ID: 1167439548

View in Genome Browser
Species Human (GRCh38)
Location 19:49500403-49500425
Sequence CAGGCTGCTGGGAAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167439539_1167439548 -1 Left 1167439539 19:49500381-49500403 CCTGTTCAGTGGTACCGGGGCCC No data
Right 1167439548 19:49500403-49500425 CAGGCTGCTGGGAAGGAAGTGGG No data
1167439534_1167439548 7 Left 1167439534 19:49500373-49500395 CCCTGGAGCCTGTTCAGTGGTAC No data
Right 1167439548 19:49500403-49500425 CAGGCTGCTGGGAAGGAAGTGGG No data
1167439535_1167439548 6 Left 1167439535 19:49500374-49500396 CCTGGAGCCTGTTCAGTGGTACC No data
Right 1167439548 19:49500403-49500425 CAGGCTGCTGGGAAGGAAGTGGG No data
1167439533_1167439548 8 Left 1167439533 19:49500372-49500394 CCCCTGGAGCCTGTTCAGTGGTA No data
Right 1167439548 19:49500403-49500425 CAGGCTGCTGGGAAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167439548 Original CRISPR CAGGCTGCTGGGAAGGAAGT GGG Intergenic
No off target data available for this crispr