ID: 1167430829

View in Genome Browser
Species Human (GRCh38)
Location 19:49453474-49453496
Sequence CGGGACTCCCCGCGAAAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 41}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167430829_1167430830 -10 Left 1167430829 19:49453474-49453496 CCGGTTTTTCGCGGGGAGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 41
Right 1167430830 19:49453487-49453509 GGGAGTCCCGTCATCCACTGCGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167430829 Original CRISPR CGGGACTCCCCGCGAAAAAC CGG (reversed) Intronic
902600771 1:17539378-17539400 GGGGTCTCCCCGCGGAGAACCGG + Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1089560095 11:119339504-119339526 TGGGCCACCCCCCGAAAAACTGG + Exonic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1134882046 16:17753499-17753521 TGGGACTCCCTCCGAAAATCCGG + Intergenic
1146993031 17:37292914-37292936 CGGCACTACCCGTGCAAAACAGG + Intronic
1150069774 17:62140574-62140596 CGGGACTCCCCGCCAAAGAAGGG - Intergenic
1152432074 17:80254078-80254100 CGGGACTGCCCGGGCAGAACGGG - Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167430829 19:49453474-49453496 CGGGACTCCCCGCGAAAAACCGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926149284 2:10415704-10415726 CTGGACTCCCCCCGAATAACAGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
948172128 2:235912366-235912388 CGGGACTTCCAGCTAAAAATAGG + Intronic
948805630 2:240452587-240452609 CCGGACTGCCCGCGGAGAACAGG + Intronic
1174773348 20:53321882-53321904 AGGGACTCCCCATGAAAATCAGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967427868 3:189348223-189348245 CGGGAATCCCTGGGAACAACTGG + Intergenic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
1002073445 5:176694363-176694385 GGGGACTCCCAGAGAGAAACTGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1198331763 X:135628961-135628983 AGGGAGTCCTCGCCAAAAACTGG - Intergenic
1200747545 Y:6915792-6915814 CCGGACTCCCAGCAGAAAACTGG - Intronic