ID: 1167439551

View in Genome Browser
Species Human (GRCh38)
Location 19:49500423-49500445
Sequence GGGCAGGAAGCGTCCGGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167439546_1167439551 -2 Left 1167439546 19:49500402-49500424 CCAGGCTGCTGGGAAGGAAGTGG No data
Right 1167439551 19:49500423-49500445 GGGCAGGAAGCGTCCGGAGACGG No data
1167439545_1167439551 -1 Left 1167439545 19:49500401-49500423 CCCAGGCTGCTGGGAAGGAAGTG No data
Right 1167439551 19:49500423-49500445 GGGCAGGAAGCGTCCGGAGACGG No data
1167439543_1167439551 5 Left 1167439543 19:49500395-49500417 CCGGGGCCCAGGCTGCTGGGAAG No data
Right 1167439551 19:49500423-49500445 GGGCAGGAAGCGTCCGGAGACGG No data
1167439534_1167439551 27 Left 1167439534 19:49500373-49500395 CCCTGGAGCCTGTTCAGTGGTAC No data
Right 1167439551 19:49500423-49500445 GGGCAGGAAGCGTCCGGAGACGG No data
1167439535_1167439551 26 Left 1167439535 19:49500374-49500396 CCTGGAGCCTGTTCAGTGGTACC No data
Right 1167439551 19:49500423-49500445 GGGCAGGAAGCGTCCGGAGACGG No data
1167439533_1167439551 28 Left 1167439533 19:49500372-49500394 CCCCTGGAGCCTGTTCAGTGGTA No data
Right 1167439551 19:49500423-49500445 GGGCAGGAAGCGTCCGGAGACGG No data
1167439539_1167439551 19 Left 1167439539 19:49500381-49500403 CCTGTTCAGTGGTACCGGGGCCC No data
Right 1167439551 19:49500423-49500445 GGGCAGGAAGCGTCCGGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167439551 Original CRISPR GGGCAGGAAGCGTCCGGAGA CGG Intergenic
No off target data available for this crispr