ID: 1167430911

View in Genome Browser
Species Human (GRCh38)
Location 19:49453872-49453894
Sequence CTGGGTAATCAAAGGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167430911_1167430916 -2 Left 1167430911 19:49453872-49453894 CCTTCATCCCTTTGATTACCCAG 0: 1
1: 0
2: 0
3: 15
4: 254
Right 1167430916 19:49453893-49453915 AGAGACCTTCAGAACTTCCATGG 0: 1
1: 0
2: 1
3: 15
4: 196
1167430911_1167430919 18 Left 1167430911 19:49453872-49453894 CCTTCATCCCTTTGATTACCCAG 0: 1
1: 0
2: 0
3: 15
4: 254
Right 1167430919 19:49453913-49453935 TGGAGCCCCCGTGATCCCATAGG 0: 1
1: 0
2: 1
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167430911 Original CRISPR CTGGGTAATCAAAGGGATGA AGG (reversed) Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
901851013 1:12015594-12015616 CTGTGTAATCAGAGGCATAAGGG - Intergenic
903952695 1:27005421-27005443 TTGGGTAATCACTGGGAGGAGGG - Exonic
904978060 1:34473529-34473551 CTGGTGAATCAAAGGCATGTAGG + Intergenic
906328994 1:44868757-44868779 CCAGGTGATCAAATGGATGAAGG + Intronic
907265959 1:53261434-53261456 GAGGGAAAGCAAAGGGATGATGG - Intronic
908367206 1:63437293-63437315 CTGAGTAAACAATGGGATTAAGG - Exonic
908821401 1:68090816-68090838 CTGGGTAAATAACGAGATGAAGG - Intergenic
911990918 1:104695770-104695792 CTGGGTAAATAACGAGATGAAGG + Intergenic
912505968 1:110156391-110156413 CAGGCTACTCCAAGGGATGAGGG - Intronic
912636450 1:111298495-111298517 CTGGGTAAATAACGAGATGAAGG + Intronic
913080249 1:115378088-115378110 CTTGCTTAACAAAGGGATGAGGG + Intergenic
913562944 1:120041289-120041311 ATGAGTAATCAAAAGGCTGATGG - Intronic
913635179 1:120752300-120752322 ATGAGTAATCAAAAGGCTGATGG + Intergenic
913658550 1:120985084-120985106 TTGGATAATAAAAGGGATGGTGG - Intergenic
914009918 1:143768204-143768226 TTGGATAATAAAAGGGATGGTGG - Intergenic
914544572 1:148651392-148651414 ATGAGTAATCAAAAGGCTGATGG - Intronic
914622055 1:149419621-149419643 ATGAGTAATCAAAAGGCTGATGG + Intergenic
914648537 1:149676865-149676887 TTGGATAATAAAAGGGATGGTGG - Intergenic
915940294 1:160114532-160114554 ATGAGTAATCCAAAGGATGAGGG - Intergenic
916377277 1:164168845-164168867 CTGGGTAAATAATGAGATGAAGG + Intergenic
916473041 1:165142240-165142262 CTGGGTAATCAATTGGGTCAAGG + Intergenic
916896860 1:169172458-169172480 CTTGGTAAGCAAGGGGATGATGG + Intronic
919063662 1:192666199-192666221 CTGGGTAAATAAAGAAATGAAGG - Intergenic
919758645 1:201082497-201082519 CTAGGCAGTCAAAGGGAGGAGGG - Intronic
920700576 1:208215445-208215467 CTAGGTAGACAAATGGATGATGG + Intronic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
921049120 1:211498620-211498642 ATGGGAAATCAATGGGAAGAGGG + Intergenic
921857676 1:220004562-220004584 CTGAGTGAAAAAAGGGATGAAGG + Intronic
923079690 1:230641953-230641975 CTGGGAACTCATAGGGAAGAAGG - Intergenic
923431435 1:233924873-233924895 CTGGGTAAACAACGAAATGAAGG - Intronic
924535185 1:244929620-244929642 CTGGCAAATCTAAGGGATGTGGG - Intergenic
1063335429 10:5208684-5208706 CTGGATAATCAATGATATGAGGG - Intronic
1066297823 10:34070381-34070403 CTGGGTAAATAACGAGATGAAGG + Intergenic
1069580308 10:69561354-69561376 CTGGTCAAGCAAAGGCATGAAGG - Intergenic
1071798314 10:89029566-89029588 CTGGGAATTGAAAGGGATGGCGG + Intergenic
1073884632 10:108023915-108023937 CTGGGTAAATAAAGAGATTAAGG + Intergenic
1074454955 10:113588570-113588592 CTTGGTAACCCAAGGAATGATGG + Exonic
1074943047 10:118253810-118253832 CTGGGGAATTCAAGGAATGAAGG + Intergenic
1076550182 10:131273127-131273149 CAGGGTAATGGAAGGGATGCGGG - Intronic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1079271598 11:18991925-18991947 CTGGGTAAATAAAGAAATGAAGG - Intergenic
1080200643 11:29665551-29665573 CTGGGTAAATAACGGAATGAAGG + Intergenic
1080667920 11:34352025-34352047 CTGGGTAGTCTGAAGGATGAGGG - Intronic
1081929429 11:46858516-46858538 GTGGGTAAAGACAGGGATGAAGG - Exonic
1082123489 11:48405217-48405239 CTGGGTAAGCAACGAAATGAAGG + Intergenic
1082557173 11:54576492-54576514 CTGGGTAAACAATGAAATGAAGG + Intergenic
1083275771 11:61596188-61596210 CTGGTTCATTAAGGGGATGAAGG - Intergenic
1083777539 11:64901688-64901710 CTGGGAAATTCAAGGGATGGAGG - Intronic
1083855665 11:65391961-65391983 CTGGGAACTCAAAGGGCTGGAGG - Intronic
1084284046 11:68120631-68120653 CTGGGTAATCCAAGGGAAGCGGG - Intronic
1084682640 11:70675784-70675806 CTGGGTAATGCCAGGGAGGAAGG + Intronic
1085261285 11:75206167-75206189 CTGGGAAACAAGAGGGATGAAGG - Exonic
1086085766 11:82953604-82953626 CTGGGTAAATAAAGAAATGAAGG - Intronic
1087013375 11:93533755-93533777 ATGGGAATTAAAAGGGATGAAGG - Intronic
1087363937 11:97195970-97195992 CTGGGTAAATAATGGAATGAAGG - Intergenic
1087598982 11:100288509-100288531 CTGGGTACACAAAGAAATGAAGG + Intronic
1087652119 11:100879942-100879964 CTGTGTGTTGAAAGGGATGAGGG - Intronic
1087703516 11:101464046-101464068 CTGGGTAAACAATGAAATGAAGG - Intronic
1088120227 11:106360553-106360575 CTGGGTAACTGAAAGGATGATGG - Intergenic
1095864226 12:46954183-46954205 CTGGGTAATAAGAGGGATTTTGG - Intergenic
1096196140 12:49649975-49649997 TTGGAGAATAAAAGGGATGAGGG - Intronic
1097882378 12:64698096-64698118 CTGGGGAACCACAGGGACGATGG + Intergenic
1098406275 12:70129838-70129860 CTGGGAAATGATAGGAATGAAGG - Intergenic
1099589337 12:84567547-84567569 CTGCATAATCAAATAGATGAGGG - Intergenic
1100872984 12:98931753-98931775 GGGGGTAAACACAGGGATGAAGG - Intronic
1102496208 12:113321009-113321031 CTGGCTTATCAATGGGAGGAGGG - Intronic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103952266 12:124557776-124557798 CTGGGTAAACCAGGGGAGGAAGG - Intronic
1105471767 13:20701551-20701573 CTGAGTAAACCAGGGGATGAGGG + Intergenic
1105617770 13:22035567-22035589 CTGGGAAATCAGAGTGAAGAAGG - Intergenic
1106438989 13:29748785-29748807 CTGGGAATTCAAAGTGGTGATGG - Intergenic
1106979517 13:35261147-35261169 CTGGGAAATGACAGGGATAAGGG + Intronic
1110199438 13:72831505-72831527 CTGGGTAAACAACGAAATGAAGG - Intronic
1114602653 14:23969158-23969180 CTGGGGAATCTGAGGGGTGATGG + Exonic
1114607021 14:24006287-24006309 CTGGGGAATCTGAGGGGTGATGG + Exonic
1115635539 14:35287243-35287265 CTGGGTAAAGAAAGGGACGTAGG - Intronic
1115643049 14:35347568-35347590 GTGGGAGATCAAAGGGAGGAGGG + Intergenic
1115968115 14:38914786-38914808 CTGGGTAAACAATGAAATGAAGG + Intergenic
1116417433 14:44695813-44695835 CTGGGTAAATAACAGGATGAAGG + Intergenic
1117448301 14:55826391-55826413 CTGGGAAATCAAAAGGTTGGAGG - Intergenic
1117613199 14:57504985-57505007 CTGGGTCATCAAAGGGCACATGG + Intergenic
1118829701 14:69419241-69419263 CTGGGTAAACAACGAAATGAAGG - Intronic
1123148892 14:106162071-106162093 CTGGGTAAATAAAGAAATGAAGG + Intergenic
1126071523 15:44869030-44869052 CTGGGTAAACAAAGAAATTAAGG + Intergenic
1126314582 15:47356628-47356650 CTGTGAAATGAGAGGGATGAAGG - Intronic
1129127055 15:73450886-73450908 CTGGGTAAATAAAGAAATGAAGG + Intronic
1129220333 15:74128591-74128613 CTGGGTAATGGAAGGGAGAATGG - Exonic
1130788799 15:87129525-87129547 GTGGGGAATCAAAAGGGTGAGGG + Intergenic
1131184415 15:90262853-90262875 CTGGGTCAGGGAAGGGATGAGGG + Intronic
1131529333 15:93178800-93178822 CTGCAAAATCAAAGGGCTGATGG - Intergenic
1134295595 16:12942693-12942715 CTGGGTAAACAAAGTGAAAAGGG - Intronic
1136681334 16:31965511-31965533 CTGGGTAAATAAAGAAATGAAGG - Intergenic
1136781641 16:32907023-32907045 CTGGGTAAATAAAGAAATGAAGG - Intergenic
1136888149 16:33946817-33946839 CTGGGTAAATAAAGAAATGAAGG + Intergenic
1137503683 16:49031585-49031607 CTGGGTACACAAAGAAATGAAGG + Intergenic
1137808803 16:51332690-51332712 CTGGGTACACAAAGAAATGAAGG + Intergenic
1138739941 16:59296319-59296341 CTGGATAATGAAAGGGATTTAGG + Intergenic
1138807127 16:60103339-60103361 CTGGCAAATCTTAGGGATGATGG + Intergenic
1141003490 16:80330486-80330508 CTGGGAAATAAAAGGGTTTAGGG - Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1203084299 16_KI270728v1_random:1171005-1171027 CTGGGTAAATAAAGAAATGAAGG - Intergenic
1146605689 17:34255712-34255734 CAGGGTAATCAAAGAGAGGGTGG + Intronic
1146659999 17:34659251-34659273 CTTGGTGATGAAATGGATGAAGG - Intergenic
1148910171 17:50938257-50938279 GAGGGGTATCAAAGGGATGAAGG - Intergenic
1149191674 17:54070651-54070673 CTGGGTAATTAAAGAAATGAAGG - Intergenic
1152435040 17:80271350-80271372 CTGAGTACTCAAAGGGAAAAAGG + Intronic
1154332891 18:13444072-13444094 CAGGGTAATCAAATCGTTGATGG - Intronic
1155263854 18:24072661-24072683 ATGGGAAATTAAAGAGATGATGG - Intronic
1156393590 18:36676124-36676146 AAGGGAAATCAAAGGGATAAGGG - Intronic
1156847856 18:41689938-41689960 CTAGGTAATCTATAGGATGATGG - Intergenic
1157057986 18:44253480-44253502 CTGGGTAAATAAAGAAATGAAGG - Intergenic
1159262084 18:66027108-66027130 CTGTGGATTCAAAGGCATGAGGG + Intergenic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1163380504 19:16963940-16963962 CTGGGTAAATAACGGAATGAAGG + Intronic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
925378293 2:3404738-3404760 TTGAGTAAATAAAGGGATGAGGG + Intronic
926021629 2:9501490-9501512 CTGGAATATCAAGGGGATGAAGG + Intronic
927055073 2:19359582-19359604 ATGGGTAGTCAAGGGGGTGATGG - Intergenic
930905870 2:56566737-56566759 CTGGGAAATAAAAAGGATGAGGG - Intergenic
931038733 2:58273207-58273229 CTTGGCAATCAGTGGGATGATGG + Intergenic
932099264 2:68882017-68882039 CTGAAGGATCAAAGGGATGATGG + Intergenic
933269873 2:80221745-80221767 CTGAGCAATCAAAAAGATGAAGG + Intronic
933801828 2:85966683-85966705 CTGGGTACATAAAGGAATGAAGG + Intergenic
933901810 2:86855607-86855629 CTGGGTCATCATAGTGCTGAGGG + Intronic
934518830 2:95006726-95006748 CTTGGCATTCAAAGGGGTGAGGG + Intergenic
934676099 2:96250689-96250711 CTGTGTGATCAAATGTATGAAGG + Exonic
934999962 2:99003705-99003727 CTGGGTAAATAACGAGATGAAGG + Intronic
935778738 2:106493655-106493677 CTGGGTCATCATAGTGCTGAGGG - Intergenic
936723591 2:115284767-115284789 ATGGTTAATCAATGGGATAAAGG + Intronic
937429527 2:121826553-121826575 CTGGGTAATTGAATGGATCAGGG - Intergenic
937835761 2:126468978-126469000 GTGGCTAACCAAAGGGTTGAGGG - Intergenic
939303021 2:140371579-140371601 CTTCAAAATCAAAGGGATGAAGG - Intronic
940437577 2:153672453-153672475 CTGGGTAAATAAAGAAATGAAGG + Intergenic
941763220 2:169267506-169267528 CTGGGTAAGCAACGAAATGAAGG + Intronic
941798649 2:169629823-169629845 CTGGCTAATGAAATGAATGAAGG - Intronic
942392139 2:175506363-175506385 CTGGGTAAACAACGAAATGAAGG + Intergenic
942599687 2:177627991-177628013 GTACGTAATCAAAGAGATGAAGG + Exonic
942669152 2:178354987-178355009 CTGGGTAATTAACGAAATGAAGG + Intronic
942727731 2:179027872-179027894 TTGGGTGAACAATGGGATGAGGG - Intronic
942734077 2:179090643-179090665 CTGGGTAAACAAGGAAATGAAGG - Intergenic
944650916 2:201829456-201829478 CTGAGTATTAAAATGGATGATGG + Intronic
945768089 2:214004709-214004731 CTGGGTCATCCTAGGGATGCAGG + Intronic
947201105 2:227615438-227615460 CTGGTCAATAAATGGGATGATGG - Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
1169683070 20:8238820-8238842 ATGGGTAATCTTAGGGATGGTGG + Intronic
1169796098 20:9464180-9464202 CTGGGTAAATAATGGAATGAAGG + Intronic
1170873452 20:20229573-20229595 CTGGGTAAGCAAATGGATGGAGG + Intronic
1171082106 20:22197015-22197037 CTGGGTAAACAACGAAATGAAGG + Intergenic
1171434352 20:25108145-25108167 CTGGGTAAATAAAGAAATGAAGG + Intergenic
1171443263 20:25184070-25184092 CTGGGTAAATAAAGAAATGAAGG - Intergenic
1172033471 20:31996740-31996762 CTGGGTCATCCAAGGGGAGACGG + Exonic
1172330593 20:34073796-34073818 CTGGGGAAACAAAGGGGAGAGGG - Intronic
1173368244 20:42408902-42408924 TTGGGTAATCACATGGGTGAAGG + Intronic
1174676715 20:52364540-52364562 GTGTGTAATATAAGGGATGATGG + Intergenic
1174976582 20:55342561-55342583 TGGGGTAATAAAAGAGATGAAGG - Intergenic
1175003321 20:55654148-55654170 CTGGGTAAACAACGAAATGAAGG + Intergenic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1178159981 21:29901039-29901061 CTGGGTAAATAAAGAAATGAAGG + Intronic
1179451993 21:41473958-41473980 GTGGGTAATTGAAAGGATGAGGG + Intronic
1182777670 22:32842893-32842915 GTGGGTGATCAAAGGGATGTGGG + Intronic
1182998018 22:34832212-34832234 CTGGGGACTCAATGGGATGCTGG - Intergenic
1183106468 22:35618658-35618680 CTGGATAGACAAAGAGATGATGG - Intronic
949178269 3:1093536-1093558 TTTTTTAATCAAAGGGATGAGGG + Intronic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
950045013 3:9943834-9943856 CAGGGTAATCACAACGATGATGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951776867 3:26320169-26320191 CTGGGTAAATAAAGAAATGAAGG - Intergenic
951790272 3:26474807-26474829 CTGAGTAATTCAAGGTATGATGG + Intergenic
951922484 3:27871681-27871703 CTGGGAAGACACAGGGATGAGGG + Intergenic
955317553 3:57951488-57951510 CTGGGGAATCAAAGGGCAAAAGG + Intergenic
956320792 3:67993895-67993917 CTGGTTAATCAAGGGGAGGGGGG + Intergenic
958447986 3:94238568-94238590 CTGGGTAAATAAAGAAATGAAGG - Intergenic
960460026 3:117922256-117922278 CTGAATACTCAAAGGGAGGAGGG - Intergenic
963727695 3:148940340-148940362 CTGGCTACTCAAAAGGTTGAAGG + Intergenic
965841576 3:172911416-172911438 CTGGGGAATCAAAGAGAAGTTGG - Intronic
966477828 3:180370262-180370284 CTGGGTAAATAAAGAAATGAAGG + Intergenic
967415216 3:189209511-189209533 CTGGGGAATCAAACAGATAAAGG - Intronic
968704236 4:2070583-2070605 CTGCGTAATTGAAGGGAAGAAGG + Intergenic
970505450 4:16724675-16724697 CTTGCTAATCAATGAGATGAGGG - Intronic
971136616 4:23875642-23875664 CTGGGTGATAAAAGAGAAGAAGG - Intronic
971359362 4:25922634-25922656 CTGGGGAATGAAATGTATGAAGG - Intronic
973093099 4:46162963-46162985 CTGGGGAGACAAAGGCATGACGG + Intergenic
974230965 4:59112993-59113015 CTGGGTAAACAAAAAAATGAAGG - Intergenic
975393193 4:73844213-73844235 CTTGGAAATCAAAGGGAATAAGG + Intronic
975524557 4:75334423-75334445 CTGGGTAAACAATGAAATGAAGG + Intergenic
976156835 4:82154865-82154887 CTGGGTAAATAAAGAAATGAAGG + Intergenic
977999275 4:103537222-103537244 ATGGTTAATGATAGGGATGAGGG - Intergenic
978464810 4:108996877-108996899 CTGGGTAAACAACGAAATGAAGG + Intronic
980157347 4:129123769-129123791 CTGGGTAAATAAAGAAATGAAGG - Intergenic
982197867 4:152934743-152934765 CAAGGAGATCAAAGGGATGAGGG + Intergenic
982434612 4:155369533-155369555 CTTGGTACTCAAAGGCTTGATGG - Intronic
983562721 4:169117058-169117080 TTGGGTAACTAATGGGATGAGGG - Intronic
983565770 4:169150051-169150073 ATGGGAAATCAAAGGGCTCAGGG - Intronic
984032470 4:174621025-174621047 CTGGGTAAGTAAAGAAATGAAGG + Intergenic
987008733 5:13738170-13738192 ATGGGTGATTAAAGGGATGCTGG - Intronic
990338774 5:54801825-54801847 CTTGGTAAGAAAATGGATGAAGG - Intergenic
991387782 5:66108833-66108855 CTGGGTAAATAAAGAAATGAAGG + Intergenic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
992846618 5:80755725-80755747 CTTGGTAATCAAAAGGATTGGGG + Intronic
992913949 5:81428628-81428650 CCGGGCACTCCAAGGGATGATGG - Exonic
993947725 5:94135690-94135712 CTGGGTAAACAACGAAATGAAGG - Intergenic
994501043 5:100578677-100578699 CTTGGTACTGAATGGGATGATGG - Intronic
995655109 5:114417614-114417636 TTGGGTGGTAAAAGGGATGAAGG + Intronic
997957003 5:138286553-138286575 CTGGGTGTCCAAAGGGACGATGG + Exonic
1002472236 5:179442400-179442422 GTGGGTGAACAAATGGATGAAGG + Intergenic
1002472264 5:179442578-179442600 GTGGGTGAACAAATGGATGAAGG + Intergenic
1003025281 6:2549672-2549694 GTGGGTAGGAAAAGGGATGAAGG + Intergenic
1003459817 6:6319603-6319625 CTGGGTAATCCAGGGGATCAAGG - Intronic
1004519913 6:16352159-16352181 CTGGTTAACCCAAGGGATGGTGG + Intronic
1005868764 6:29957709-29957731 ATGGGTAAGGAAGGGGATGAGGG + Intergenic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006283838 6:33078168-33078190 CTGGGCAGTGAAAGGGAGGACGG + Intronic
1008088485 6:47268844-47268866 TTGGGGAAGCAAAGGAATGAAGG - Intronic
1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG + Intergenic
1010747507 6:79580543-79580565 CTGGGTAAATAAAGAAATGAAGG + Intergenic
1010838157 6:80614992-80615014 CTGGGTAAATAAAGAAATGAAGG + Intergenic
1011727673 6:90227079-90227101 ATGGCAAATCAAATGGATGAAGG - Intronic
1012261704 6:97094909-97094931 TTGGGTAATTAAAGGAGTGATGG + Intronic
1013870230 6:114749251-114749273 TTGAGTGATCAAAGGGATGCAGG + Intergenic
1014202648 6:118622801-118622823 CGGGGTCATCAAAAAGATGAAGG + Intronic
1014471971 6:121827349-121827371 ATGGGAAATCAAAGGGATAGAGG + Intergenic
1015784391 6:136906069-136906091 ATGGAGAATCAATGGGATGATGG - Intronic
1015800661 6:137059276-137059298 CTGGGTAATTTAAGGAATTAAGG + Intergenic
1015890823 6:137968051-137968073 CTGGGAGATCAAAGTGATGGTGG - Intergenic
1015931548 6:138365565-138365587 CTGGGTAAATAAAGAAATGAAGG + Intergenic
1016523627 6:144974964-144974986 CTGGGTAAATAACGGAATGAAGG - Intergenic
1018075779 6:160211962-160211984 CTGGGTAAACAATGAAATGAAGG - Intronic
1020107082 7:5427112-5427134 CTGGGTAAACAAAAGTATGAGGG - Intergenic
1028419637 7:90618492-90618514 CTGGGTCATGAAAGGCTTGAGGG - Intronic
1028805721 7:95024023-95024045 CTGGGTAAACAAAGAAATTAGGG - Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1031068392 7:117134020-117134042 CAGGGTAATCAAAGAGGGGAAGG - Intronic
1032550447 7:132779697-132779719 CTGTGCAGTCCAAGGGATGAGGG - Intergenic
1032586099 7:133148066-133148088 CCAGGTATCCAAAGGGATGAGGG - Intergenic
1034496053 7:151423244-151423266 CTAGGTGATTAAAGGGAAGAGGG + Intergenic
1036694317 8:10964734-10964756 CTGGGGAAATCAAGGGATGAGGG - Intronic
1037316979 8:17608428-17608450 CTGGGTAAATAAACGCATGAGGG - Intronic
1039824099 8:41158195-41158217 CTGGGGAAGAAAAGGGATGGGGG + Intergenic
1040574137 8:48635997-48636019 CTGGGTCATAAAAGGTATGGTGG - Intergenic
1041423832 8:57698048-57698070 CTGGGTAATTAAAGAAATGAAGG + Intergenic
1042016566 8:64319962-64319984 CTGGGTAAGTAAAGAAATGAAGG - Intergenic
1042525576 8:69761454-69761476 CAGTGTAATCAAAGGAAAGACGG - Intronic
1043244163 8:77976979-77977001 CTGGGTAAATAAAGAAATGAAGG - Intergenic
1044598687 8:93982363-93982385 CTGGCTATTCAAAGGGATTAAGG + Intergenic
1045323671 8:101101068-101101090 CTGAGAAATTAAAGGGATGGTGG - Intergenic
1045928100 8:107594521-107594543 CTGGGTAAATAACGAGATGAAGG - Intergenic
1046351034 8:113012785-113012807 CTGTATTATCAAAGGGATGTTGG - Intronic
1047298764 8:123594701-123594723 CTGGGTCTTCAAAGGAATGATGG - Intergenic
1047445609 8:124916399-124916421 CTGAGTAATTAAAGGGTAGAAGG - Intergenic
1049385663 8:142341794-142341816 CTGGGTAATTAACGGGATGGTGG - Intronic
1050590807 9:7158581-7158603 CTGGGTAAACAACGAAATGAAGG - Intergenic
1053163665 9:35829805-35829827 TTGGGTAAACACAGAGATGAGGG - Exonic
1055189664 9:73502433-73502455 TTGGCTAACAAAAGGGATGATGG - Intergenic
1060523242 9:124306179-124306201 CTTGGTAGTGGAAGGGATGAGGG + Intronic
1185939276 X:4297152-4297174 ATGGGTAGTCAAAAGGATTAGGG - Intergenic
1186585912 X:10872727-10872749 CTGGGTAATTAAGGAAATGAAGG + Intergenic
1188445408 X:30249095-30249117 CTGGGTACTCAGAGAGGTGAAGG + Intronic
1189317212 X:40064552-40064574 CTGGGGCTTCAAAGGGATCACGG + Exonic
1189878290 X:45460663-45460685 TTGGGTAAACAAAGGAATTAAGG - Intergenic
1191154278 X:57254675-57254697 CTGGGTAAATAAAGAAATGAAGG + Intergenic
1191907124 X:66105541-66105563 CTGGGTAAATAAAGAAATGAAGG - Intergenic
1193317113 X:80077137-80077159 GTGGGGAATCACAGGGAAGAGGG + Intergenic
1193736839 X:85167234-85167256 CTGGGGAATCAGAGAGATGGGGG + Intergenic
1195774536 X:108388955-108388977 CTGGGTAAACAACGAAATGAAGG - Intronic
1198110861 X:133501653-133501675 CTGGGAAATCAGAGGCAAGATGG - Intergenic
1198749369 X:139923248-139923270 CTGGGGACCCAAAGGGCTGAAGG - Intronic
1200732310 Y:6755897-6755919 CTGGGTAAACAATGAAATGAAGG - Intergenic
1201957675 Y:19644134-19644156 CTGGGTAAACAATGAAATGAAGG - Intergenic