ID: 1167439549

View in Genome Browser
Species Human (GRCh38)
Location 19:49500407-49500429
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167439533_1167439549 12 Left 1167439533 19:49500372-49500394 CCCCTGGAGCCTGTTCAGTGGTA No data
Right 1167439549 19:49500407-49500429 CTGCTGGGAAGGAAGTGGGCAGG No data
1167439535_1167439549 10 Left 1167439535 19:49500374-49500396 CCTGGAGCCTGTTCAGTGGTACC No data
Right 1167439549 19:49500407-49500429 CTGCTGGGAAGGAAGTGGGCAGG No data
1167439539_1167439549 3 Left 1167439539 19:49500381-49500403 CCTGTTCAGTGGTACCGGGGCCC No data
Right 1167439549 19:49500407-49500429 CTGCTGGGAAGGAAGTGGGCAGG No data
1167439534_1167439549 11 Left 1167439534 19:49500373-49500395 CCCTGGAGCCTGTTCAGTGGTAC No data
Right 1167439549 19:49500407-49500429 CTGCTGGGAAGGAAGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167439549 Original CRISPR CTGCTGGGAAGGAAGTGGGC AGG Intergenic
No off target data available for this crispr