ID: 1167439539

View in Genome Browser
Species Human (GRCh38)
Location 19:49500381-49500403
Sequence GGGCCCCGGTACCACTGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167439539_1167439549 3 Left 1167439539 19:49500381-49500403 CCTGTTCAGTGGTACCGGGGCCC No data
Right 1167439549 19:49500407-49500429 CTGCTGGGAAGGAAGTGGGCAGG No data
1167439539_1167439544 -8 Left 1167439539 19:49500381-49500403 CCTGTTCAGTGGTACCGGGGCCC No data
Right 1167439544 19:49500396-49500418 CGGGGCCCAGGCTGCTGGGAAGG No data
1167439539_1167439550 13 Left 1167439539 19:49500381-49500403 CCTGTTCAGTGGTACCGGGGCCC No data
Right 1167439550 19:49500417-49500439 GGAAGTGGGCAGGAAGCGTCCGG No data
1167439539_1167439548 -1 Left 1167439539 19:49500381-49500403 CCTGTTCAGTGGTACCGGGGCCC No data
Right 1167439548 19:49500403-49500425 CAGGCTGCTGGGAAGGAAGTGGG No data
1167439539_1167439547 -2 Left 1167439539 19:49500381-49500403 CCTGTTCAGTGGTACCGGGGCCC No data
Right 1167439547 19:49500402-49500424 CCAGGCTGCTGGGAAGGAAGTGG No data
1167439539_1167439551 19 Left 1167439539 19:49500381-49500403 CCTGTTCAGTGGTACCGGGGCCC No data
Right 1167439551 19:49500423-49500445 GGGCAGGAAGCGTCCGGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167439539 Original CRISPR GGGCCCCGGTACCACTGAAC AGG (reversed) Intergenic
No off target data available for this crispr