ID: 1167434256

View in Genome Browser
Species Human (GRCh38)
Location 19:49470031-49470053
Sequence TCACATCTGTTACCAACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167434256_1167434262 19 Left 1167434256 19:49470031-49470053 CCTCCTGTTGGTAACAGATGTGA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1167434262 19:49470073-49470095 GGGGCCCATTCCTTTCAACATGG 0: 1
1: 0
2: 0
3: 10
4: 90
1167434256_1167434259 -1 Left 1167434256 19:49470031-49470053 CCTCCTGTTGGTAACAGATGTGA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1167434259 19:49470053-49470075 AACTTGTTGACAAGAGCCTTGGG 0: 1
1: 1
2: 0
3: 5
4: 109
1167434256_1167434267 29 Left 1167434256 19:49470031-49470053 CCTCCTGTTGGTAACAGATGTGA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1167434267 19:49470083-49470105 CCTTTCAACATGGGCTGTTAAGG 0: 1
1: 0
2: 0
3: 7
4: 104
1167434256_1167434263 20 Left 1167434256 19:49470031-49470053 CCTCCTGTTGGTAACAGATGTGA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1167434263 19:49470074-49470096 GGGCCCATTCCTTTCAACATGGG 0: 1
1: 0
2: 0
3: 9
4: 82
1167434256_1167434268 30 Left 1167434256 19:49470031-49470053 CCTCCTGTTGGTAACAGATGTGA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1167434268 19:49470084-49470106 CTTTCAACATGGGCTGTTAAGGG 0: 1
1: 0
2: 1
3: 11
4: 139
1167434256_1167434258 -2 Left 1167434256 19:49470031-49470053 CCTCCTGTTGGTAACAGATGTGA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1167434258 19:49470052-49470074 GAACTTGTTGACAAGAGCCTTGG 0: 1
1: 0
2: 1
3: 3
4: 102
1167434256_1167434260 0 Left 1167434256 19:49470031-49470053 CCTCCTGTTGGTAACAGATGTGA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1167434260 19:49470054-49470076 ACTTGTTGACAAGAGCCTTGGGG 0: 1
1: 0
2: 1
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167434256 Original CRISPR TCACATCTGTTACCAACAGG AGG (reversed) Intronic
903156941 1:21451873-21451895 TCACATTTGATCCCAACTGGCGG - Intronic
906604887 1:47161528-47161550 CCACAGCTCTTACCAACTGGGGG + Intergenic
906917599 1:50027910-50027932 TCACATCTAGTAAAAACAGGAGG + Intergenic
913490024 1:119370426-119370448 TCACACATGTCATCAACAGGAGG + Intronic
913541866 1:119828916-119828938 TCACATTTGATCCCAACTGGCGG - Intergenic
913545315 1:119862024-119862046 TCACATTTGATCCCAACTGGCGG + Intergenic
913601743 1:120427811-120427833 TCACATTTGATCCCAACTGGCGG - Intergenic
914085299 1:144448789-144448811 TCACATTTGATCCCAACTGGCGG + Exonic
914191188 1:145412763-145412785 TCACATTTGATCCCAACTGGCGG + Intergenic
914589120 1:149090767-149090789 TCACATTTGATCCCAACTGGCGG + Exonic
915287794 1:154863926-154863948 AAACATCTGTAACCCACAGGGGG - Intronic
1063401420 10:5749532-5749554 CCACAACTGTTACCAGAAGGGGG - Exonic
1069659821 10:70116367-70116389 TCCCATCTCTTACCACTAGGGGG + Intronic
1070765477 10:79053803-79053825 TCACAGCTGTTAGCAGCAGGAGG - Intergenic
1082142510 11:48626064-48626086 TCACCCCAGTGACCAACAGGAGG + Intergenic
1083797819 11:65027785-65027807 TTACATCTTTAACCACCAGGGGG + Intronic
1084434976 11:69134072-69134094 TCACATCTGTTGTTCACAGGTGG - Intergenic
1085682127 11:78586642-78586664 TTATATATGTTACCACCAGGTGG - Intergenic
1089410685 11:118239663-118239685 CAACATCTGTCACCAACACGAGG + Intronic
1090781063 11:130007098-130007120 TCACATCTGTTGCCAACATATGG + Intergenic
1092101803 12:5889654-5889676 TCACAGCTGTTACCAGCACAGGG - Intronic
1094604955 12:31941998-31942020 TAATATCTCTTCCCAACAGGAGG + Intergenic
1094802785 12:34056415-34056437 TCACAGCTGTTACTGACAAGTGG - Intergenic
1095055205 12:37590403-37590425 TCATATCTGTTACTAATAAGGGG - Intergenic
1095116194 12:38354907-38354929 TCACAGCTGTTACTGACAAGTGG - Intergenic
1100857594 12:98771830-98771852 TCAGATCAGATACCTACAGGTGG - Intronic
1103878777 12:124149907-124149929 TCACATCTGTTCCTAACAACGGG - Intronic
1112448854 13:99491320-99491342 TAATATCTCTTCCCAACAGGGGG + Intergenic
1118547997 14:66916168-66916190 TCACATCTGATACCAATTGCAGG + Intronic
1123165036 14:106318395-106318417 ACACATGTATTACCAACAGGAGG + Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128770962 15:70282129-70282151 TCACTTCTGTTACCATGGGGAGG + Intergenic
1133218361 16:4307170-4307192 TCACATTTTTTAGCAAGAGGTGG - Intergenic
1134861685 16:17565761-17565783 TCTCCTTTTTTACCAACAGGGGG - Intergenic
1138167606 16:54817685-54817707 ACACATCTGCTGCCACCAGGAGG + Intergenic
1141686945 16:85575675-85575697 TGACATCTGTAACTAACAGCTGG + Intergenic
1144740984 17:17582100-17582122 TCACACCTGTGACCAAAGGGCGG + Intronic
1150358289 17:64506618-64506640 TCACGTCTGTAACCAAAAGAGGG + Exonic
1156579875 18:38362632-38362654 TCACATCTGTGAGCTGCAGGGGG - Intergenic
1157636445 18:49160643-49160665 TTTCATCTTTTACCAACAAGTGG + Intronic
1157912457 18:51630014-51630036 TCACATTTGGTAACAACAGAGGG + Intergenic
1158327480 18:56326844-56326866 TCACAGTTGTTACCTGCAGGGGG - Intergenic
1159024325 18:63168661-63168683 TCTGATCTGTTTCCAACTGGGGG + Intronic
1159886911 18:73917142-73917164 TCCCATCTATTACCAAAAAGGGG - Intergenic
1167434256 19:49470031-49470053 TCACATCTGTTACCAACAGGAGG - Intronic
1168459474 19:56541359-56541381 TCACATCTATCACCAGCAGCAGG + Intronic
930343447 2:50147123-50147145 TCACATCTGGGATCATCAGGAGG + Intronic
935261762 2:101361934-101361956 TGAGATCTGTTACCCAGAGGAGG - Intronic
936714076 2:115163357-115163379 TCACATGTGTTTCACACAGGTGG + Intronic
938610809 2:132945596-132945618 TCACTTCTCTTACAAACTGGGGG + Intronic
943851238 2:192725172-192725194 TAACATCTATTTCCAACAGAAGG + Intergenic
947389066 2:229621494-229621516 TCCCACCTGCTCCCAACAGGAGG + Intronic
947672071 2:231944007-231944029 TCTCACCTCTTACCAACAGCTGG - Intergenic
948320075 2:237062033-237062055 TCAGCTCTGTGACCAGCAGGTGG - Intergenic
1170343161 20:15351925-15351947 ATACATCTGGTACAAACAGGTGG + Intronic
1170773151 20:19351721-19351743 TCACCTCAGTTTCCACCAGGTGG + Intronic
1176759695 21:10769385-10769407 TCACAGATTTTACCAAAAGGGGG + Intergenic
1179145357 21:38763323-38763345 TCACATTTGTTACCTCCAGCAGG + Intergenic
1179579555 21:42332437-42332459 TGACATCTGCTAACAGCAGGTGG - Intergenic
1180938676 22:19642434-19642456 GCACATCTGTTCCCAAAAGGAGG - Intergenic
1182168390 22:28200669-28200691 TTACATGTGTAACAAACAGGTGG + Intronic
1184237528 22:43191567-43191589 TCACAGCTGAGATCAACAGGAGG - Intergenic
950183217 3:10929321-10929343 TCACCTCTGTTAACATCACGAGG - Exonic
950770419 3:15306605-15306627 ACACATGTTTTACCAGCAGGTGG - Intronic
953121422 3:40046330-40046352 TGACGTTTGTTACCAACTGGTGG + Intronic
953534801 3:43769601-43769623 TCCCAGCTGTGACCAGCAGGGGG + Intergenic
960954453 3:123021941-123021963 TCAGATGGGTTAACAACAGGGGG + Intronic
963276034 3:143330626-143330648 TCACTTCTGTTAGGAACAGAAGG - Intronic
970383468 4:15531910-15531932 TCTTATCTGTCACCATCAGGTGG - Intronic
973638244 4:52879421-52879443 TCACATGTGTTGCCAACTGCAGG + Intronic
975443458 4:74437778-74437800 TAATATCTCTTCCCAACAGGGGG + Intergenic
986102360 5:4625708-4625730 CCCCATCTGTTACCAGCAGTGGG - Intergenic
994007282 5:94853859-94853881 TCATATCTGTTATCCAGAGGCGG - Intronic
994349973 5:98734213-98734235 TCATATTTCTTACCAACAGCTGG - Intergenic
995297595 5:110539005-110539027 TAATATCTCTTCCCAACAGGGGG - Intronic
995461621 5:112409877-112409899 TCACAGCACTAACCAACAGGAGG + Intronic
1001486500 5:172123329-172123351 TCACTGCTGCCACCAACAGGGGG + Intronic
1006142991 6:31942208-31942230 TCACACCTGTAATCACCAGGAGG - Intronic
1008567593 6:52784412-52784434 TCACATCTGGATCCAAAAGGAGG + Intergenic
1010786669 6:80010456-80010478 TCACAACAGTTAGAAACAGGAGG - Intronic
1011528142 6:88289323-88289345 TAACATTTTTTACTAACAGGTGG - Intergenic
1012300144 6:97577464-97577486 TCACATGTGTGATCATCAGGTGG - Intergenic
1014244754 6:119055932-119055954 TCATATCTGTTATCAAGATGGGG - Intronic
1015692828 6:135944451-135944473 TCAAATCTGTTACCATCATCAGG + Intronic
1022879355 7:34569895-34569917 TCACTTCTGTTACCAGAAAGGGG + Intergenic
1023164678 7:37331838-37331860 TCACATCTGTCACCAAGAAAAGG + Intronic
1024780294 7:52839871-52839893 TCACATCTTTGACTAACAAGGGG - Intergenic
1027112615 7:75452895-75452917 TTGCATCTCTCACCAACAGGTGG + Intronic
1027284859 7:76637501-76637523 TTGCATCTCTCACCAACAGGTGG + Intergenic
1030323033 7:108189202-108189224 CCAGTTCTGTTACCAACAGGGGG + Intronic
1031710721 7:125043085-125043107 TCACATCATTTAACACCAGGTGG + Intergenic
1031860593 7:126975407-126975429 TCACATATGTTACCAGGACGTGG + Intronic
1032522387 7:132555385-132555407 TCACATCTGTTTCTAACACTGGG - Intronic
1033601552 7:142892368-142892390 TGACATCTGGTACCCGCAGGAGG + Intergenic
1033740679 7:144273571-144273593 TCACATCTGTGCCCACCAGCTGG + Intergenic
1033753228 7:144376042-144376064 TCACATCTGTGCCCACCAGCTGG - Intronic
1034018174 7:147609752-147609774 ACAAATTTGTTACCTACAGGAGG + Intronic
1034600703 7:152252625-152252647 TGACAATTGTTACCAACAGCAGG - Exonic
1036561020 8:9900517-9900539 TTACTTCTGTTACCAAAGGGAGG - Intergenic
1041662347 8:60412685-60412707 TAAAATCTGTGACCACCAGGGGG + Intergenic
1043687400 8:83105015-83105037 AGGCATCTGTTACAAACAGGTGG - Intergenic
1046675598 8:117104603-117104625 ACATTTCTGTTACCAAAAGGGGG + Intronic
1050278427 9:4024802-4024824 TCATATCTGTGATAAACAGGAGG - Intronic
1058950698 9:109901297-109901319 TCTCAGCTGTTTACAACAGGTGG - Intronic
1203404512 Un_KI270507v1:65-87 TCACAGATTTTACCAAAAGGGGG - Intergenic
1186849501 X:13566802-13566824 TCACACCTGTTCCACACAGGGGG + Intergenic
1187850119 X:23583372-23583394 CCACATCTTTTACCAACATCAGG - Intergenic
1191191804 X:57675831-57675853 TGACATCTGGTAACAACAGAGGG - Intergenic
1199161016 X:144611837-144611859 TGTCCTCTGTTGCCAACAGGAGG - Intergenic
1200754469 Y:6977300-6977322 TGTCATCTGTCAACAACAGGAGG - Intronic