ID: 1167437194

View in Genome Browser
Species Human (GRCh38)
Location 19:49486345-49486367
Sequence CTGGAGCCCCGGGCCGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 368}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167437194 Original CRISPR CTGGAGCCCCGGGCCGGCGC TGG Intergenic
900019922 1:181252-181274 GAGGCGCGCCGGGCCGGCGCAGG + Intergenic
900162784 1:1232252-1232274 CTGGGCCGCCGGCCCGGCGCGGG + Exonic
900494852 1:2971781-2971803 CTGGAGCCCCAGGCCGTCCCTGG + Intergenic
900503547 1:3018159-3018181 CTGGACACCCGGGGCGACGCTGG - Intergenic
900577915 1:3393555-3393577 CTCGAGCCAGGAGCCGGCGCAGG + Intronic
900630647 1:3633424-3633446 CCGCCGCCCCGGGCCGGGGCCGG - Exonic
901057477 1:6455383-6455405 CTCCAGCCCCGGGCCAGCACCGG - Intronic
901703123 1:11055975-11055997 CTGGAGCACTGGGGCGGGGCGGG - Intronic
902053621 1:13583183-13583205 CTGGATCCCCGGGTCGGCAGAGG + Intergenic
902323732 1:15684744-15684766 CGGGAGCCCCGGGCCGGTAGAGG + Intronic
902372421 1:16014869-16014891 CTGGAGGCCCCAGCAGGCGCAGG + Exonic
902405981 1:16183838-16183860 CTGGAGCCCCGGGCTGGCTGAGG + Intergenic
902501468 1:16914219-16914241 CTGGAGCCACGTACCGGGGCTGG + Intronic
903161303 1:21491059-21491081 CTGGAGCCCTGGGCCAGAGCAGG + Intergenic
904528732 1:31154827-31154849 CTGGAGACCAAGGCCGGCGCCGG - Intergenic
904696843 1:32335870-32335892 CTAGGGCCCGGGGCCGGGGCCGG - Intronic
904769018 1:32870762-32870784 CGGCAGGCCCGGGGCGGCGCAGG + Exonic
905912180 1:41662487-41662509 GAGGCGCCCCGGGCCGGCGGCGG - Intronic
906036709 1:42755022-42755044 GTGGAGCCCAGGGCTGGCCCTGG - Intronic
906627087 1:47334076-47334098 CTGGGTCCCCTTGCCGGCGCCGG - Exonic
907278076 1:53327909-53327931 CCGGAGCCCCGGGCCCGCCATGG - Exonic
907319721 1:53594747-53594769 CTGGAGGCCCAGGCCAGAGCTGG + Exonic
907689220 1:56645546-56645568 CGGGAGCCCCGGGCCTCCGGCGG + Intronic
910251461 1:85201795-85201817 CCGGAGCCCCGGGCCGCGACGGG + Intergenic
912576050 1:110674107-110674129 CGAGAGCTCCGGGCCGGCCCGGG - Exonic
915344389 1:155190930-155190952 GTGGAGCCCGGGGCCGGCAGGGG + Intronic
915740266 1:158113705-158113727 CCGGAGCCCGAGGTCGGCGCGGG + Intergenic
916414097 1:164576639-164576661 GGGGAGCCTCGGGCCGCCGCCGG - Intronic
918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG + Exonic
918437737 1:184533780-184533802 CAGGAGGCCCTGGCCGGGGCTGG + Intronic
920310106 1:205043724-205043746 CGGGTGCCCAGGGCCGGCCCAGG - Intronic
920502071 1:206491771-206491793 CTGGAGCCCAGGGCCTGGCCTGG + Exonic
921053661 1:211528170-211528192 CTGGAGGCCCTGGCCTGCCCTGG - Intergenic
921155167 1:212433239-212433261 CGGGCGCCCTGGGCCGGCGGGGG + Intronic
921650723 1:217674746-217674768 CTGGAGCCACAGGCCAGAGCAGG - Intronic
922116468 1:222618353-222618375 CCGCAGCCCCTGGCCGGCCCGGG + Intronic
922758125 1:228107982-228108004 CTGGTGACCCGTGCCGGGGCAGG + Exonic
924172439 1:241356756-241356778 CGGGAGCCCCGCGCCGGGGCTGG - Intronic
924436708 1:244049001-244049023 CAGGGGCCAGGGGCCGGCGCCGG - Intronic
1062769090 10:85609-85631 CTGGAGCCCTGGCCCAGCTCTGG + Intergenic
1065926029 10:30434340-30434362 CTGGAGCGCTCGGCCGGCGTGGG + Exonic
1066220553 10:33334236-33334258 CCTGAGCCCCGGTCCGGGGCGGG + Intronic
1067060923 10:43077522-43077544 CGGGCGCCTCGGGCCGGGGCTGG + Intronic
1067084369 10:43230058-43230080 CTGGCGCGCGGGGCCGGCGAGGG + Intronic
1070329183 10:75405659-75405681 CAGGAGCCGCGGCCCGGCCCGGG + Intergenic
1072021802 10:91410174-91410196 CGCGAGCCCCGGGCGGGCGGGGG + Intergenic
1072169984 10:92849094-92849116 CTGGCGCGCCGGGCTGCCGCGGG + Intronic
1073288103 10:102400389-102400411 CTGGCGCTGCGGGCAGGCGCTGG + Exonic
1073789793 10:106928405-106928427 CTGGAGTTCCGGGTGGGCGCGGG - Intronic
1074399053 10:113126780-113126802 GTGGAGCCCGCGGCCGGCGCGGG + Intronic
1075648656 10:124113076-124113098 GTGCAGCCCCGGGCGGGGGCAGG + Intergenic
1076661159 10:132056925-132056947 CTGGAACCCAGGGCGGGAGCTGG - Intergenic
1076909353 10:133379446-133379468 CTGGAGGCCACGGCCCGCGCCGG + Exonic
1077103530 11:832483-832505 CTGGAGACCCGGGCAGGCCTGGG - Intergenic
1077214627 11:1390251-1390273 CGGGCGCCCCTGGCCGGCGCCGG + Intronic
1079122518 11:17695914-17695936 CCGCAGCCCCGGCCCGGCCCCGG - Intergenic
1081636756 11:44726967-44726989 CTGGAGCCCCGCGACGCCGGCGG - Intronic
1083631522 11:64097812-64097834 CTGCAGCCCCAGGCCTGAGCAGG - Intronic
1083766617 11:64844501-64844523 GTCGAGCCCCGGGCAGCCGCCGG + Exonic
1084086305 11:66856905-66856927 CCCGAGGCCCGGGCCGGCGCGGG - Intronic
1084129178 11:67119742-67119764 CCCGAGCCCCGGGCCGGCCCCGG - Exonic
1084165583 11:67373421-67373443 CGGGAGCCCCGCGCCGGGGCCGG - Intronic
1084192485 11:67505264-67505286 CTGGAACCCGAGGCCGGGGCTGG - Exonic
1084695905 11:70755547-70755569 CTGCAGGCCGGGGCCGGGGCTGG - Intronic
1084749289 11:71193641-71193663 CAGGTGCCCAGGGCCGGAGCAGG - Intronic
1084837580 11:71813845-71813867 CTGGAGACCCGGCCCGCCGAGGG + Intergenic
1084888120 11:72223828-72223850 CCGGCTCCCCGGGGCGGCGCGGG + Intronic
1084973044 11:72781728-72781750 CGGGAGACCCGGGGCCGCGCGGG + Intronic
1089533855 11:119149219-119149241 CCGGCGGCCCGGGCCGGGGCGGG - Exonic
1092401118 12:8180224-8180246 CTGGAGACCCGGCCCGCCGCGGG - Intronic
1092471746 12:8787315-8787337 CTGGAGTTCCGGGCGGGCGTGGG + Intergenic
1092472939 12:8794772-8794794 CTGGAGTTCCGGGCGGGCGTGGG + Intergenic
1092861902 12:12725649-12725671 GAGGGGCCCCGGGCGGGCGCGGG - Intergenic
1095743729 12:45634696-45634718 CAGCAGCCCTGGGGCGGCGCTGG + Intergenic
1096622679 12:52874317-52874339 CTGGGGCCCCCGGCCGCCGTGGG - Intergenic
1096622685 12:52874328-52874350 CGGGGGCCCCAGGGCGGCGCCGG + Intergenic
1097021561 12:56024664-56024686 CTGGAGCCCCCAGCCGGTTCAGG - Intronic
1100260492 12:92928792-92928814 ACGGAGCCCCGCGCCGGAGCGGG + Intronic
1100594624 12:96061222-96061244 CTTGAGGCCGGGGCCGTCGCTGG + Intergenic
1102937716 12:116911387-116911409 CTGGGGGCGGGGGCCGGCGCAGG - Intronic
1103509713 12:121466564-121466586 TGCGAGCCGCGGGCCGGCGCGGG - Intronic
1103723306 12:122986037-122986059 CTGGAGCCGGGGGCAGCCGCGGG - Exonic
1103921517 12:124401885-124401907 CTGCAGCCCCTGGCAGGCACAGG + Intronic
1104049631 12:125186729-125186751 CGGGAGCCGCGGGCCGGGCCGGG + Intergenic
1104207825 12:126657068-126657090 GTGGAGCTCCGAGCCTGCGCAGG + Intergenic
1104802673 12:131565405-131565427 ATGGAGCCCCGGACAGGCGCTGG - Intergenic
1104910842 12:132240297-132240319 CTGTAGCCCCGGCCCGGCTCTGG + Intronic
1105074529 12:133264223-133264245 GAGGCGCCCCGCGCCGGCGCGGG - Intergenic
1106480828 13:30135692-30135714 CTGGAGCCCCGGGGTGGCTGGGG + Intergenic
1107259405 13:38472742-38472764 CTGGAGCTCCGGGTGGGCGAGGG - Intergenic
1107978643 13:45713898-45713920 CTGCAGCCCCGGGCTGCTGCAGG + Exonic
1113874303 13:113584912-113584934 CGGGAGCCGCGGGCGGGAGCCGG + Intronic
1114035879 14:18626846-18626868 CTGGAGGCCGCGGCGGGCGCTGG + Intergenic
1114122760 14:19688176-19688198 CTGGAGGCCGCGGCGGGCGCTGG - Intergenic
1114270667 14:21098309-21098331 CACGAGCCCCGGGCGGGCGGCGG + Exonic
1114513971 14:23285832-23285854 CTGGAGCCCCATCCCCGCGCTGG - Intronic
1114637389 14:24195579-24195601 CTGGAGGCCCGGCCCAGCTCCGG + Intronic
1115243310 14:31270423-31270445 CTGGAGCCAAGGGCCAGAGCTGG + Intergenic
1115701970 14:35962655-35962677 CTTGAGCCCAGGGGCAGCGCAGG - Intergenic
1117336427 14:54760378-54760400 CTGGAGCCCCCCGCTGGCCCCGG - Exonic
1117920538 14:60722775-60722797 GTGCAGACCCCGGCCGGCGCCGG + Intronic
1118285260 14:64465373-64465395 CCGGAGGCGCGGGGCGGCGCGGG - Intronic
1118610124 14:67533288-67533310 CCGGAGTCCCGGGCTGCCGCCGG - Exonic
1120813044 14:88824671-88824693 CTGGAGCGCTGGGCCTTCGCTGG + Exonic
1121433499 14:93903668-93903690 CTGGAGCCCCCGGGAGGAGCTGG - Intergenic
1121647989 14:95534430-95534452 CTGGAACCCCGGTCAGGCTCCGG + Intronic
1122296673 14:100709811-100709833 CTGGGCTCCCGGGCAGGCGCCGG - Intergenic
1123011368 14:105351049-105351071 CGGGAGCCCGGGGCCAGCCCAGG - Intronic
1124129390 15:26971210-26971232 CTGGAGCCGCGAGCGGGCGCGGG - Intergenic
1124973671 15:34514516-34514538 CGGCAGTCCCGGGCCGGGGCTGG + Intergenic
1124983734 15:34585173-34585195 CTGGAGCCCGGGGGCGGGGGTGG + Intronic
1125577900 15:40767617-40767639 CAGCTGCCCCGGGCCGGAGCTGG + Exonic
1125674230 15:41493981-41494003 CTGCAGCCCGGGGCTGGAGCGGG + Exonic
1126736584 15:51737390-51737412 GTGGAGCACCGGGTCCGCGCGGG - Exonic
1128028654 15:64460790-64460812 CCGGGGCCCCGGGCGGGCGGAGG + Intronic
1128173239 15:65531008-65531030 ATGGAGCCCAGGCCCGGCCCTGG + Intronic
1128322582 15:66703538-66703560 TCGGAGCCAGGGGCCGGCGCTGG + Exonic
1128482958 15:68054989-68055011 AGCGAGCCCCGGGCCGGCGTTGG + Intronic
1129162269 15:73753266-73753288 CTGGCCGCCCGGGCGGGCGCTGG + Intergenic
1129273863 15:74433199-74433221 CCCGAGCTCCGGGCCGGGGCGGG + Intronic
1129539107 15:76336708-76336730 CACTAGCCCCGGGCCGGAGCTGG - Exonic
1130305326 15:82709426-82709448 CTGGAGCCCCGGCCCAGCGCGGG - Intronic
1130411838 15:83654229-83654251 GTGCAGCCCCGGGGCCGCGCGGG - Exonic
1131215182 15:90530204-90530226 GTGAGGGCCCGGGCCGGCGCGGG + Intronic
1131238470 15:90717493-90717515 CTGGCGGCCCGGCCCGGAGCTGG + Intronic
1132146946 15:99434835-99434857 CGGGAGCCCCGGGCTGGTGGGGG - Intergenic
1132510992 16:341312-341334 CTGGAGTCCCGGGTGGGCGTGGG + Intronic
1132527827 16:426213-426235 TTGGAGCGCCGGGCCGGCCCCGG + Exonic
1132656563 16:1044040-1044062 GTGGGGCCCTGGGCCGGCGGCGG + Intergenic
1132670282 16:1099712-1099734 CTGCAGCCCCGGGACCGCCCAGG - Intergenic
1132683575 16:1153340-1153362 CTGGGGGCCGGGGCCGGGGCCGG + Exonic
1132683594 16:1153374-1153396 CTGGGGGCCGGGGCCGGGGCCGG + Exonic
1132728229 16:1348034-1348056 CTGGAGCCTGGGGCTGGGGCTGG - Intronic
1132747176 16:1441662-1441684 CTGTGGACCCGGGCAGGCGCTGG + Intronic
1133188194 16:4115460-4115482 CTGGTGACCCCGGCCGGGGCAGG - Exonic
1133245094 16:4443308-4443330 CTGGAGCCCCAGGCTGGAGGAGG + Intronic
1133738729 16:8635240-8635262 CTGGAGCTCGGGGCCGGCACGGG + Exonic
1134584146 16:15396309-15396331 CTGGGGACCCGGGCAGGAGCCGG + Intronic
1135016079 16:18926122-18926144 CCTCAGCCCCGGGCCGGAGCGGG - Exonic
1135437263 16:22437298-22437320 CCTCAGCCCCGGGCCGGAGCGGG + Intergenic
1136192144 16:28623007-28623029 CTGGGGACCCGGGCAGGAGCCGG - Intronic
1136333169 16:29595047-29595069 CCTCAGCCCCGGGCCGGAGCGGG - Intergenic
1136447863 16:30335113-30335135 CCTCAGCCCCGGGCCGGAGCGGG - Intergenic
1136455614 16:30378266-30378288 CCGTAGCCCCGCCCCGGCGCTGG - Exonic
1136477833 16:30524504-30524526 CTGGGGCCCCAGGTCAGCGCCGG + Exonic
1137426430 16:48384955-48384977 CTGGAGCCCCGGGCCCGGCGGGG - Intronic
1137627791 16:49920617-49920639 CTGGAGCCCTGGGCTTGCCCTGG - Intergenic
1139437078 16:66942512-66942534 GTGGAGCCCCAGGCTGGGGCAGG - Intronic
1141658337 16:85428234-85428256 CAGGAGCCCAGGGCCGGGGCTGG - Intergenic
1141749828 16:85951014-85951036 CTGGAGCCCCTGGCCGGGCTGGG + Intergenic
1141840048 16:86568296-86568318 CTGGAGGCCGGGGCCGCCGGGGG + Exonic
1142136251 16:88453259-88453281 CTGGAGGCACGGGGCGGGGCCGG - Intergenic
1142136360 16:88453583-88453605 CTCTAGCCCCGGGCGGGCGGCGG - Exonic
1142156420 16:88534609-88534631 CTCGACCCCCGGGCCGGCCAGGG - Exonic
1142174751 16:88639969-88639991 GGGGAGCCCCGAGCCGTCGCGGG - Exonic
1142229365 16:88892640-88892662 CAGGAGCCCTGGGCCCGCCCAGG + Intronic
1142262611 16:89049957-89049979 AGGGAGCTCCGAGCCGGCGCGGG + Intergenic
1142376801 16:89710803-89710825 CTGGGGCCGCGGGGCTGCGCTGG + Exonic
1142429657 16:90019319-90019341 ATGGAGCCCCCGGAGGGCGCCGG - Intronic
1142711605 17:1726726-1726748 CAGGAGCCCCAGCCAGGCGCTGG - Exonic
1142836813 17:2593662-2593684 CTGGAGCGGCGGGGCGGCGGCGG + Intronic
1142964725 17:3573417-3573439 CTGGATCCCCGGGCCTGGCCGGG + Intronic
1143030038 17:3962866-3962888 CTGGGGGCGAGGGCCGGCGCAGG - Intronic
1143515393 17:7417195-7417217 CTGGCGCCCCGGGCACACGCCGG + Exonic
1144728251 17:17512447-17512469 CTGGAGCCCCAGGGAGGTGCAGG - Intronic
1145762491 17:27433785-27433807 CTAGAGCCCAGGGCTGGGGCCGG - Intergenic
1145912898 17:28552641-28552663 CTGGGGCCCCGGCCGGGGGCGGG - Exonic
1146581162 17:34040023-34040045 GTGGAGCCCGGCGCCGGCGGTGG - Intronic
1147190665 17:38736200-38736222 CTGGAGCCCCGAGCTGGCCAGGG - Intronic
1148081699 17:44970455-44970477 TTGGATGCCCCGGCCGGCGCGGG - Intergenic
1148849327 17:50547245-50547267 CTGCTGCCCCGCGCCGGTGCAGG + Exonic
1148855309 17:50575946-50575968 CTGGATCTCCGGGCTGGCCCGGG - Exonic
1150108603 17:62479123-62479145 GTGGAGCCCGGCGCCGGCGGCGG + Exonic
1150737219 17:67751210-67751232 CTGGAGCCTTGGGCCAGAGCAGG + Intergenic
1151499392 17:74479324-74479346 CTGGAGCCCCGGGCAGTGGGGGG - Intronic
1151780140 17:76240252-76240274 CTGCAGCCCCGGCCCGGCCCCGG + Exonic
1152413897 17:80146692-80146714 CCGGAGCGCAGGGCCGGCCCGGG + Intronic
1152586398 17:81191369-81191391 CTGGCCCCGCGGGCCGGCTCCGG - Intronic
1152816035 17:82408598-82408620 CTGGAGCCCTGGGAGGGAGCAGG - Intronic
1154196595 18:12271683-12271705 CTGGAGCGCGTGGCCGGCGGTGG - Intronic
1155507544 18:26548097-26548119 CTGGCGCCCCGGGCCCGCGGTGG - Intronic
1155910284 18:31498022-31498044 ATGGAGCCGGGGGCCGGCCCGGG - Exonic
1158954301 18:62524151-62524173 GTGGAGCCCCGGGTCGGCGGCGG + Exonic
1158954381 18:62524447-62524469 CCCGAGCCCCAGCCCGGCGCAGG + Intronic
1159260412 18:66005911-66005933 CTGCAGCCCCGGTGCGGTGCGGG - Intergenic
1159931435 18:74316176-74316198 CAGGATCCCGGTGCCGGCGCCGG + Intronic
1160663103 19:310465-310487 CTGGAGCTCCGGGCAGGTCCTGG - Intronic
1160813859 19:1026592-1026614 CGGGACCGCCGGGCTGGCGCGGG - Exonic
1160923042 19:1529502-1529524 CTGCAGCCCCGGGCTGGGACGGG - Intronic
1161101872 19:2425500-2425522 CTGGTCCCCTGGGCCGGGGCGGG - Intronic
1161333842 19:3700478-3700500 AGGGCGCGCCGGGCCGGCGCGGG + Exonic
1161384832 19:3985337-3985359 CTGGTGCCCCGGAGCGGCGGCGG - Intronic
1161473401 19:4472471-4472493 CGGGGGCCCCGGGCCGGAGGCGG + Intronic
1161556262 19:4944454-4944476 CTGGAGCCCCGGGACGCTGCAGG - Intronic
1161583923 19:5094969-5094991 CTGCAGCTCGGGGGCGGCGCCGG + Intronic
1161764572 19:6199632-6199654 CTGGAGCGCTGCGCTGGCGCAGG - Intergenic
1162022056 19:7872539-7872561 CTGGAGACCCCCACCGGCGCTGG + Exonic
1162932039 19:13962258-13962280 CCTGAGCCCCGGGCCGGCGCAGG - Exonic
1162944161 19:14032150-14032172 CCGGAGCCCCGGGGCGGGGTGGG + Intronic
1162975958 19:14207024-14207046 CTGGAGCCCCGCGTTGGAGCGGG + Intergenic
1163157875 19:15449248-15449270 CTGGCGCCCCGGCCCCGCCCCGG - Intronic
1163559197 19:18009031-18009053 CTGGGACCCAGGGCCGGTGCAGG - Exonic
1163677043 19:18660465-18660487 CTGGAGACTCGGACCGGCTCAGG + Intronic
1163844133 19:19628859-19628881 TGGGAGCCCGGGGCCGCCGCAGG - Exonic
1164144051 19:22499300-22499322 CTGGAGTTCCGGGTCGGCGTGGG - Intronic
1165864801 19:38930438-38930460 CTGCGCCCCCCGGCCGGCGCAGG + Intronic
1165916714 19:39265211-39265233 CTGGAGCCCCTGGCAGCCGCGGG + Intergenic
1165952207 19:39480787-39480809 CTGTAGCTCCGGCCCGGGGCGGG + Exonic
1166730612 19:45057204-45057226 CTGGAGCCCTGGCTCGGGGCTGG + Intronic
1166960417 19:46493370-46493392 CTGGCGCCCCCGGCCTGCGAGGG + Exonic
1167437194 19:49486345-49486367 CTGGAGCCCCGGGCCGGCGCTGG + Intergenic
1167738815 19:51312013-51312035 CTGCATCCCTGGGCCGGCGCGGG + Intronic
1168336283 19:55599409-55599431 CTGGAGACCCGGGGCGGCCCCGG + Intronic
1168404919 19:56105666-56105688 CTGGAGCCCTGGCCCGGCAGTGG - Intronic
926077082 2:9950877-9950899 GTGGTGCCCGGGGCCGGCCCGGG + Intergenic
926077085 2:9950884-9950906 CGCGCGCCCCGGGCCGGCCCCGG - Intergenic
926122832 2:10254165-10254187 CTGGAGACCAGGGCGGGCGCTGG + Intergenic
927981450 2:27377467-27377489 GTGGAGCCCCTGGCCAGCGGGGG + Exonic
931422738 2:62143223-62143245 CTGGAGCCCCAGGCTGACCCTGG + Intronic
932567930 2:72921054-72921076 CCTGAGCCCCTGGCCGGCGGCGG + Intronic
932812078 2:74834151-74834173 CAGGAGTCCCGGGCTGCCGCTGG + Exonic
932873291 2:75425343-75425365 CTGGAGCCATGAGCCGGAGCAGG - Intergenic
932892477 2:75609035-75609057 CAGGAGCCCCAGGGCAGCGCAGG - Intergenic
934520619 2:95018047-95018069 CAGCAGCCCCGGGCCGCCCCGGG + Intergenic
935219772 2:101002401-101002423 CCGGAGCCCCGGGCTGGCTCGGG - Intronic
935645334 2:105329677-105329699 CAGGAGCCGCGGGCCGGAGCGGG - Exonic
936104747 2:109614507-109614529 GTGGGGCCCCGAGGCGGCGCTGG + Exonic
936462831 2:112724782-112724804 CTGAAGCCTCGGGCAGGCCCTGG + Exonic
937221738 2:120346056-120346078 GCGGAGGCCCGGGCGGGCGCGGG + Intergenic
938368795 2:130756155-130756177 CGGGAGGGGCGGGCCGGCGCTGG - Intronic
939460933 2:142494606-142494628 CTGGAGTCCGTGACCGGCGCCGG + Intergenic
940851501 2:158691602-158691624 CTGGAGCCCAGGGCTGGCCTGGG - Intergenic
946373536 2:219294880-219294902 CTGGAGCCCCGGGTCGGGCCTGG - Intronic
947897663 2:233690661-233690683 CTGGAGACCCAGGCCTGCCCTGG - Intronic
948046831 2:234951874-234951896 CCGAAGCCCCGCCCCGGCGCGGG + Intergenic
948632987 2:239313853-239313875 CTGGAGCCCAGGGCCTGTCCTGG + Intronic
948806589 2:240455835-240455857 GCGGAGCTCCGGCCCGGCGCAGG - Intronic
1170813001 20:19689413-19689435 CTGAAGCCAGGGGCCGGAGCTGG - Intronic
1171972530 20:31573170-31573192 CTGGAGCCAGGCGCCGGCCCGGG - Intronic
1172245638 20:33443562-33443584 CTGGAGCTGCGCGCCGGGGCGGG - Exonic
1173740193 20:45394849-45394871 CAGGAGCCACAGGCCGGAGCAGG + Intronic
1174060909 20:47832540-47832562 CTGGAGACCCGGGGCGGAGCTGG - Intergenic
1174070989 20:47898830-47898852 CTGGAGACCCGGGGCGGAGCTGG + Intergenic
1174148938 20:48472563-48472585 CTGGAGACCCGGGGAGGAGCGGG - Intergenic
1174148957 20:48472669-48472691 CTGGAGACCCGGGGAGGAGCGGG - Intergenic
1174148974 20:48472775-48472797 CTGGAGACCCGGGGAGGAGCAGG - Intergenic
1174149570 20:48476568-48476590 CTGGAGACCCGGGGAGGAGCTGG + Intergenic
1174153069 20:48499828-48499850 CTGGAGACCCGGGGCGGAGCTGG - Intergenic
1174153585 20:48502764-48502786 CTGGAGCCCTAGGCAGGAGCTGG - Intergenic
1174560685 20:51428654-51428676 CTGGACCCCAGGGCAGGGGCGGG + Intronic
1174648473 20:52105096-52105118 CTGGAGCCCCGCCCGGGGGCTGG - Intronic
1175216859 20:57395761-57395783 CTGGAGAGCTGGGCCGGAGCTGG + Intronic
1175715915 20:61253771-61253793 CTGGAGCTCCGGGCTGGGGGCGG + Intronic
1175926544 20:62474234-62474256 CTCCAGGCCCGGCCCGGCGCCGG + Intronic
1175935350 20:62511455-62511477 CTGGGCCCCCAGGCCGGCCCAGG + Intergenic
1176156911 20:63626704-63626726 TTGGCGCCGCGGGCGGGCGCGGG - Intronic
1176207113 20:63895205-63895227 CTGGAGACCCCGGGCGGCGGCGG - Exonic
1176390162 21:6159091-6159113 CGGGAGGCCCGGGCCGGTCCTGG + Intergenic
1177773166 21:25539513-25539535 CTGGAACCCTGGGCCAGAGCAGG + Intergenic
1178916406 21:36707873-36707895 CAGGAGCCCCCGGGCAGCGCGGG - Intronic
1179733304 21:43379149-43379171 CGGGAGGCCCGGGCCGGTCCTGG - Intergenic
1180001268 21:44996605-44996627 CAGGAGCCCGGGGCTGGGGCTGG + Intergenic
1180032982 21:45224664-45224686 CGGGAGCCCTGGGCCGGGGCAGG + Exonic
1180460000 22:15553900-15553922 CTGGAGGCCGCGGCGGGCGCTGG + Intergenic
1180649991 22:17369611-17369633 CAGGAGCCGAGGGCGGGCGCCGG - Exonic
1180699720 22:17774566-17774588 CCACAGCCCCGCGCCGGCGCGGG - Intronic
1180708949 22:17826733-17826755 CTGCAGCCCTGGGCCGGCGGTGG - Intronic
1181006583 22:20016528-20016550 CTGGGGCCTCGGGTCGGAGCCGG - Intronic
1181049480 22:20231822-20231844 CTGGGGCCCCTGGCCAGCACGGG - Intergenic
1181057898 22:20268465-20268487 ATGGCGGCCCGGGCCGGAGCCGG + Exonic
1181269851 22:21652612-21652634 CTGGAGCCGCGGGCCGAGTCAGG + Intronic
1182301052 22:29337400-29337422 CTGGAGCCCCTGGCAGGGTCTGG - Intronic
1183411760 22:37659073-37659095 CCGGAGGCCCGGGCAGGCGCTGG - Exonic
1183486380 22:38089454-38089476 CTGAGGCCCCGGGCCCCCGCGGG + Intronic
1184465877 22:44668724-44668746 CCGGAGCCCGGGGCCGGGGGAGG - Intronic
1184689065 22:46109286-46109308 CTGGAGCCCCTGCCTGGGGCTGG + Intronic
1185042998 22:48515303-48515325 CTGGAGCCCAGGGCTTGCGCAGG + Intronic
1185230587 22:49678300-49678322 CTGGAGCCCCAGGCCGGCTCAGG + Intergenic
1185317635 22:50185887-50185909 CTGGGGCCGCGGGGCGGGGCGGG - Intergenic
949638194 3:6007386-6007408 CTAGAGTCCCGTGCCGGGGCTGG - Intergenic
950076965 3:10194108-10194130 ATGGAGCCCTGGGACGGCCCTGG + Intronic
950548985 3:13655202-13655224 CCGCAGCCCCTGGCCGGGGCTGG + Intergenic
951509602 3:23486540-23486562 CAGGAGCCATGGGCCGGAGCAGG - Intronic
953027362 3:39152957-39152979 CGGGCGCCCCCGGCCGGCGGGGG - Intronic
953562118 3:43999405-43999427 CTGGGACCGCGGGCTGGCGCCGG - Intergenic
953927857 3:46991468-46991490 CTGGAGCCGTGGGCCAGCCCCGG + Exonic
953979507 3:47406621-47406643 CTGGGGCCCCAGGGCGGGGCAGG + Intronic
954582627 3:51711296-51711318 CTGCAGCCCCGGGTTGGGGCAGG + Intronic
958022608 3:88015739-88015761 CTGGAGTTCCGGGTCGGCGTGGG + Intergenic
960937604 3:122913114-122913136 CGGGAGCCCCGGGGAGGCCCAGG - Intronic
961013477 3:123450039-123450061 CTGGAGCCCTGGCCGGGGGCGGG - Intergenic
961664825 3:128488630-128488652 GTGGAGACCCGGACTGGCGCCGG + Intronic
961716280 3:128859598-128859620 CTGGAGCCCCAGGCCAGGGGAGG - Intergenic
962249764 3:133828804-133828826 CAGGAGCCCCCGGCCAGCGAGGG - Exonic
963870316 3:150408759-150408781 CGGGAGCCGCGGGCCGGAGCTGG - Exonic
968036196 3:195550055-195550077 CTGGAGCCCAGAGCCAGAGCTGG - Intergenic
968161638 3:196432021-196432043 CCGGGTCCCCGGGCCGGCGGGGG + Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968583613 4:1406018-1406040 CTGGAGCGCCGCGCCCTCGCCGG - Exonic
968609946 4:1552385-1552407 CTGGAGCCCAGGCCCAGGGCAGG + Intergenic
969511839 4:7622542-7622564 CTGGAGTCCCAGGCAGGGGCTGG + Intronic
969715634 4:8866928-8866950 CTGGAGCCCAGGGCTGGGCCAGG - Intronic
969721291 4:8894210-8894232 CGGGAGCGCAGGGCCGGGGCGGG - Intergenic
969778996 4:9381356-9381378 CTGGAGACCCGGCCCGCCGCGGG + Intergenic
973954502 4:56049389-56049411 CTGGAGTCCCGGGGCGCTGCGGG - Intergenic
975608514 4:76180240-76180262 CTGGAGTCCCTGGCCGACACAGG + Intronic
978741906 4:112145940-112145962 CGCGACCCCGGGGCCGGCGCTGG - Intronic
980075216 4:128287531-128287553 CTGGGGGCCGGGGCCGGGGCGGG - Exonic
980481610 4:133395167-133395189 CTGGAGCCACGGGCTGGAGAGGG + Intergenic
981508369 4:145527960-145527982 CTTGAACCCAGGGCCGGGGCCGG - Intronic
982436662 4:155388362-155388384 CTGGAGCCCATGGCCGGGGCAGG - Intergenic
983026074 4:162739590-162739612 CTGGAGTTCCGGGCGGGCGGGGG + Intergenic
985550182 5:528785-528807 CCGGAGCCCCGGGCGGGGGGAGG - Intergenic
985760259 5:1745296-1745318 CACGAGCCCCGGGCCTGGGCAGG - Intergenic
987015103 5:13810179-13810201 GTGGAGCGCGGGGGCGGCGCTGG - Exonic
988065805 5:26228180-26228202 CTGAAGACCCGGGCAGGAGCTGG - Intergenic
992042377 5:72848556-72848578 CGGGAGCCCCCGGCCGCCGGGGG - Intronic
992102316 5:73419489-73419511 TTGGATTGCCGGGCCGGCGCGGG + Intergenic
992271085 5:75063554-75063576 CTGGAGCCCCGAGGCAGTGCAGG + Intergenic
992939943 5:81751507-81751529 CTGGAGTCTCCGGCCGGAGCCGG + Intronic
997585515 5:135040798-135040820 CTGGAGCCCGTGGCCGTCGGCGG - Intronic
999188453 5:149730197-149730219 CTCGAGCCCCCGGCTGCCGCAGG - Intergenic
1001035256 5:168292331-168292353 CTGGAGCCGCCGGCCGGGACTGG + Intronic
1001599450 5:172919509-172919531 CTGGAGCCCCCAGCCAGCTCTGG + Intronic
1002058096 5:176610133-176610155 CGGGAGCGCGGAGCCGGCGCTGG - Exonic
1003139042 6:3456407-3456429 CTGGATCTCCGCGCCGCCGCCGG + Exonic
1003947256 6:11087267-11087289 CTGGAGCTCCGGGTGGGCGTGGG + Intergenic
1004053177 6:12108700-12108722 CTGGAGCTCCGGGTGGGCGTGGG - Intronic
1004665550 6:17745617-17745639 CTGGAGTTCCGGGTGGGCGCGGG - Intergenic
1006135443 6:31892973-31892995 CTGGAGCCCCAGGCGGGGGTGGG + Intronic
1006303886 6:33207834-33207856 CAGGAGCCGCGGCCCGGGGCGGG - Intergenic
1006950704 6:37819546-37819568 CCGGAGCCCCCCGCCGGCTCCGG - Exonic
1007107883 6:39295805-39295827 CTGGAGCCCAGGGGCGTGGCTGG + Intergenic
1007557792 6:42781921-42781943 GCGGCGCCCCGGCCCGGCGCGGG + Intronic
1010044179 6:71420870-71420892 CTGGAGCCAGGGGGCGGAGCGGG - Intergenic
1010204537 6:73310395-73310417 CTGGAGCCCCTGGAAAGCGCTGG - Intergenic
1010489036 6:76452479-76452501 CTGGAGCCGCGGGCTGGAGTGGG - Intergenic
1011603594 6:89081389-89081411 CGGGAGCCGCGGGCCGCAGCGGG - Exonic
1013980342 6:116121288-116121310 CTGGAGCCCCAGGCCAGCCAGGG - Exonic
1014725056 6:124962941-124962963 CTGGAGCCCAGGACCCGCGTGGG + Exonic
1016730518 6:147422959-147422981 CTGGAGCCCTGGGCCAGAGTGGG + Intergenic
1017009361 6:150052911-150052933 CTGGAGCCCTGGGGAGGAGCCGG - Intergenic
1017009497 6:150053741-150053763 CTGGAGACCCGGGTAGGAGCCGG - Intergenic
1018774212 6:166998863-166998885 CTGCAGCCCCGGGGGGGCGCCGG - Intergenic
1018800481 6:167218286-167218308 CTGGAGCCATGGCCCGGCCCAGG + Intergenic
1018827524 6:167421077-167421099 CCGGGGGCCCGGGCCGGCTCAGG - Intergenic
1019151304 6:170007765-170007787 CGTGAGCCCGGGGGCGGCGCAGG + Intergenic
1019487450 7:1295898-1295920 CTGGGGCCCCAGGCCTGGGCAGG + Intergenic
1019707768 7:2504712-2504734 CTGCAGCCCCTGGCCCGTGCTGG - Intergenic
1019745988 7:2700652-2700674 CGGGAGCCTCGGGTCGGCTCAGG - Exonic
1019989667 7:4682605-4682627 GCAGAGCCCGGGGCCGGCGCTGG + Exonic
1020096877 7:5374371-5374393 CAGCAGCCCGGGGCCGGCGGTGG + Exonic
1020130225 7:5555351-5555373 CTGCACCCCCGGGCCGGCGAGGG - Intronic
1020278078 7:6636872-6636894 CCAGATCCCCGGGCCCGCGCGGG - Intergenic
1023614921 7:42010204-42010226 CTGGAGCCTCGTGCAGGCACAGG - Intronic
1023934539 7:44730099-44730121 CTGGAGCCACGGGCCAGAGTGGG + Intergenic
1024043836 7:45574485-45574507 CCGGCGCCCCGGGCCGGCGAGGG + Intronic
1025233128 7:57216252-57216274 CTGGAGCCCAGGGGAGGAGCCGG + Intergenic
1025233373 7:57217757-57217779 CTGGAGCCCTAGGCAGGAGCTGG + Intergenic
1025257606 7:57395779-57395801 CTGGAGCCCCTGGGAGGGGCGGG + Intergenic
1025840403 7:65141272-65141294 CTGCAGCCCCGGGCTGGCCGGGG - Intergenic
1025878311 7:65508892-65508914 CTGCAGCCCCGGGCTGGCCGGGG + Intergenic
1025882654 7:65554692-65554714 CTGCAGCCCCGGGCTGGCCGGGG + Intergenic
1025890789 7:65647911-65647933 CTGCAGCCCCGGGCTGGCCGGGG - Exonic
1026471069 7:70694453-70694475 GGGGAGCCCCGGGCGGCCGCCGG + Intronic
1027001804 7:74658723-74658745 CAGGCGCGCCGGGCCGGCCCGGG - Intronic
1029414760 7:100435937-100435959 CTGGAGCTGCGGGCCGCAGCCGG - Exonic
1030358454 7:108569586-108569608 CTGGAGACCGGGGCCGGCGACGG + Exonic
1032402530 7:131633741-131633763 CTGGAGCCCTGAGCTGGCTCTGG - Intergenic
1033253196 7:139777829-139777851 CTGCCGCCCGGGCCCGGCGCGGG + Intronic
1033285751 7:140039338-140039360 CTGGAGGCCTGGGTCGGGGCAGG - Intronic
1033390648 7:140924615-140924637 ATGGAGCCCGAGGCCGGCGCCGG - Exonic
1033477031 7:141701747-141701769 CGGGAGCCCGGGGCCGGCCCTGG + Intronic
1034063408 7:148113832-148113854 CTGGAGACCCAGCCCGGGGCTGG - Intronic
1034089716 7:148352598-148352620 CTAGAGCCCTGGGCAGGGGCAGG + Intronic
1034423057 7:150999201-150999223 TTGCAGCCCTGGGCCTGCGCTGG + Exonic
1034441275 7:151087118-151087140 GTGGAGCCCTCGGCCGGCGCCGG - Intronic
1035297548 7:157875848-157875870 CTGCAGCCCCGTGCCTGCCCTGG - Intronic
1035297594 7:157875968-157875990 CTGCAGCCCCGTGCCTGCCCTGG - Intronic
1035356856 7:158280905-158280927 GTGTAGCCGTGGGCCGGCGCAGG - Intronic
1035496818 7:159335248-159335270 AAGGCGCCCCGCGCCGGCGCGGG - Intergenic
1036276436 8:7355315-7355337 CTGGAGACCCGGCCCGCCGCGGG + Intergenic
1036344905 8:7955030-7955052 CTGGAGACCCGGCCCGCCGCGGG - Intergenic
1036840244 8:12115797-12115819 CTGGAGACCCGGCCCGCCGCGGG - Intergenic
1036862034 8:12362034-12362056 CTGGAGACCCGGCCCGCCGCGGG - Intergenic
1037806658 8:22061604-22061626 CTGGAGCCTCGGGGAGGCCCTGG - Intronic
1039475451 8:37837284-37837306 GTGGAGCCCAGGGCCTGCTCCGG + Intronic
1042021445 8:64374008-64374030 ATGGAGCCCCGGCCAGCCGCGGG + Intergenic
1042246291 8:66712385-66712407 CTGGGGCCCAAGACCGGCGCGGG - Intronic
1043390333 8:79785540-79785562 CTGGAGCCCTGTGCTGCCGCTGG - Intergenic
1047100157 8:121667526-121667548 CAGGAGCCCCCGGCGGGGGCGGG + Intergenic
1047343950 8:124009429-124009451 CTGGAGCCCAGGGGAGGAGCCGG + Intronic
1047454803 8:124998872-124998894 CGGGGGCTGCGGGCCGGCGCGGG - Exonic
1047961769 8:130016370-130016392 CTGGCGGCCCGGGCGGGCGAGGG + Intronic
1049373942 8:142280268-142280290 CTGCAGCCCCGAGCCGGCCGCGG - Intronic
1049406210 8:142452823-142452845 CTGGAGCCCCGCGGCGTCCCCGG - Intronic
1049592621 8:143469447-143469469 CTGAAGCCCTGGGCTGGCGCTGG + Intronic
1049657452 8:143805083-143805105 CTGGGGCCCAGGGCCGGGGAGGG - Intronic
1049721075 8:144115856-144115878 CTGGTGCGCGGGGCCTGCGCCGG + Exonic
1049788403 8:144462237-144462259 CTGCAGCCCCGGGCTGGGCCGGG + Intronic
1049850335 8:144827217-144827239 CTGGGGACGCGGGCCGGGGCCGG - Intergenic
1057208073 9:93184972-93184994 ATGGAGCCCGGGCGCGGCGCGGG + Exonic
1057705262 9:97391186-97391208 GTGAAGGCCCGGGCCGGCGCAGG - Intergenic
1057846716 9:98531573-98531595 CTGGAGCCCCTGACAGGCGGTGG + Intronic
1059769856 9:117414888-117414910 CCGGAGCCCCGAGCCGGGGCCGG + Exonic
1060825029 9:126683039-126683061 CGGGAGCCCCCAGCCGGGGCTGG - Intronic
1060995483 9:127873124-127873146 CTGGAGTCCCAGGCCTGTGCTGG + Intronic
1061044231 9:128155944-128155966 CTGGAGCCACAGGCCAGAGCAGG + Intergenic
1061089957 9:128420888-128420910 CTGGAGCAGCGGCGCGGCGCGGG - Exonic
1061540970 9:131277667-131277689 CTGGAGTCTGGGGCCGGCGTGGG + Intergenic
1062134253 9:134916384-134916406 CTGGGGCCCCGGGCAGCCCCGGG + Exonic
1062231444 9:135484219-135484241 CAGCAGCCCCGGGCTGGAGCAGG + Intronic
1062467334 9:136687056-136687078 CCGGAGCCCCGGAGCGGGGCGGG + Intronic
1062577429 9:137215219-137215241 TTGGAGCCCAGGACCGGCCCTGG + Intronic
1062596946 9:137303789-137303811 GTGGAGCCCAGGCCCGGGGCAGG + Intergenic
1062656305 9:137605872-137605894 CGGGAGCCCTGGCCCCGCGCAGG - Intronic
1187391807 X:18891061-18891083 CTGGAGCCTCGAGCCGGGGGTGG - Intergenic
1189335147 X:40166605-40166627 CTGCAGCCCCAGGCTGGCTCAGG + Intronic
1190056866 X:47186199-47186221 CTGGAGCCCGGGGCCGGGGCCGG + Intronic
1190234689 X:48606408-48606430 CTGGAGCCCCAAGCTGGTGCAGG + Exonic
1191184191 X:57592410-57592432 CTGGAGCCCCGGGCCCTCCTCGG - Exonic
1191213200 X:57910049-57910071 CTGGAGCCCCGGGCCCGCCTTGG + Exonic
1193360678 X:80575015-80575037 CAGGAGTCCCGGGCTGCCGCTGG - Intergenic
1198184172 X:134237482-134237504 TTAGAGCCCCAGGCCGGGGCTGG + Intronic
1200057799 X:153470701-153470723 TGGGAGCCCGGGGCCCGCGCAGG - Intronic
1200092933 X:153644259-153644281 CGGGCGCCCCGGGCCTCCGCCGG - Intronic
1200418177 Y:2935178-2935200 TCGGCGCCCCGGGTCGGCGCCGG - Intronic