ID: 1167430830

View in Genome Browser
Species Human (GRCh38)
Location 19:49453487-49453509
Sequence GGGAGTCCCGTCATCCACTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167430821_1167430830 6 Left 1167430821 19:49453458-49453480 CCCCAGGCCTGGGCGCCCGGTTT 0: 1
1: 0
2: 0
3: 14
4: 120
Right 1167430830 19:49453487-49453509 GGGAGTCCCGTCATCCACTGCGG 0: 1
1: 0
2: 0
3: 5
4: 59
1167430815_1167430830 30 Left 1167430815 19:49453434-49453456 CCGGCCGGCGCTGCTCGCTGCGT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1167430830 19:49453487-49453509 GGGAGTCCCGTCATCCACTGCGG 0: 1
1: 0
2: 0
3: 5
4: 59
1167430823_1167430830 4 Left 1167430823 19:49453460-49453482 CCAGGCCTGGGCGCCCGGTTTTT 0: 1
1: 0
2: 1
3: 6
4: 139
Right 1167430830 19:49453487-49453509 GGGAGTCCCGTCATCCACTGCGG 0: 1
1: 0
2: 0
3: 5
4: 59
1167430829_1167430830 -10 Left 1167430829 19:49453474-49453496 CCGGTTTTTCGCGGGGAGTCCCG 0: 1
1: 0
2: 0
3: 5
4: 41
Right 1167430830 19:49453487-49453509 GGGAGTCCCGTCATCCACTGCGG 0: 1
1: 0
2: 0
3: 5
4: 59
1167430828_1167430830 -9 Left 1167430828 19:49453473-49453495 CCCGGTTTTTCGCGGGGAGTCCC 0: 1
1: 0
2: 0
3: 4
4: 28
Right 1167430830 19:49453487-49453509 GGGAGTCCCGTCATCCACTGCGG 0: 1
1: 0
2: 0
3: 5
4: 59
1167430824_1167430830 -1 Left 1167430824 19:49453465-49453487 CCTGGGCGCCCGGTTTTTCGCGG 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1167430830 19:49453487-49453509 GGGAGTCCCGTCATCCACTGCGG 0: 1
1: 0
2: 0
3: 5
4: 59
1167430816_1167430830 26 Left 1167430816 19:49453438-49453460 CCGGCGCTGCTCGCTGCGTTCCC 0: 1
1: 0
2: 1
3: 19
4: 192
Right 1167430830 19:49453487-49453509 GGGAGTCCCGTCATCCACTGCGG 0: 1
1: 0
2: 0
3: 5
4: 59
1167430822_1167430830 5 Left 1167430822 19:49453459-49453481 CCCAGGCCTGGGCGCCCGGTTTT 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1167430830 19:49453487-49453509 GGGAGTCCCGTCATCCACTGCGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167430830 Original CRISPR GGGAGTCCCGTCATCCACTG CGG Intronic
900392963 1:2441713-2441735 GGGAGTCCCGTGGGCCAGTGTGG + Intronic
901840045 1:11948493-11948515 GGGAGTCTGATGATCCACTGAGG + Intronic
904304270 1:29577516-29577538 GGGAGTCCCGCCTCCCTCTGGGG + Intergenic
906685851 1:47762753-47762775 GAGAGCCCTGTCATCCACAGTGG - Exonic
907355985 1:53874215-53874237 TGGAGTCCAGCCTTCCACTGGGG - Intronic
909487893 1:76193985-76194007 GGGAGTCCTGACCTCCAGTGTGG - Intronic
912572648 1:110635770-110635792 AGGACTCCCCACATCCACTGTGG - Intergenic
913188061 1:116388265-116388287 GGCTGTCAAGTCATCCACTGGGG - Intronic
913213812 1:116603394-116603416 AGGAGCCCCATCATCCACTGTGG + Intronic
1073609139 10:104926074-104926096 GGGAGGCCCAGCAGCCACTGCGG - Intronic
1077953840 11:6991455-6991477 GGTAGGGCCCTCATCCACTGTGG - Intergenic
1082700736 11:56426924-56426946 TTGAGTCCCTTCAGCCACTGAGG + Intergenic
1084051031 11:66600013-66600035 GGGAGGCCCGTAATCTCCTGAGG + Intronic
1096386377 12:51197674-51197696 GGGGGGCTCGTCCTCCACTGTGG + Intronic
1105217041 13:18293945-18293967 AGGAGCCCCATCATCCACTGTGG + Intergenic
1115125943 14:29993947-29993969 GGGAGTCCATTCAGTCACTGGGG - Intronic
1129164691 15:73769918-73769940 TGGAGAACTGTCATCCACTGCGG - Intergenic
1136030269 16:27497733-27497755 GAGAGTCCCCTGATCCACTTGGG + Exonic
1140479752 16:75256304-75256326 GGGCTTCCCATCCTCCACTGCGG + Intronic
1141441405 16:84031866-84031888 GTGAGTCCCATCCTTCACTGAGG - Exonic
1147541412 17:41363327-41363349 GTGAGTCCCAGCATCCACTTAGG - Intergenic
1148236779 17:45974397-45974419 GGGAGCTCCCTCATCCACTAAGG - Exonic
1149715536 17:58785714-58785736 TGTAGTTCAGTCATCCACTGGGG - Intronic
1152161472 17:78671106-78671128 GGGAGGCCCGGCAGCCACTCTGG + Intergenic
1152924893 17:83082380-83082402 GTGAGTCCCTTTATCCACTTGGG + Intronic
1153050801 18:901628-901650 AGGAGCCCCGGCATGCACTGAGG - Intergenic
1160394162 18:78559660-78559682 GGTAGTCCCAGCTTCCACTGGGG + Intergenic
1161052262 19:2170724-2170746 GGGAGTTCTGTGAGCCACTGAGG - Intronic
1164149749 19:22540953-22540975 GTGAGTCCTGCCCTCCACTGGGG - Intergenic
1164470306 19:28524633-28524655 GGGAGTCTCGTCCCCCAGTGTGG - Intergenic
1164918128 19:32068127-32068149 AGGCATCCCGACATCCACTGAGG + Intergenic
1167430830 19:49453487-49453509 GGGAGTCCCGTCATCCACTGCGG + Intronic
925986915 2:9223951-9223973 GGGATGCACGTAATCCACTGAGG + Intronic
926118221 2:10226539-10226561 GGGAGTCCTGGCAGCCACAGCGG + Intergenic
926255152 2:11187450-11187472 GTGATTCCAGGCATCCACTGGGG + Intronic
934297284 2:91752737-91752759 AGGAGCCCCATCATCCACTGTGG - Intergenic
946437918 2:219671040-219671062 GGGGGTCTCTTCATCCACTTGGG + Intergenic
1168907944 20:1421911-1421933 GGGAGTCCCTACCTGCACTGGGG - Intergenic
1172203090 20:33140486-33140508 GGGAGCCTTATCATCCACTGGGG - Intergenic
1173084801 20:39905363-39905385 GGGACTCCTGTCATCCACCTTGG + Intergenic
1178199385 21:30386856-30386878 GGGAGGTCCCTCATCCACAGAGG + Intronic
1179325924 21:40345356-40345378 GGGAGTGTCCTCTTCCACTGAGG - Intronic
1181031574 22:20150762-20150784 GGGAGCCTCGCCCTCCACTGTGG + Exonic
1181951520 22:26557235-26557257 GTGCCTCCCCTCATCCACTGCGG - Intronic
1182353932 22:29713727-29713749 GGAAGTCCCTCCATCCACCGGGG + Intergenic
1183216989 22:36487099-36487121 GGGATTCCCATCCTCCTCTGAGG - Intergenic
953455482 3:43037294-43037316 GGGAGCCCTGTCATCACCTGGGG - Intronic
962234589 3:133696425-133696447 GTGATTTCCGGCATCCACTGTGG + Intergenic
968832033 4:2937414-2937436 GGGGGCTCCGTCATCCCCTGGGG + Intergenic
969725243 4:8914699-8914721 GGGGGTCCGGTCAACCGCTGGGG - Intergenic
976436411 4:85023508-85023530 GGGGGTCCAGTTATCCCCTGGGG + Intergenic
984689708 4:182712678-182712700 TGGTGTCCCCTCCTCCACTGTGG - Intronic
985487964 5:162576-162598 GGCAGTCCCGCCACCCAGTGGGG - Intronic
997145964 5:131433488-131433510 GGCAGTCCCTGAATCCACTGGGG - Exonic
1024059918 7:45690076-45690098 GGGAGCCCTGTGATCCACAGGGG + Intronic
1024600226 7:50974056-50974078 GGGAGCACTGCCATCCACTGGGG + Intergenic
1041244416 8:55876893-55876915 GAGCATCCCATCATCCACTGTGG - Intergenic
1048345626 8:133572369-133572391 GGGAGGCCCGGGAGCCACTGGGG + Intergenic
1050273232 9:3968852-3968874 GGGAGTTACTTCATCCACTGGGG + Intronic
1054787548 9:69223169-69223191 CGGAGTACTGTCCTCCACTGTGG - Intronic
1057700202 9:97358601-97358623 GGGTGTGCTGTCATTCACTGGGG - Intronic
1059690225 9:116677604-116677626 GGGAGTCTCATCTTCCAGTGGGG - Intronic
1062285685 9:135771587-135771609 GGGAGTCCTGACGTCCACTGGGG + Intronic
1193923239 X:87455120-87455142 AGGAGACCCCTCAACCACTGTGG + Intergenic
1201727401 Y:17168951-17168973 GGGAGGCCTGTCACACACTGGGG - Intergenic