ID: 1167430495

View in Genome Browser
Species Human (GRCh38)
Location 19:49451484-49451506
Sequence ATTTGAGGAGCTGCTGCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 314}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167430495 Original CRISPR ATTTGAGGAGCTGCTGCTGC AGG (reversed) Exonic
900385237 1:2407572-2407594 ATTTGATGAGCTGCTGTGACAGG - Intronic
904333551 1:29783102-29783124 CATGGAGGAGGTGCTGCTGCAGG - Intergenic
905674756 1:39817602-39817624 AGTGGAGGAGCTGCGGCTACGGG + Intergenic
905901505 1:41584551-41584573 TTTTGGGGGGCTTCTGCTGCTGG + Exonic
905951927 1:41959111-41959133 AATTCAGGAGCTCCTGCTGTTGG - Intronic
907316139 1:53573990-53574012 ATTAGAGCAGCAGCTGCTGCAGG + Intronic
907413919 1:54301311-54301333 AGTTGGCGTGCTGCTGCTGCTGG - Intronic
908795333 1:67825642-67825664 CTATGAGTAGCTGCTGCTTCTGG - Intronic
910514006 1:88037517-88037539 AAATGTGGAGCTGCTGCTACTGG - Intergenic
914346717 1:146806326-146806348 ATCTGGGGAGATGGTGCTGCAGG - Intergenic
914869694 1:151462549-151462571 AGTTGTGAAGCTGCTGCTTCAGG + Intergenic
916923030 1:169488399-169488421 ATTTGACGTGCTGCTGTTGGAGG + Intergenic
917080139 1:171249440-171249462 AAATGAGGAGCTGCTGCTAGAGG + Intronic
917333945 1:173909657-173909679 ATTGGAGGAGATGATGCTGGTGG - Exonic
918030124 1:180799572-180799594 ATTTCAGGAGATGGTGGTGCTGG + Intronic
920941004 1:210482321-210482343 ATTACAGTACCTGCTGCTGCTGG + Intronic
922244256 1:223779176-223779198 ATTCGAGGACCTGCTGTTTCTGG - Intergenic
923519577 1:234725409-234725431 ATTCTAGGAGGTGCTGCAGCAGG + Intergenic
923672486 1:236052538-236052560 ATTTGAGGACCTGCTGTAGTTGG - Intronic
924690935 1:246349494-246349516 ATTTGAGGAGGTGCTGAGGAAGG + Intronic
1063812606 10:9730090-9730112 ATTTAAAGACCTGCTGCTGAAGG + Intergenic
1067685181 10:48462616-48462638 TTTTCAGGAACTGCTGGTGCTGG - Intronic
1067831106 10:49611499-49611521 CTTTGACGCGCTGTTGCTGCTGG + Exonic
1070858439 10:79628729-79628751 ATTTGAGGACACGCTGCTGGAGG + Intergenic
1071720244 10:88136617-88136639 ATATCAGGAACTGCTGCTGCTGG - Intergenic
1073080217 10:100854960-100854982 AATGGAGAAGCTGCTGCTGCTGG - Intergenic
1073089250 10:100920242-100920264 ATATAAGGGGCTGCTGCTGGTGG + Intronic
1073253749 10:102137933-102137955 AATGGAGGAGCTAATGCTGCAGG + Exonic
1073294739 10:102432245-102432267 GTTTAGGGAGCTGCTGCTTCAGG - Intronic
1074416798 10:113273851-113273873 ATTGGAGCAGCAGCCGCTGCTGG - Intergenic
1076161428 10:128246937-128246959 TTTTGAGGAAATGCTGATGCCGG + Intergenic
1076522770 10:131091235-131091257 ATTTGCAAAGCCGCTGCTGCTGG - Intergenic
1077730362 11:4723308-4723330 GTATGAGGAGCTGCAGATGCTGG - Intronic
1078137107 11:8660653-8660675 ATTTAAGGAGCTGTTGCTTTAGG - Intronic
1079328530 11:19514757-19514779 TTTGAAGGAGCAGCTGCTGCGGG - Intronic
1081740659 11:45437524-45437546 CTTTGAAGAGCTGTGGCTGCAGG + Intergenic
1082810508 11:57476613-57476635 GTTGGAGGAGCTGTTGCCGCGGG - Exonic
1084000760 11:66294315-66294337 GTTTCAGGGGCCGCTGCTGCAGG - Exonic
1084323507 11:68386317-68386339 AGCCGAGGAGGTGCTGCTGCTGG + Exonic
1084655447 11:70513398-70513420 ATTTGAGCTGCTGCCACTGCAGG + Intronic
1085552987 11:77392526-77392548 ATTCTAGTAGCTGCTGCTGGTGG - Exonic
1087045222 11:93838955-93838977 ATTTAAGGAGCTCCTGCTCTTGG + Intronic
1089090454 11:115870071-115870093 CTTGCAGCAGCTGCTGCTGCAGG - Intergenic
1089519126 11:119052100-119052122 AGTTCAGGAGGTGCTGCTGAAGG - Exonic
1089682124 11:120124394-120124416 ATCTGAGAAGCTGCGGCTGGCGG - Intronic
1090628176 11:128624075-128624097 ATTTGAGGAGCCCATACTGCAGG - Intergenic
1092069196 12:5618995-5619017 ATATTAGGAGATGATGCTGCTGG + Intronic
1094580639 12:31730816-31730838 ATTGGTGGAGGTCCTGCTGCTGG - Intergenic
1098264673 12:68706485-68706507 ATATGAGGAGCTGCAGACGCTGG + Intronic
1098363258 12:69676079-69676101 ATTTGAGGAGGTGGTGGTGAAGG + Intronic
1099377008 12:81904143-81904165 ATTGGTGGGGGTGCTGCTGCAGG - Intergenic
1100236582 12:92667538-92667560 ATTAGAGGAGCCTCTGCTGATGG - Intergenic
1100930419 12:99602332-99602354 ATTTGAGGAGGTGGTATTGCAGG + Intronic
1102058014 12:109911176-109911198 CATTGAGGAGCAGCTGCAGCTGG + Exonic
1103036560 12:117661735-117661757 CTTTGGGATGCTGCTGCTGCTGG + Intronic
1103390657 12:120570558-120570580 ATGTGAGGGCCTGCTGCTGGGGG + Intronic
1103848326 12:123914942-123914964 AGTTGAGGGCCTGCTGCTGGGGG - Exonic
1103959170 12:124597337-124597359 AGTTGAGGAGCTGCTTCTGGGGG + Intergenic
1104524091 12:129501801-129501823 AATTTAGGAGCTGCTGCTGGCGG - Intronic
1104832001 12:131758821-131758843 CTGTGAGGAGCTGGTGCTACAGG - Intronic
1105052096 12:133063845-133063867 ATTTGGGAAGCTGCTGCTCTAGG + Intergenic
1108594698 13:51939208-51939230 ACTTGTGTAGCTGCTGATGCTGG - Intronic
1109306466 13:60647142-60647164 ATTTGAGAGGCGGTTGCTGCTGG + Intergenic
1109558471 13:64014182-64014204 TTCTGAGTAGCTGGTGCTGCAGG - Intergenic
1112548287 13:100393372-100393394 TTTTCAGCAGCTGCTTCTGCTGG + Intronic
1113174296 13:107544864-107544886 ATGTGAGGAGCTGGAGCTACAGG + Intronic
1113414234 13:110115655-110115677 ATTTAAGCAGATGCAGCTGCAGG + Intergenic
1113484166 13:110642383-110642405 TTTCTAGGAGCTGCTGCCGCCGG + Exonic
1113834027 13:113317092-113317114 ATGTGAGTATCTGCTGTTGCCGG + Intronic
1114453140 14:22839226-22839248 GGTTGAGGAGCAGCTGCTTCAGG - Intronic
1114476446 14:22998537-22998559 GATTGAGGAGCTGCGGCAGCTGG - Exonic
1114951652 14:27761802-27761824 AAATGTGGAGCTGCTGCTACTGG + Intergenic
1115432513 14:33336325-33336347 ATTTGAGGAGTTCCTCCTCCAGG + Intronic
1115490979 14:33957810-33957832 TTTCCAGGAGCTGCTTCTGCTGG + Intronic
1115860948 14:37685781-37685803 CTTTGGGGAGCTGCTGCAGTGGG + Intronic
1117212263 14:53512825-53512847 ATTGGAGGAGAGGCTGCTGGGGG + Intergenic
1118798568 14:69167930-69167952 ATAGGAGGGGGTGCTGCTGCTGG + Intergenic
1118916200 14:70108635-70108657 ATTAGAGCAGCTGCTGCTCATGG + Intronic
1119385523 14:74255968-74255990 TCATGAGGTGCTGCTGCTGCAGG + Intronic
1120599618 14:86485658-86485680 AGGAGAGGAGCTGCTGCTGCAGG - Intergenic
1121005884 14:90490445-90490467 AGTGGAGGAGCTTGTGCTGCAGG + Intergenic
1121321103 14:92992096-92992118 ATTCGAGGAGGTGCCGCTGAAGG - Intronic
1121466070 14:94116259-94116281 GTTTGGGGAGAGGCTGCTGCAGG - Intronic
1121521780 14:94590859-94590881 ATTTGAGTGGTTGCTGATGCCGG - Exonic
1122384808 14:101337107-101337129 ATTTGAGGAGTTGCTGTGGCCGG + Intergenic
1122690117 14:103528311-103528333 ACTGGAGGAGGTGCTGCTGGAGG - Intergenic
1123056811 14:105574719-105574741 CCATGAGGAGCTGCTGCTGGTGG - Intergenic
1123081399 14:105697066-105697088 CCATGAGGAGCTGCTGCTGGTGG + Intergenic
1124636998 15:31371758-31371780 ATTTCAGGTGCTGAAGCTGCAGG - Intronic
1124786112 15:32682145-32682167 TTTTCAGGTGCTGCTGCTGCTGG - Intronic
1125510784 15:40291356-40291378 CTGGGAGGAGCTGCTGCAGCGGG - Exonic
1125854911 15:42939436-42939458 ATATGAGGAGCTGGATCTGCCGG - Intergenic
1125875448 15:43140278-43140300 ATATGAGGAGCTGGATCTGCCGG - Intronic
1126561142 15:50045475-50045497 ATTTGAAAATCTGCTGCTTCGGG + Intronic
1126692764 15:51300651-51300673 GTTGGAGGAGGAGCTGCTGCTGG - Intronic
1128726250 15:69990676-69990698 ATTCAAGGAGCTGCTCCTGCAGG + Intergenic
1129193915 15:73953176-73953198 AGTTGATGAGCTACTGCTGCAGG + Intergenic
1129293781 15:74588270-74588292 ATATGTGGGGCTGCTGCGGCAGG - Intronic
1129536143 15:76315054-76315076 ATTTCAGGAGCAGCTCCTCCAGG + Intergenic
1129600553 15:76995858-76995880 TTCTGAGGAGCTCCTGCTGTGGG - Intronic
1130538419 15:84803200-84803222 ATTTGAGAGGCTGCTGCCCCAGG + Exonic
1130766823 15:86879301-86879323 ATCAGAGGAGCTGCTGCCCCAGG - Intronic
1131602722 15:93865860-93865882 ATTTGTGAAGCAGCTGCTGGTGG + Intergenic
1131820698 15:96270836-96270858 TTTTGGTGAGCTGCTGCTTCTGG - Intergenic
1131870200 15:96756315-96756337 CTTTCAGGAGCTTCTGCTTCGGG + Intergenic
1132155334 15:99492088-99492110 ATTTGGGGATGAGCTGCTGCAGG + Intergenic
1132785655 16:1655885-1655907 ACTCGAGGAGCGGCAGCTGCAGG + Exonic
1132797511 16:1732529-1732551 GCCTGAGGACCTGCTGCTGCAGG - Intronic
1133613963 16:7458376-7458398 ATTTGAGGAGCACATGCTCCAGG - Intronic
1136341837 16:29649056-29649078 ATTTGAGAAAATGCTGCTTCAGG - Intergenic
1137374327 16:47939866-47939888 TTTGGAGGAGCTGCTGCTGCAGG + Intergenic
1139740466 16:69031111-69031133 AGATGAGGAGCTGCTGCTTTGGG + Intronic
1139987264 16:70908944-70908966 ATCTGGGGAGATGGTGCTGCAGG + Intronic
1140115676 16:72039412-72039434 ATTGGAGAAGCTGCGGCTGGAGG + Intergenic
1141510039 16:84505942-84505964 GTTTGTGGAGCTGCTTCTCCTGG - Intronic
1141519059 16:84565482-84565504 GTTTGCGGAGCTGCTGAGGCGGG - Intergenic
1141979846 16:87543313-87543335 CTTTAAGCAGCTGCTGGTGCTGG + Intergenic
1142204989 16:88778655-88778677 ATCTGGGCAGCTGCTGGTGCCGG - Intronic
1142684750 17:1571358-1571380 ATAAGGGGAGCTGCTGCTGAAGG + Intronic
1143595057 17:7909163-7909185 GATTGAGGAGCAGCTGCGGCGGG + Exonic
1143881560 17:10034027-10034049 ATTTCTGGAGCTGCTGCCGCTGG + Intronic
1144464355 17:15485108-15485130 ATTTGGGGAGCAGCAGATGCAGG + Intronic
1144595544 17:16567449-16567471 AATTTTGGAGCTGCTGGTGCTGG - Exonic
1146016946 17:29241395-29241417 CCATGAGGGGCTGCTGCTGCAGG - Intergenic
1146705524 17:34998266-34998288 ATTGGAGGGGCTGGTGCTGAAGG + Exonic
1146738226 17:35258110-35258132 AGTTGAGGAGCTGAGTCTGCTGG - Intronic
1147358953 17:39919272-39919294 ATTTGGGCAGCTGGTTCTGCTGG - Intronic
1148663836 17:49360650-49360672 GATTGAGGAGCTGCTGTTGCTGG - Intronic
1149611703 17:57962270-57962292 ACTTGGGGAGCAGGTGCTGCAGG + Intergenic
1149661804 17:58338041-58338063 CTGTGAGCTGCTGCTGCTGCTGG - Intergenic
1151246186 17:72796693-72796715 ATTTGAGGTGGTGATGCTGCTGG - Intronic
1151292085 17:73157582-73157604 AAAAGAGGAGCTGCTGCTGGGGG - Intergenic
1151479140 17:74360153-74360175 CTTGCAGGAGCTGCTGCGGCAGG - Exonic
1151693769 17:75703591-75703613 ATGTGTGGACCTGCTGCTCCTGG + Intronic
1151824213 17:76514611-76514633 ATTTTAAGAGCTACTGTTGCTGG + Intergenic
1153299655 18:3581565-3581587 ATTTGAGAGGCTGCTGCCCCAGG + Intronic
1154169600 18:12041435-12041457 ATTTCAGGAGGTGGTGGTGCAGG + Intergenic
1155957632 18:31967175-31967197 GTACAAGGAGCTGCTGCTGCTGG + Intergenic
1157294585 18:46433452-46433474 CTTCCAGGAGCTGCTGCTGCAGG - Exonic
1158745665 18:60196835-60196857 ATTTGGGAAGCAGCTGCTGAAGG - Intergenic
1158836414 18:61334914-61334936 ATTTGAGGGGAGGCGGCTGCAGG - Intronic
1159428896 18:68325421-68325443 AGGAGAGGAGTTGCTGCTGCTGG - Intergenic
1160524399 18:79526487-79526509 ATGTCAGGAGGTGCTGCTGGCGG + Intronic
1161085661 19:2333770-2333792 CTCTGAGCTGCTGCTGCTGCAGG + Intronic
1162637918 19:11984882-11984904 TTTAGAACAGCTGCTGCTGCAGG + Intergenic
1163323423 19:16587718-16587740 ATTACAGGAGCTGTGGCTGCAGG - Intronic
1165319018 19:35074609-35074631 CTCTGAGGAGCTGCGGCTGCTGG + Intergenic
1165788189 19:38474910-38474932 TTGGGAGGGGCTGCTGCTGCTGG + Intronic
1166796632 19:45430078-45430100 ATTTGAGGAATTGCTCCGGCTGG - Intronic
1166898073 19:46036447-46036469 GTTTGGGCAGCTGCAGCTGCAGG - Intergenic
1167430495 19:49451484-49451506 ATTTGAGGAGCTGCTGCTGCAGG - Exonic
1168126025 19:54283475-54283497 ATTGGAGGAGATGCTGTTGCTGG + Intergenic
1168175913 19:54627605-54627627 ATTGGAGGAGATGCCGTTGCTGG - Intronic
924998134 2:382683-382705 CTTTGAGAAGCTTCTGCTTCTGG - Intergenic
928374084 2:30760942-30760964 ATTTGAGGAAGTACTACTGCAGG - Intronic
928721310 2:34124833-34124855 ATTTGAGGAAGTTCTGTTGCTGG + Intergenic
930599303 2:53424960-53424982 GTTGGTGGAGCTACTGCTGCTGG + Intergenic
930724048 2:54665516-54665538 GCTGGAGGAGCTGCTGCTGGAGG + Intronic
930865403 2:56117908-56117930 ATTCCTGGTGCTGCTGCTGCTGG - Intergenic
932347449 2:71004942-71004964 ACTTGAAGAGCTGCTGATGCTGG - Intergenic
932698019 2:73973207-73973229 GTTGGAGGAGCTGCTGCAGGAGG - Intergenic
932758882 2:74426706-74426728 AGGTGAGGGGCTGCTCCTGCAGG - Intronic
933263363 2:80154372-80154394 TTTTGAAGAGCTACTGCTACCGG + Intronic
934485704 2:94707892-94707914 AAATGTGGAGCTGCTGCTACTGG - Intergenic
936611322 2:114004835-114004857 ATTCGAGAAGCTTCTGCTACCGG + Intergenic
937011139 2:118563756-118563778 GTTCCAGGTGCTGCTGCTGCTGG + Intergenic
937326747 2:120994002-120994024 CTTTGGGGACCTGCAGCTGCTGG - Intergenic
937424814 2:121789935-121789957 ATCTTGGGAGCTTCTGCTGCTGG - Intergenic
939514454 2:143149152-143149174 ATTAGAGGAGCTGTTTCTCCAGG - Intronic
940562933 2:155324547-155324569 ATATGAGGAGCACCTGCTTCTGG + Intergenic
942701431 2:178715500-178715522 TTTTAAGGATGTGCTGCTGCTGG + Exonic
944966925 2:204945419-204945441 CTTTGAGGAGCTTCTCCTTCAGG - Intronic
946996214 2:225394834-225394856 ATTTAATGAGCTGGTGCTGTAGG + Intergenic
947103225 2:226643875-226643897 AGTTGCTGAGCTGCTGCTGAAGG + Intergenic
947484771 2:230537976-230537998 GTTCCAGGTGCTGCTGCTGCTGG + Intronic
948137037 2:235644149-235644171 ATTTGAGCTGCTTCCGCTGCAGG + Intronic
948718764 2:239883046-239883068 ATCTGAGGAGCAGGTGCTGCTGG + Intergenic
1171006200 20:21467772-21467794 ACTTTAGGAGGTTCTGCTGCTGG + Intergenic
1171356374 20:24548650-24548672 ATTTGAGGTGCTGCTGATTTGGG + Intronic
1173594148 20:44247865-44247887 GTGGGAGGTGCTGCTGCTGCGGG + Intronic
1174062578 20:47843221-47843243 ACTGGAGGAGCTGAGGCTGCGGG - Intergenic
1174183559 20:48689978-48690000 ATTTGGGGAGCAGGTGTTGCAGG + Intronic
1174750132 20:53103836-53103858 ACTTGAGGAGCTGCCGCAGGTGG + Intronic
1174888005 20:54357262-54357284 ATTTGAGTAGCTGATCATGCAGG + Intergenic
1175012384 20:55752723-55752745 TTCTCAGGTGCTGCTGCTGCTGG - Intergenic
1175908007 20:62391356-62391378 CTTTGAGAAGCTGGTCCTGCAGG - Exonic
1176034277 20:63028797-63028819 AGTAGAAGAGCTGCTCCTGCTGG + Intergenic
1176612165 21:8992903-8992925 ATTAGAGGAGCCCCTTCTGCTGG - Intergenic
1177783391 21:25643377-25643399 ATCTGAGGACCAGCTGCTACTGG - Intronic
1179391293 21:40994493-40994515 ATTTCTGGAGATGCTGCTGCAGG - Intergenic
1179506886 21:41847090-41847112 CATTGAGGAGCTGCAGCTCCAGG + Exonic
1179677139 21:42991031-42991053 ATTTGAGAAGCAGCTTGTGCAGG - Intronic
1179833441 21:44012502-44012524 CTCTGAGGAGCCGCTGCCGCCGG + Exonic
1180121005 21:45748052-45748074 ATCTGGAGAGCTGTTGCTGCTGG + Intronic
1181132555 22:20741828-20741850 ATTTCTGGAGTTGCTACTGCAGG - Intronic
1181440146 22:22931527-22931549 TTCTGAGGACCTGCTGCTCCTGG + Intergenic
1181611110 22:24012687-24012709 ATCTGAGGAAATGCAGCTGCTGG + Intronic
1182512673 22:30830165-30830187 ATTTGATCAGATGCTGCTGCTGG - Intronic
1182714731 22:32348423-32348445 CCTGGAGGAGCAGCTGCTGCTGG - Intergenic
1183519277 22:38287158-38287180 CCTTGGGGAGCTGCTGCTGGGGG - Intergenic
1185007804 22:48294135-48294157 ATTTGAGGACCTGCTGAAGTTGG - Intergenic
1185030306 22:48439492-48439514 ATAAGAGGAGCTGCGGATGCAGG - Intergenic
1185176350 22:49329292-49329314 AATTGAGGAGGAGTTGCTGCTGG + Intergenic
949609600 3:5690926-5690948 ATTGGAGGTGTTGCTGCCGCTGG + Intergenic
949937483 3:9127363-9127385 ATTGGTGGTGCTGATGCTGCTGG - Intronic
950274422 3:11646477-11646499 ACTTTAGAAGCTACTGCTGCTGG - Intronic
950417697 3:12877624-12877646 AGGTGAGGAGCTGGTGCTGGAGG + Intergenic
950604257 3:14064424-14064446 GCTGGTGGAGCTGCTGCTGCTGG - Exonic
950615721 3:14156402-14156424 ATTTCAGGAGATGCCGCTTCAGG + Exonic
952624661 3:35390261-35390283 TTTAATGGAGCTGCTGCTGCTGG - Intergenic
953582068 3:44166479-44166501 ATTTGAAGACCTGCTCCTGGTGG - Intergenic
954198935 3:49012875-49012897 TTATGAGGAGCTCCTGTTGCTGG + Exonic
955087461 3:55717108-55717130 GTTTTAGGAACTGCTGCTGCAGG + Intronic
955535672 3:59921027-59921049 ATTTGTGGACCAGTTGCTGCAGG - Intronic
956164506 3:66386192-66386214 CATGGGGGAGCTGCTGCTGCTGG + Exonic
958444957 3:94203546-94203568 ATTGAAGGGCCTGCTGCTGCAGG - Intergenic
960486846 3:118263210-118263232 ATCTGAGGAGATGGTGGTGCTGG - Intergenic
961135010 3:124502240-124502262 ATTTGAGGATGTGCTCCTACGGG + Intronic
961320530 3:126070319-126070341 CTATGAGGATCTGATGCTGCCGG - Intronic
962712840 3:138102040-138102062 GTATGAGGAGCTGCAGATGCTGG - Intronic
966916881 3:184589382-184589404 ATTTGAGAAGCTGATGGTGTGGG - Intronic
966976142 3:185085060-185085082 ATTTGAGAAGGAGCTGCTACTGG - Intronic
968282895 3:197490412-197490434 ATGTGAGCAGCTGCCTCTGCTGG + Intergenic
971384482 4:26130466-26130488 ACCTGAGGAGCGGCTGCAGCCGG - Intergenic
972585372 4:40432802-40432824 ATTTTAGGGGCTGGAGCTGCTGG + Exonic
972828459 4:42787461-42787483 ATTGCTGGAGCTGCAGCTGCTGG + Intergenic
973589806 4:52429599-52429621 GATTGAGGTGCTGCTGCTGGTGG - Intergenic
973754776 4:54064228-54064250 ACTTGAGCAGCTGCTCCTCCAGG + Exonic
974585618 4:63872650-63872672 ATTTGAGAAGCTGGGGCAGCAGG - Intergenic
977979769 4:103307727-103307749 GTTGCAGGAGCTGCAGCTGCTGG + Intergenic
979577428 4:122310712-122310734 ATTTGAGAAGCAGCAGATGCAGG - Intronic
980586575 4:134824878-134824900 ATTTTAGGATATGCTGCTGGAGG - Intergenic
981127420 4:141122389-141122411 ATTGGCGGTGCTGCTGCTGTGGG - Intronic
982370842 4:154631178-154631200 ATTTGGGGAGATGGGGCTGCTGG - Intronic
982468009 4:155755158-155755180 CTTTGTGAAGCTTCTGCTGCTGG - Intergenic
982740879 4:159055599-159055621 AATTGAGGAGCTGAGGCTGGAGG + Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
987951847 5:24686695-24686717 CTTTGAGGAGCTGCAGTTCCTGG - Intergenic
988065785 5:26228060-26228082 CATGGAGGAGCTGGTGCTGCTGG - Intergenic
991058290 5:62343292-62343314 ATTAGAGGAGATGCAGGTGCTGG - Intronic
991596518 5:68312424-68312446 ATTTCATAAGCTGCTACTGCAGG - Intergenic
993124078 5:83810290-83810312 CTTTGAGGAACTTCTGCTTCTGG - Intergenic
995274261 5:110260264-110260286 ATTTGAGGAGATTCTACTGTTGG - Intergenic
995683991 5:114750983-114751005 ATTTGTGTTGCTGCTGCTGCTGG + Intergenic
997243105 5:132322618-132322640 ATTTGTGGAGCTGGTGGTGTTGG + Intronic
997357295 5:133271376-133271398 ATTTGAGAAGATGCCTCTGCTGG + Intronic
998378304 5:141706112-141706134 ATTTGATTAGATTCTGCTGCAGG - Intergenic
998778849 5:145633726-145633748 TTCTCTGGAGCTGCTGCTGCTGG + Intronic
998863547 5:146471274-146471296 ATAGGACAAGCTGCTGCTGCTGG + Intronic
999111705 5:149127108-149127130 TCTTCTGGAGCTGCTGCTGCTGG - Intergenic
999240097 5:150122413-150122435 CTTTGGGGAGCTGATGCTACAGG - Intronic
1000449032 5:161361744-161361766 ATTTGGGAAGCTGCAGCTGAAGG + Intronic
1002279750 5:178123364-178123386 ATTAGATGAGCTCCTGCCGCAGG + Exonic
1002439692 5:179257938-179257960 ATTGGAGGCCCTCCTGCTGCTGG + Intronic
1007063537 6:38965669-38965691 ATTGGAGGAAGTGTTGCTGCAGG - Intronic
1007220394 6:40274433-40274455 ATGAGAAGAGCTGCTTCTGCAGG + Intergenic
1007635675 6:43298364-43298386 CTTTGAGGAGCTGCTGGAGCAGG + Exonic
1012506008 6:99947067-99947089 ATTTGAGGAGATGATGGTGATGG - Intronic
1015338879 6:132074699-132074721 ATTATAGGAGCTGCTGCACCAGG + Intergenic
1015539264 6:134297847-134297869 ATATGAGGAGCTGCAGATGCTGG - Intronic
1016467496 6:144340430-144340452 TTTTGTGGGGCTGATGCTGCTGG + Intronic
1017767045 6:157615430-157615452 ATTTGTAGAGTTCCTGCTGCTGG + Intronic
1017883836 6:158582194-158582216 ATTTGAGGAGGTGCCGCCGTGGG + Intronic
1020427580 7:8086466-8086488 CCTGCAGGAGCTGCTGCTGCTGG - Exonic
1021029219 7:15708951-15708973 ATTTCAGGGTCTGCCGCTGCTGG + Intergenic
1022096424 7:27144288-27144310 ATTGTAGCTGCTGCTGCTGCGGG - Intronic
1022746547 7:33178518-33178540 AGTAGAGGAGCTGGTGGTGCTGG + Intronic
1022831156 7:34068071-34068093 ATATTAGCTGCTGCTGCTGCTGG - Intronic
1023090022 7:36608886-36608908 ATATTAGGAGCTGTTGCGGCGGG + Intronic
1023289621 7:38656048-38656070 GTATGAGGAGCTGCAGATGCTGG + Intergenic
1023295308 7:38708648-38708670 ATTTAAACAGCTGCTGCTGGTGG + Intergenic
1023418127 7:39950770-39950792 GTTGCAGGAGCTGCGGCTGCAGG - Exonic
1024587331 7:50853519-50853541 TTTTGAGGAGCTGATGCCTCTGG - Intergenic
1026970984 7:74467294-74467316 ATCCCAGGAGCTGCTTCTGCCGG + Intronic
1027334536 7:77134448-77134470 ATTTGAGGATCTGCTGTAGTTGG - Intronic
1027539772 7:79453116-79453138 GTCGGAGGAGCTGCTGCTGGAGG - Exonic
1027857329 7:83529141-83529163 ATCTGAAGAGCTGCTTCTCCTGG - Intronic
1029119395 7:98256623-98256645 ATTTGAGGAGCTTCTGGTGATGG + Intronic
1029328371 7:99829786-99829808 ATTTCAGGAGGTGATGTTGCAGG - Intronic
1029484129 7:100828903-100828925 ATTGGAGGGGGTGCTGCTCCAGG + Intronic
1029781310 7:102737145-102737167 ATTTGAGGATCTGCTGTAGTTGG + Intergenic
1032545384 7:132737591-132737613 AGTTCATGAGCAGCTGCTGCTGG + Intergenic
1033227854 7:139575136-139575158 GATTGAGTGGCTGCTGCTGCTGG + Exonic
1034178052 7:149115838-149115860 ACTTGAGGTGCTGCTAATGCTGG - Intronic
1035512658 8:205033-205055 AGAGGAGAAGCTGCTGCTGCAGG + Intergenic
1036618313 8:10405241-10405263 AGGTGGGGAGCTGCAGCTGCAGG + Intronic
1038334018 8:26631963-26631985 ACTTGGGGAGGTGCTGCTGATGG + Intronic
1039678814 8:39705479-39705501 ATTTGAGAAGCTGATGCAGGAGG + Intronic
1040565677 8:48564730-48564752 ATCTGAGGACCTGCTGGTGCTGG + Intergenic
1040595261 8:48832174-48832196 ATTTGAGGAGCTGCTGGTACTGG + Intergenic
1041048541 8:53910246-53910268 ATTTGAGGGGCTCTTGCTTCAGG + Intronic
1041563798 8:59251819-59251841 TTTTGATGTGCTGCTGCTGCTGG + Intergenic
1043176979 8:77033857-77033879 TCTTCAGGAGCTGCTGCTCCAGG + Intergenic
1043263181 8:78227476-78227498 CTTTGAGAGGCTGCTGCTGGAGG - Intergenic
1044908437 8:97030240-97030262 ATTTGGTCTGCTGCTGCTGCTGG + Intronic
1045003206 8:97896058-97896080 TTTGGAGGTGCTGCTGCAGCCGG + Intronic
1045393128 8:101734699-101734721 ATTCAAGGAACTCCTGCTGCAGG + Intronic
1046462471 8:114558816-114558838 ACTTGAGGGGCTGCTGTTCCTGG + Intergenic
1047421461 8:124711253-124711275 ATCTGAGGTGCTGCTGCTCCTGG + Intronic
1048218603 8:132519927-132519949 ATTTGAATAGCTTCTGATGCAGG - Intergenic
1048282201 8:133113924-133113946 ATTTGCTGAGCGGCTGCTTCAGG - Intronic
1048393752 8:133993147-133993169 CATTGAGCACCTGCTGCTGCTGG + Intergenic
1048750507 8:137668219-137668241 ATTTTAGGGGCTGCTGATCCAGG + Intergenic
1049040669 8:140110261-140110283 ATGTGGGGAGCTGCTGCAGGGGG - Intronic
1049377157 8:142294739-142294761 TACAGAGGAGCTGCTGCTGCAGG + Intronic
1049584490 8:143426623-143426645 ACCTTAGCAGCTGCTGCTGCTGG - Intronic
1049661501 8:143821602-143821624 GGTTGGTGAGCTGCTGCTGCTGG + Exonic
1049682377 8:143925296-143925318 CCTGGAGGAGCTGCGGCTGCAGG - Exonic
1049782729 8:144436198-144436220 TTCTGAGCTGCTGCTGCTGCTGG + Exonic
1051881104 9:21840794-21840816 AGTACAGGAGCTGCTGCTGATGG + Intronic
1053128298 9:35600272-35600294 CTTTGAGGACCTGCTGTTCCTGG + Intergenic
1053397063 9:37784933-37784955 GGGTGAGGAGCTGCTCCTGCCGG - Exonic
1053672086 9:40376431-40376453 AAATGTGGAGCTGCTGCTACTGG + Intergenic
1053921902 9:43002789-43002811 AAATGTGGAGCTGCTGCTACTGG + Intergenic
1054383202 9:64516475-64516497 AAATGTGGAGCTGCTGCTACTGG + Intergenic
1054512537 9:65999879-65999901 AAATGTGGAGCTGCTGCTACTGG - Intergenic
1055270983 9:74558214-74558236 ATTTGAGGAGCAGCTGCAAAAGG - Intronic
1055914867 9:81390778-81390800 GTTTGTGCTGCTGCTGCTGCTGG - Intergenic
1056228022 9:84515627-84515649 ATTTGAGGAGCTTGGGCTGGTGG + Intergenic
1057237964 9:93380865-93380887 AGTTGTGGAGGTGCTGCTACTGG - Intergenic
1057257030 9:93558130-93558152 ACTTGAAGAACTGCTGCTGCAGG - Intronic
1057899279 9:98935484-98935506 TTTTGAGAAGCTGCTGCTCAGGG + Intergenic
1058201875 9:102053494-102053516 ATTTGCTGAGCAGCAGCTGCAGG - Intergenic
1058656579 9:107227565-107227587 ATTTGTGGAGCTGCTTCTACAGG + Intergenic
1060416703 9:123435788-123435810 AGCAGAGGTGCTGCTGCTGCTGG + Intronic
1060931650 9:127492837-127492859 CTTTGAGCAGCTGCTGGAGCAGG - Exonic
1061645369 9:131996533-131996555 ATTTGAGGAGCTGCCCCTCCAGG - Intronic
1061889825 9:133612749-133612771 ATGTGAGCAGCTGCTGTTGATGG + Intergenic
1185502272 X:607050-607072 GTTTAATGAGCTGCTGCTGAGGG - Intergenic
1185724346 X:2407347-2407369 CTTTGACAAGCTGCTGCTGTGGG + Intronic
1185879521 X:3728322-3728344 AGTTTAGAAGCTGCTGCTCCTGG - Intergenic
1187346297 X:18467560-18467582 ATTTGATGAGTTGCAGCTGAGGG + Intronic
1187424011 X:19161021-19161043 ATTTGAGCAGCTGCTGCTGAAGG - Intergenic
1189776669 X:44476155-44476177 ATCTGAGGAGCTGAATCTGCTGG - Intergenic
1192510296 X:71717232-71717254 TGCTCAGGAGCTGCTGCTGCAGG - Exonic
1192516401 X:71764321-71764343 TGCTCAGGAGCTGCTGCTGCAGG + Exonic
1192608298 X:72542696-72542718 GTTCAAGGAGCTGCTGCTGTAGG + Intronic
1194278171 X:91913254-91913276 AGTACAGGAGCTGCTGCTGATGG + Intronic
1195502418 X:105617380-105617402 AATTGAGTAGCTGCTGCTTGAGG - Intronic
1196614462 X:117752050-117752072 ATTAAAGAAGCTGGTGCTGCTGG + Intergenic
1196745552 X:119068818-119068840 ATGTGGGTAGCTGCTGCTGAAGG + Intergenic
1198851467 X:140969089-140969111 ATTTTAAGAACTGCTGCTCCAGG + Intergenic
1199927236 X:152480427-152480449 GTATGAGGAGCTGCAGGTGCTGG + Intergenic
1200181208 X:154151712-154151734 AGAGCAGGAGCTGCTGCTGCTGG - Intronic
1200186853 X:154188826-154188848 AGAGCAGGAGCTGCTGCTGCTGG - Intergenic
1200192504 X:154225964-154225986 AGAGCAGGAGCTGCTGCTGCTGG - Intronic
1200198259 X:154263768-154263790 AGAGCAGGAGCTGCTGCTGCTGG - Intronic
1200595508 Y:5135329-5135351 AGTACAGGAGCTGCTGCTGATGG + Intronic
1201548535 Y:15194039-15194061 AGTCTAGGAGCTGCTGATGCTGG + Intergenic