGGAGGGAGACTGGCCCGGAGG - Exonic
956165781 3:66397248-66397270 GGGCAGGGAGGCTGGGACTGGGG - Intronic
957505883 3:81119875-81119897 GGTGAGGGAGGTTGGGAGGGAGG + Intergenic
959678556 3:109066020-109066042 GGAGAGGGAGGCAGGGATGGGGG + Intronic
961142839 3:124569778-124569800 TGAGAGGGAGAGTGGGAAGGTGG - Intronic
961497813 3:127306924-127306946 TAAGAGAGAGACTGGGACGGCGG - Intergenic
961563262 3:127746111-127746133 GGCCAGGGAGACTGGGGAAGAGG + Intronic
961729029 3:128953620-128953642 GGAGAGGGAGACGGAGAGGGAGG - Intronic
962486652 3:135849952-135849974 AGGGAGGGAGACAGGGAGGGAGG + Intergenic
963790463 3:149577809-149577831 GGGGAGGGTGACTTGGAGGGTGG - Intronic
965701112 3:171460174-171460196 GGCGGGGGAGGCTGGGCCCGGGG - Exonic
966246280 3:177811351-177811373 GGTGAGAGAGACTGAAACGGAGG + Intergenic
966444567 3:179987305-179987327 GGAGAGGGAGAGAGGGAGGGAGG - Intronic
966834501 3:184038675-184038697 AGGGAGGGAGACAGGGAAGGAGG - Intronic
966843295 3:184106393-184106415 AGGGAGGGAGACAGGGAAGGAGG - Intronic
967606838 3:191456936-191456958 GGTGAGGGAGAATGGGTGGGAGG + Intergenic
968059300 3:195714827-195714849 GGGGAGGGTGACAGGGACAGAGG + Intergenic
968356083 3:198108306-198108328 GGGGAGGGAGGGAGGGACGGAGG + Intergenic
968747039 4:2365495-2365517 GGCCAGGGAGGCAGGGCCGGGGG - Intronic
968914664 4:3492211-3492233 AGGGAGGGAGACTGGGAGTGAGG + Intronic
968947855 4:3675000-3675022 GGGGAGGGAGAGAGGGAGGGAGG - Intergenic
969239391 4:5888834-5888856 GGGGAGGGAGTGTGGGACGGGGG + Intronic
969331104 4:6473746-6473768 GGGCAGGGAGACTGGGGCTGTGG + Intronic
969842626 4:9893539-9893561 GGGGAGGCAGAGAGGGACGGAGG + Intronic
970332679 4:15002468-15002490 GGCTACGGCGACTGCGACGGCGG + Intergenic
971186973 4:24387961-24387983 GGAGAGGGAGAAAGGGAGGGAGG + Intergenic
971393675 4:26209546-26209568 AGGGAGGGAGACAGGGAAGGAGG - Intronic
971393683 4:26209570-26209592 AGGGAGGGAGACAGGGAAGGAGG - Intronic
972670956 4:41214024-41214046 GGCGGGGGAGACCGGGTTGGAGG - Intronic
972937084 4:44149928-44149950 AGGGAGGGAGACAGGGAAGGAGG + Intergenic
975426336 4:74232417-74232439 AGAGAGGGAGACTGGGACGGTGG - Intronic
975673150 4:76801943-76801965 GGCGAGGGCGAGTGGAACAGAGG - Intergenic
976127192 4:81846486-81846508 GGCGAGGGAGACAGAGATAGGGG + Intronic
976215375 4:82710797-82710819 GGAGAGGGAGAGAGGGAGGGAGG + Intronic
978912672 4:114082897-114082919 TGGGAGGGAGAATGGGAAGGTGG - Intergenic
980509492 4:133766701-133766723 AGAGAGGGAGAGTGGGAGGGAGG + Intergenic
982717874 4:158827825-158827847 GCCAAGGGAGGCTGGGGCGGTGG - Intronic
982745775 4:159103291-159103313 GCCGAGAGCGACTGGGCCGGAGG + Intergenic
984221791 4:176987153-176987175 GGAGAGAGAGACTAGGACAGAGG + Intergenic
984715077 4:182917480-182917502 GGGGAGGGAGGGAGGGACGGCGG + Intronic
985008179 4:185555468-185555490 GGCGGGGAAGAGTGGGAAGGAGG - Intergenic
985453699 4:190073264-190073286 CGGGAGGGAGCCGGGGACGGGGG + Intergenic
985454688 4:190076557-190076579 CGGGAGGGAGCCGGGGACGGGGG + Intergenic
985457648 4:190086444-190086466 CGGGAGGGAGCCGGGGACGGGGG + Intergenic
985774999 5:1836876-1836898 GGAGAGGGACACTAGGACAGGGG - Intergenic
985847761 5:2364983-2365005 TGCGAGGGGGACTGAGACTGAGG + Intergenic
985890294 5:2710155-2710177 GGCGAGGGAGGCTGCGCAGGTGG + Intergenic
986464825 5:8010821-8010843 GGTGAGGGAGACTGGAAAAGGGG - Intergenic
986836711 5:11647087-11647109 GGTGATGGAGACAGGGACAGTGG - Intronic
987204453 5:15610585-15610607 GGAGAGGGAGGCAGGGAGGGTGG - Intronic
988760854 5:34307702-34307724 GGAGACGGAGACGGAGACGGAGG + Intergenic
990416426 5:55591352-55591374 GGAGAGGGAGAGAGGGACAGAGG + Intergenic
992440573 5:76794487-76794509 AGGGAGGGAGACAGGGAGGGAGG - Intergenic
992556371 5:77907274-77907296 TGAGAGGGAGACTGGGCTGGAGG + Intergenic
992661927 5:78970611-78970633 GGAGAGGGAGACAGTGACAGAGG + Intronic
993016187 5:82536948-82536970 GGCGATGGAGATTGGGCTGGTGG + Intergenic
993766532 5:91865354-91865376 GGCAGGGGAGAGTGGGAAGGAGG + Intergenic
994291640 5:98034011-98034033 GCTTAGGGAGACTGGGATGGTGG - Intergenic
995433346 5:112107097-112107119 GAAGAGTGAGACTGGGAAGGAGG - Intergenic
995539315 5:113169086-113169108 GGGCAGGGAGTCTGGGACGGTGG - Intronic
997079464 5:130721647-130721669 GGAGAGGGAAACTGGGATGGTGG + Intergenic
997383039 5:133450965-133450987 GTGGAGGGAGACAGGGACAGAGG + Intronic
997713964 5:136028760-136028782 GGCGAGGGAGAGAGGGAGGGAGG + Intergenic
998004624 5:138648856-138648878 GGGGAAGGAGACAGGGACAGAGG - Intronic
998130042 5:139647261-139647283 GGGGAGGGAGAGGGGGAGGGCGG - Intergenic
998374646 5:141682483-141682505 CGGGACGGAGACTGGGACGGAGG + Intergenic
999736494 5:154517265-154517287 GGGGAGGGAGACTGGGAACTGGG - Intergenic
1000240623 5:159405075-159405097 GGCCTGGGAGATTGGGGCGGGGG - Intergenic
1001060469 5:168484112-168484134 GGCAAGACAGAATGGGACGGTGG - Intergenic
1001089453 5:168726509-168726531 GGAGAGGGAGGCAGGGAGGGAGG + Intronic
1002115581 5:176960628-176960650 GGAGACGGAGACGGAGACGGAGG - Intronic
1002377326 5:178797613-178797635 TGCGGGGGAGACGGGGACAGCGG + Intergenic
1003234586 6:4284252-4284274 GGCGGCAGAGACTGGGACAGAGG + Intergenic
1004262105 6:14117619-14117641 GGCGAAGGGGGCGGGGACGGGGG + Exonic
1005205255 6:23395419-23395441 GGCCAGAGAGACAGGGACTGGGG + Intergenic
1006132855 6:31879130-31879152 GGAGCTGGAGCCTGGGACGGGGG + Intergenic
1006339794 6:33440576-33440598 GGTGAGAGAGACAGGGAAGGAGG - Intronic
1006411357 6:33875678-33875700 GGCTAGGGAGAGTGGGTTGGAGG + Intergenic
1007082307 6:39116439-39116461 GGAGAGGGAGGCAGGGAGGGAGG + Intergenic
1007378032 6:41469563-41469585 GGTGAGGGAGGCTGGAAGGGGGG + Intergenic
1007424000 6:41735284-41735306 GGCCAGGGAGCCTGGGTCGGGGG + Intronic
1008553938 6:52656959-52656981 GGAGAGGGAGACGGAGACCGTGG + Intergenic
1010800485 6:80168733-80168755 GGGGAGGGAGGCAGGGAGGGAGG + Intronic
1011039617 6:83015296-83015318 GCTTAGGGAGACTGGGATGGTGG - Intronic
1011445240 6:87432437-87432459 GGGGAGGGAGAGAGGGAGGGAGG - Intronic
1011517007 6:88166127-88166149 GGCGCTGGAGACCGGGACGCCGG - Exonic
1011640552 6:89412607-89412629 GGCGTGTGGGAGTGGGACGGCGG - Intergenic
1012730205 6:102872279-102872301 GGCTAAGGAGAATGGGACGGTGG + Intergenic
1013003642 6:106049602-106049624 GGAGAGGAAGACAGGGAGGGAGG - Intergenic
1013195423 6:107840818-107840840 GGCAATGGAGAGTGGGACGGGGG + Intergenic
1015139356 6:129912180-129912202 GGAGAGGGAGACAGCGATGGAGG + Intergenic
1015425416 6:133060001-133060023 GTGGAGGGAGAGAGGGACGGAGG + Intergenic
1015475470 6:133655280-133655302 GCTTAGGGAGACTGGGATGGTGG + Intergenic
1017443892 6:154489975-154489997 GAGGAGGGAGACTGGGGTGGGGG - Intronic
1017872868 6:158501977-158501999 GGCGGGGGAGGCAGGGACAGTGG - Exonic
1017991666 6:159494578-159494600 GGCTAGGGTGCTTGGGACGGGGG - Intergenic
1018140542 6:160829677-160829699 GGAGAGGGAGAAAGGGAAGGAGG + Intergenic
1018569699 6:165196031-165196053 GGTTAGGGAGATTGGGATGGTGG + Intergenic
1018602800 6:165563237-165563259 GGAGAGGGAGAGAGGGAGGGAGG + Intronic
1018727786 6:166627114-166627136 GGCCAGGGAGCCCGGCACGGCGG + Intronic
1018888790 6:167965889-167965911 GGCGCGGGGGACGGGGACGGGGG - Intronic
1019008894 6:168825860-168825882 GGGGATGGAGCCTGGGGCGGGGG + Intergenic
1019008940 6:168826004-168826026 GGGGATGGAGCCTGGGGCGGGGG + Intergenic
1019125707 6:169838976-169838998 GGCGAGGGAGAGGGTGACGCAGG + Intergenic
1019524748 7:1475898-1475920 GGCCAGGGCACCTGGGACGGCGG + Intronic
1019587096 7:1811163-1811185 GGCGGGAGAGTCTGGGATGGGGG + Intergenic
1019873761 7:3790856-3790878 GGCTAGGGAGGTTGGGACAGGGG + Intronic
1020111241 7:5448854-5448876 GGGGAGGGAGACTGGGCTAGAGG + Intronic
1022251025 7:28608571-28608593 GGGGAGGGAGATTGGGAGGAGGG - Intronic
1023582859 7:41700656-41700678 AGGGAGGGAGACAGGGAGGGAGG + Intronic
1024884611 7:54126681-54126703 GCCTAGGGAGATTGGGATGGTGG - Intergenic
1024983216 7:55174599-55174621 GGTGAGGGACACTGGGGCTGTGG - Intronic
1025944498 7:66095460-66095482 GGGGAGGGTGACTGGGATGCAGG + Intronic
1026410954 7:70122180-70122202 GGGGATGGAGAGTGGGAGGGAGG + Intronic
1026471757 7:70699886-70699908 GGAGAGGGAGACTGGGGTAGAGG + Intronic
1027041502 7:74964768-74964790 GGCGAGGGAGGCAGCGCCGGCGG - Intergenic
1027082140 7:75237601-75237623 GGCGAGGGAGGCAGCGCCGGCGG + Intergenic
1027138229 7:75639264-75639286 GGCGAGGGGGAGGGGGAGGGGGG + Intronic
1027171915 7:75878872-75878894 TGCGTGGGAGGCCGGGACGGGGG - Intronic
1027232237 7:76279559-76279581 AGGGAGGGAGACAGGGAGGGCGG + Intronic
1027407026 7:77872798-77872820 GCTTAGGGAGACTGGGATGGTGG - Intronic
1028417530 7:90596196-90596218 GGCGAGGGCGAGTGGGCCGGCGG - Intronic
1030277191 7:107734065-107734087 GCTTAGGGAGACTGGGATGGTGG + Intergenic
1030566474 7:111164100-111164122 GGGGAGGGAGAAGGGGAGGGAGG + Intronic
1031414513 7:121479444-121479466 GGAGAGGGAGAGAGGGAGGGAGG + Intergenic
1031986551 7:128167708-128167730 GGCGAGGGCGGCTGGCGCGGGGG + Intergenic
1034560661 7:151877460-151877482 GGCGACGGGGAGCGGGACGGTGG - Intergenic
1035265949 7:157690467-157690489 GGCGAGAGAGGCTGGGATGGGGG - Intronic
1035567596 8:651657-651679 AGCGAGGGAGACGGGCAGGGTGG + Intronic
1036625634 8:10469370-10469392 GGCGAGGGAGGGAGGGAAGGAGG - Intergenic
1036625645 8:10469394-10469416 GGCGAGGGAGGGAGGGAAGGAGG - Intergenic
1036625656 8:10469418-10469440 GGCGAGGGAGGGAGGGAAGGAGG - Intergenic
1036652436 8:10653982-10654004 GGGGAGGGAGCCTGGGGCAGGGG + Intronic
1036963756 8:13273745-13273767 AGGGAGGGAGACAGGGAGGGAGG + Intronic
1037969353 8:23161005-23161027 GGCCAGGGAGCCTGGTATGGAGG + Intronic
1038540384 8:28385959-28385981 GGCGCGGCAGCCGGGGACGGGGG - Intronic
1039488013 8:37927066-37927088 GGAGAGGGAGAGGGGGAGGGAGG - Intergenic
1039554691 8:38467763-38467785 GGCGCAGGAGACGCGGACGGAGG + Exonic
1039953178 8:42187847-42187869 GGCGGGGGAGACTGGAGAGGTGG + Intronic
1041552699 8:59119321-59119343 GGCGCGGGAGGCGGGGATGGGGG - Intergenic
1042194974 8:66223978-66224000 TGCGAAGGAGACCGGGAGGGAGG + Intergenic
1042397810 8:68311868-68311890 AGGGAGGGAGACAGGGAAGGGGG - Intronic
1042397833 8:68311945-68311967 AGGGAGGGAGACAGGGAAGGAGG - Intronic
1043333639 8:79147322-79147344 GGCAAGGGAGTCTGGGCAGGTGG - Intergenic
1043958724 8:86390715-86390737 GGGGAGGGAGAGGGGGAGGGAGG + Intronic
1044279236 8:90337277-90337299 GGTGAGAGAGGTTGGGACGGAGG - Intergenic
1045195495 8:99926612-99926634 GGAGAGGGAGAGTGAGACCGTGG - Intergenic
1046419157 8:113957094-113957116 GGCGAGTGAGACAGAGAAGGAGG + Intergenic
1047038082 8:120961746-120961768 GGAGAGTGAGACTGTGACAGTGG + Intergenic
1047388778 8:124432853-124432875 GGAGAGGGAGACGGGGAGAGGGG + Intergenic
1047754603 8:127908878-127908900 GGAGAGGGAGACAGAGGCGGAGG - Intergenic
1047767694 8:128002922-128002944 AGGGAGGGAGACAGGGAGGGAGG - Intergenic
1048571841 8:135663233-135663255 GGAGAGGGAGGCTGGGCCAGAGG - Intergenic
1048986187 8:139736319-139736341 TGCCAGGCAAACTGGGACGGTGG + Intronic
1049178140 8:141206481-141206503 GACGAGGGAGAAAGGGACGAGGG - Intergenic
1049262326 8:141646376-141646398 GGCAAGGGTGGCTGGGGCGGAGG - Intergenic
1049439541 8:142602839-142602861 GGCTAGGGAGAGTGGGAAGGGGG + Intergenic
1049442419 8:142615406-142615428 AGAGAGGGAGACAGGGAGGGAGG + Intergenic
1051626242 9:19102479-19102501 GGCGAGGGAGCCTGAACCGGGGG - Intronic
1053330893 9:37206291-37206313 GGAGAGGGAGAGGGGGAAGGGGG - Intronic
1056381397 9:86060296-86060318 GGGGAGGGAGACAGGGAAAGCGG + Intronic
1056742189 9:89267079-89267101 GGGGAGGGAGTTTGGGAGGGTGG - Intergenic
1057182939 9:93039672-93039694 GCAGAGGGAGACTGGGATGCAGG + Intergenic
1057596388 9:96418690-96418712 GGCCAGGGAGACAAGGGCGGCGG + Intergenic
1057853271 9:98581512-98581534 AGGGAGGGAGACAGGGAGGGAGG + Intronic
1057861284 9:98642917-98642939 GGCGAGGGAGACAGTGCAGGAGG - Intronic
1057936612 9:99244926-99244948 GGGAAGGGAGACTGGGAAGAAGG + Intergenic
1058272321 9:102987570-102987592 GGAGAGAGAGATTGGGATGGGGG + Intergenic
1058603016 9:106691424-106691446 GGCAAGGGAGTGTGGGAGGGAGG + Intergenic
1058722337 9:107775359-107775381 GGAGACGGAGACGGAGACGGAGG - Intergenic
1060301226 9:122375649-122375671 GGCAAGGGAGAGTGGGAGGAGGG + Intronic
1060793354 9:126499946-126499968 GGCCACAGAGACTGGGACAGCGG + Intronic
1061818710 9:133210774-133210796 GGCGAATGAGACTGGGACACAGG - Intergenic
1062191406 9:135249650-135249672 GGGGAGGGAGAGGGGGAGGGAGG + Intergenic
1062640427 9:137515759-137515781 GGGGAGGGAGATTGGGAGGAGGG - Intronic
1062732528 9:138118097-138118119 GGCTAGTGAGACTGGGTTGGGGG + Intronic
1062732593 9:138118313-138118335 GGTGTGTGAGACTGGGATGGGGG + Intronic
1185459738 X:328707-328729 GGGGAGGGGGACGGGGAGGGGGG - Intergenic
1186406962 X:9312960-9312982 GGGGAGGGAGAGAGGGAGGGAGG + Intergenic
1186423175 X:9443072-9443094 CGGGAGGGAGACTTGGACGAAGG + Intergenic
1186423183 X:9443097-9443119 CGGGAGGGAGACTTGGACGAAGG + Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1186957158 X:14696173-14696195 AGGGAGGGAGAGTGGGAGGGAGG + Intronic
1186957163 X:14696189-14696211 AGGGAGGGAGAATGGGATGGAGG + Intronic
1187097735 X:16165186-16165208 GGAGAGGGAGACAGAGAGGGAGG - Intergenic
1187164029 X:16787670-16787692 GGGGACTGAGACTGGGAAGGTGG + Intronic
1187283733 X:17883050-17883072 AGGGAGGGAGAGTGGGAAGGAGG + Intergenic
1187464352 X:19514793-19514815 GACGAGGGGGAGGGGGACGGGGG + Intronic
1188080322 X:25830934-25830956 GGGAAGGGAGACTGGGAGGGGGG - Intergenic
1189095065 X:38129881-38129903 TGCGAGGGAGACTGAAACGAAGG - Intronic
1190111183 X:47590122-47590144 AGAGAGGGACACTGGGACTGAGG - Intronic
1190133058 X:47768757-47768779 GGTGGGGGGGACTGGGAGGGGGG - Intergenic
1190158881 X:48016304-48016326 GGAGAGGGAGACGGAGAGGGAGG - Intronic
1190184357 X:48221768-48221790 GGAGAGGGAGAGGGGGAGGGGGG - Intronic
1190739454 X:53279811-53279833 GGCGTGGGAGGCAGGGAGGGAGG + Intronic
1191659072 X:63632030-63632052 GCTTAGGGAGACTGGGATGGTGG - Intergenic
1191975678 X:66868690-66868712 GGGGAGGGAGAATAGGAGGGAGG - Intergenic
1192484681 X:71514807-71514829 TGCTAGGCAGACTGGGATGGAGG + Intronic
1195243894 X:102979178-102979200 GGCGGGGGAGGCGGGGACGGTGG + Intergenic
1197708743 X:129651899-129651921 GGAGAAGGCGACTGGGATGGGGG - Intronic
1197757008 X:130002553-130002575 GGGGAGGGAGAAGGGGAAGGAGG + Intronic
1198215204 X:134549345-134549367 AGCGAGGGAGACAGGGAGGAAGG + Intergenic
1198705793 X:139446893-139446915 GGCGACGGCGACGGCGACGGCGG + Intergenic
1200039185 X:153353560-153353582 AGCCAGGGAGACTGGGGCAGTGG - Intronic
1200123574 X:153802712-153802734 GGGGAGGAAGAGTGGGAGGGAGG - Exonic