ID: 1167431295

View in Genome Browser
Species Human (GRCh38)
Location 19:49456085-49456107
Sequence GAACCCTCTGGACATTCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167431288_1167431295 2 Left 1167431288 19:49456060-49456082 CCAGGCCCTCTTCTCAGGCCTCC 0: 1
1: 0
2: 8
3: 73
4: 695
Right 1167431295 19:49456085-49456107 GAACCCTCTGGACATTCTTTTGG 0: 1
1: 0
2: 1
3: 8
4: 119
1167431286_1167431295 13 Left 1167431286 19:49456049-49456071 CCTCTTCTCATCCAGGCCCTCTT 0: 1
1: 0
2: 2
3: 33
4: 411
Right 1167431295 19:49456085-49456107 GAACCCTCTGGACATTCTTTTGG 0: 1
1: 0
2: 1
3: 8
4: 119
1167431284_1167431295 30 Left 1167431284 19:49456032-49456054 CCATGAATCGTTAAGCTCCTCTT 0: 1
1: 0
2: 0
3: 9
4: 83
Right 1167431295 19:49456085-49456107 GAACCCTCTGGACATTCTTTTGG 0: 1
1: 0
2: 1
3: 8
4: 119
1167431290_1167431295 -3 Left 1167431290 19:49456065-49456087 CCCTCTTCTCAGGCCTCCTGGAA No data
Right 1167431295 19:49456085-49456107 GAACCCTCTGGACATTCTTTTGG 0: 1
1: 0
2: 1
3: 8
4: 119
1167431291_1167431295 -4 Left 1167431291 19:49456066-49456088 CCTCTTCTCAGGCCTCCTGGAAC 0: 1
1: 0
2: 3
3: 40
4: 320
Right 1167431295 19:49456085-49456107 GAACCCTCTGGACATTCTTTTGG 0: 1
1: 0
2: 1
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167431295 Original CRISPR GAACCCTCTGGACATTCTTT TGG Intronic
900686352 1:3950554-3950576 GAACTCTCTGTACCTTCTGTTGG + Intergenic
901167005 1:7228519-7228541 GAACACACTGGAGATACTTTTGG + Intronic
910438157 1:87226456-87226478 CATTCCTCTGGACATTCTTCTGG + Intergenic
911720064 1:101181308-101181330 GAACCCTCCGGACAGCCTATAGG + Intergenic
912556420 1:110519373-110519395 GAACCCAATGGGGATTCTTTAGG + Intergenic
916439045 1:164804700-164804722 GAACTGTCAGGACATGCTTTGGG + Intronic
916586696 1:166155644-166155666 GAACCATCTTCACTTTCTTTAGG - Intronic
917075954 1:171205204-171205226 GAACCCTCTTGATATTTTTGGGG - Intronic
917237171 1:172906707-172906729 AAACCATCAGGACATTCTATGGG + Intergenic
917255815 1:173115203-173115225 AAACCCTGTGGCCATCCTTTGGG + Intergenic
917982030 1:180275721-180275743 GAACCCTTTGGACAATTTTAGGG - Exonic
919395459 1:197041679-197041701 AAACCCTGTTGTCATTCTTTTGG + Intronic
1063590020 10:7386618-7386640 GAACCCACTGGTCATTGGTTAGG + Intronic
1064052715 10:12071845-12071867 GAACCCTCTTTTCATTCCTTAGG - Intronic
1069409052 10:68133616-68133638 GAACTCTCTGGACATGCTCCAGG + Intronic
1073326722 10:102647571-102647593 GAACCCTCTGCACTCTCTGTAGG + Intronic
1073607035 10:104906674-104906696 GAATCCTCTTGTGATTCTTTTGG + Intronic
1074667657 10:115748516-115748538 GAAAGCCCTGGACACTCTTTTGG + Intronic
1075599283 10:123755484-123755506 TAAGCCTCTGGACATTCTAATGG - Intronic
1075608024 10:123829993-123830015 GAACCATCTGGAATTTATTTTGG - Intronic
1082053545 11:47793554-47793576 GACCCCTCTTTTCATTCTTTGGG - Intronic
1086046107 11:82533853-82533875 TAAACCTCTGGACATTCCTGTGG - Intergenic
1089456628 11:118629586-118629608 GAAGCATCTGGAGATGCTTTTGG + Intronic
1092148550 12:6231581-6231603 GGCCCCTCTGGGCATTCCTTTGG + Intronic
1093420736 12:18971459-18971481 GAACCCTTTGAACTTTCCTTTGG + Intergenic
1093867133 12:24241452-24241474 GAACCCTCTTGACATACTCCTGG - Intergenic
1096380283 12:51151279-51151301 GAAGCCACTGGACAGTTTTTAGG + Intronic
1099725190 12:86417292-86417314 GAACACTGTGGTCATTCTATTGG - Intronic
1103435236 12:120920343-120920365 GAGCCCTCTGGAAAGTATTTGGG + Intergenic
1109289396 13:60455499-60455521 GAAGCCACTGGAAATGCTTTTGG + Intronic
1115659848 14:35482628-35482650 GTACCCTCTGGACCCTCCTTGGG - Intergenic
1121926167 14:97929260-97929282 GGACCCTCTGGACAGCTTTTTGG + Intronic
1124471785 15:29993984-29994006 CAAATCTCTGTACATTCTTTTGG - Intergenic
1129899667 15:79136849-79136871 GCACCCTCTGCTCAGTCTTTGGG - Intergenic
1131582171 15:93654987-93655009 GCACCCTCTGAACATTATATTGG + Intergenic
1131916730 15:97274101-97274123 GATCCCTCTGGATATTCTGGTGG + Intergenic
1131988170 15:98065911-98065933 ATACCCTCTGGACCTGCTTTGGG - Intergenic
1137355733 16:47761629-47761651 GAGCACTCTGGGCATTCTTTTGG + Intergenic
1146992436 17:37287072-37287094 TAATCCTCTGAACACTCTTTTGG - Intronic
1148549533 17:48542292-48542314 GAAGCCTGTGGACAGTCTTCAGG - Intronic
1153345034 18:4016445-4016467 AAACCTTGTGTACATTCTTTGGG + Intronic
1155599384 18:27527286-27527308 AAGCCATCTGGATATTCTTTAGG - Intergenic
1155868748 18:30998883-30998905 GCACTCCCTGGAAATTCTTTTGG - Intronic
1156468303 18:37361925-37361947 GTACCCTCTGAAGCTTCTTTTGG - Intronic
1156487952 18:37478535-37478557 GAACCCTCAGGACAGTGGTTGGG + Intronic
1160086101 18:75778921-75778943 AAACCTTCTTGACATCCTTTTGG + Intergenic
1162035912 19:7939251-7939273 CAACTCTTTGGACATTCTGTTGG + Intronic
1166958015 19:46478750-46478772 GAGCCCCCTGGACTTTCTTTGGG - Intergenic
1167431295 19:49456085-49456107 GAACCCTCTGGACATTCTTTTGG + Intronic
929022124 2:37563794-37563816 GAACACTCAGGACTCTCTTTTGG - Intergenic
929219268 2:39446742-39446764 GACCCCACTGGAAAATCTTTAGG - Intergenic
930055673 2:47250380-47250402 GAAGCATCTGGACACTCCTTGGG - Intergenic
931665517 2:64607589-64607611 GAACCATCTGGACATTTTGCAGG + Intergenic
931960730 2:67479465-67479487 AAACAATGTGGACATTCTTTTGG + Intergenic
935321324 2:101891964-101891986 GAACCATCTGCACATGATTTAGG - Intronic
942463165 2:176183543-176183565 CAAACCTCTGGACACTTTTTAGG + Intergenic
943527565 2:189036864-189036886 AAACCCTCTGTTAATTCTTTTGG - Intronic
944415656 2:199477167-199477189 GAACCCCCTGGATTTTCATTTGG - Intergenic
944416064 2:199480969-199480991 GTACTCTCTGGACATACTTTGGG - Intergenic
944557338 2:200900459-200900481 TAGCCCTCTGGCCATTCCTTTGG + Intronic
944901530 2:204221504-204221526 GAACCCCATGGACAGTCTTCAGG - Intergenic
947983055 2:234426222-234426244 GAACCCTCAGGACCTGCCTTTGG + Intergenic
1169740290 20:8886166-8886188 GAACACTTTGGAGATTCATTGGG - Intronic
1170600079 20:17835469-17835491 AAACCCTGTGAACATGCTTTAGG + Intergenic
1171437251 20:25133243-25133265 TGACCCTCTGAACATTCTCTTGG + Intergenic
1172987824 20:39007145-39007167 AAAACCCCTGGACCTTCTTTAGG - Intronic
1173136529 20:40443695-40443717 GAAATGTCTGCACATTCTTTAGG - Intergenic
1174991110 20:55510982-55511004 GAAGCCTCGGGAAATTCTTAGGG - Intergenic
1181163897 22:20973506-20973528 GAACCCACTGGCCATTCTCGAGG - Exonic
1181924477 22:26347504-26347526 GAACTCACTGAACATTCTCTTGG - Intronic
1183160617 22:36110597-36110619 GCAGCCTGTGGACCTTCTTTGGG + Intergenic
1183753078 22:39733292-39733314 AGACCCTCTGGATCTTCTTTTGG - Intergenic
1184004267 22:41697128-41697150 GAACCCTCTGGAACCTCTCTGGG - Exonic
953684507 3:45066101-45066123 CAACCCTCTGGCCCTTCTTTGGG - Intergenic
954983562 3:54768890-54768912 GAACCCTCAGAACATTCTACCGG - Intronic
961390138 3:126547687-126547709 GAACTCTCTGGAAATTGTTCTGG + Intronic
961419043 3:126785265-126785287 GAAACATCTGGAGATTGTTTTGG - Intronic
965733375 3:171795749-171795771 GAACTCTCTGAACACCCTTTTGG - Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
969120435 4:4904786-4904808 AAAGCCTCTGGACATTATTTTGG - Intergenic
969552358 4:7879193-7879215 GAACCCTCTGGCCAGTCTTTGGG - Intronic
978232015 4:106411026-106411048 GAATCCTCTCAACATTCTTAAGG - Intergenic
981074415 4:140577159-140577181 GATCCCTTTGCACCTTCTTTGGG - Intergenic
981341450 4:143626419-143626441 GAACCCTTTGGAAATCCTTCTGG - Intronic
982280571 4:153680293-153680315 GAACTCTCTGAAGTTTCTTTTGG + Intergenic
983021742 4:162684974-162684996 GAAACCTATGGACTTTCCTTGGG + Intergenic
983787793 4:171756107-171756129 CAACCATCTGGACATTGTTTGGG - Intergenic
989263103 5:39441373-39441395 AAACTATCTGGACATACTTTAGG + Intronic
989300733 5:39889583-39889605 GAACCATCTTTGCATTCTTTGGG + Intergenic
989411344 5:41122826-41122848 CAGCCCCCGGGACATTCTTTGGG + Intergenic
993805325 5:92400821-92400843 GAAACTTGTGGAAATTCTTTAGG - Intergenic
994583203 5:101674168-101674190 AAACCATGTGGAAATTCTTTAGG + Intergenic
995295421 5:110515551-110515573 GAAGCATTTGGACATTCATTGGG - Intronic
996915822 5:128711308-128711330 AAGCCCTTTAGACATTCTTTTGG + Intronic
999883832 5:155898033-155898055 GAACCCTATCCAGATTCTTTTGG + Intronic
1000213458 5:159131555-159131577 GATCTCTCTGGACTTTTTTTTGG + Intergenic
1003755799 6:9118534-9118556 GAACTCTGAGGACATTCTTGAGG - Intergenic
1004139352 6:13001376-13001398 GAACCCTCTGCACTATCTTTTGG - Intronic
1005807682 6:29490328-29490350 GAACTGTCTGTACCTTCTTTGGG + Intergenic
1008316813 6:50053363-50053385 GAACCCTCTGATGATTTTTTTGG + Intergenic
1010133807 6:72526296-72526318 TCTCCCTCTGGACATCCTTTAGG + Intergenic
1011452432 6:87508835-87508857 TAGCCCTCTGGGCATTGTTTTGG + Intronic
1014007428 6:116436118-116436140 GATTCCTCTGAACATTCTTCAGG - Exonic
1016974646 6:149795292-149795314 GAACCATCTGGAGAGGCTTTTGG - Intronic
1021561209 7:21970326-21970348 GAACCCACTTGACATTCTGCAGG - Intergenic
1021776230 7:24057889-24057911 ATAGCCTCTGCACATTCTTTTGG + Intergenic
1026270265 7:68830476-68830498 GAACTCTCTGGAAATCTTTTAGG - Intergenic
1028165152 7:87530006-87530028 GTTCCCTCTGGAAAATCTTTTGG - Intronic
1029362695 7:100098826-100098848 GAACCCTCTGAACTTACTCTGGG + Intronic
1029805720 7:102994212-102994234 GAACATTCTGCACATTATTTGGG + Intronic
1030019952 7:105263524-105263546 AAACCCTCTGGATAAGCTTTTGG - Intronic
1031997149 7:128240584-128240606 GGACACTCTGGACATACTGTGGG - Intergenic
1037707481 8:21327307-21327329 GAACTATGTGGTCATTCTTTGGG - Intergenic
1038764065 8:30411296-30411318 GAATCTTCTGGAGATTCTGTGGG + Intronic
1039563188 8:38529421-38529443 AGACCCTCAGGACATTCTGTGGG - Intergenic
1041415434 8:57602824-57602846 GAACTCCCTGAACCTTCTTTTGG - Intergenic
1041848351 8:62357662-62357684 GAAGCCTCTGGACCATGTTTAGG - Intronic
1043299684 8:78711821-78711843 GAACTCTCTGAGGATTCTTTTGG + Intronic
1043814924 8:84790570-84790592 GCACCCACTGGACATTTTTCTGG + Intronic
1054721752 9:68610758-68610780 GATTCCTCTGAACATTCTTCAGG - Intergenic
1057522583 9:95772012-95772034 GGACACTCTGGACAGTCTTTTGG - Intergenic
1059909884 9:119031191-119031213 GGACCCTCTGTGCATTCATTGGG + Intergenic
1188304440 X:28545444-28545466 GAAATTTCTGCACATTCTTTGGG - Intergenic
1188961251 X:36494703-36494725 GATCCCGCTTTACATTCTTTTGG + Intergenic
1196005935 X:110837189-110837211 GGACCCTCTGGGCAGTCTCTGGG + Intergenic
1196154606 X:112414472-112414494 GGTCCATCTGGACATTATTTTGG + Intergenic
1198830338 X:140743790-140743812 AAAGCCTCTCGACTTTCTTTTGG - Intergenic
1200172826 X:154090697-154090719 GAACTCTCTGTACATTTCTTAGG + Intronic
1201225677 Y:11816702-11816724 GAACCCTCTGGACTATTTGTAGG + Intergenic