ID: 1167441041

View in Genome Browser
Species Human (GRCh38)
Location 19:49509048-49509070
Sequence CTCCTGAGGGACACTGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167441034_1167441041 20 Left 1167441034 19:49509005-49509027 CCCACAGTGATGGTAGTCAGACT 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1167441041 19:49509048-49509070 CTCCTGAGGGACACTGTAACAGG 0: 1
1: 0
2: 0
3: 4
4: 108
1167441038_1167441041 -4 Left 1167441038 19:49509029-49509051 CCAGGAAAAGCATAGCAGGCTCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1167441041 19:49509048-49509070 CTCCTGAGGGACACTGTAACAGG 0: 1
1: 0
2: 0
3: 4
4: 108
1167441033_1167441041 21 Left 1167441033 19:49509004-49509026 CCCCACAGTGATGGTAGTCAGAC 0: 1
1: 0
2: 1
3: 13
4: 178
Right 1167441041 19:49509048-49509070 CTCCTGAGGGACACTGTAACAGG 0: 1
1: 0
2: 0
3: 4
4: 108
1167441035_1167441041 19 Left 1167441035 19:49509006-49509028 CCACAGTGATGGTAGTCAGACTT 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1167441041 19:49509048-49509070 CTCCTGAGGGACACTGTAACAGG 0: 1
1: 0
2: 0
3: 4
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167441041 Original CRISPR CTCCTGAGGGACACTGTAAC AGG Intronic
903207042 1:21790307-21790329 CTCCTGAGGGTCGGTGTCACAGG + Intergenic
913045135 1:115067905-115067927 CTCCAGAGAGGGACTGTAACAGG + Intronic
917315413 1:173719494-173719516 CTCCTGACTGGCACTGTAGCTGG - Intronic
924755858 1:246940437-246940459 TTGCTGAGGGACACAGTCACTGG - Intergenic
1069087279 10:64155652-64155674 CTGCTGAATGAAACTGTAACTGG + Intergenic
1075553886 10:123415031-123415053 CTACTGATGCACACTGCAACAGG - Intergenic
1075658177 10:124175397-124175419 CTGCTCAGGGACACTGTCATTGG + Intergenic
1076624469 10:131812969-131812991 CTCCTGGGGGATTCTGAAACTGG - Intergenic
1076832732 10:133004818-133004840 CTCCTGAGGAAAACAGTAGCAGG - Intergenic
1078841307 11:15077573-15077595 CTCAGGAGGAACAATGTAACTGG - Intronic
1082883887 11:58064449-58064471 CACCTGAGGGACTCTGTAGATGG + Intronic
1083769165 11:64856718-64856740 CTCCCCAGGGACACTGTGGCAGG + Intronic
1086290217 11:85300401-85300423 CTCCTCAGGGATACAGTAAATGG + Intronic
1088423076 11:109669972-109669994 TTCCTGTGTGAAACTGTAACTGG - Intergenic
1089654982 11:119940834-119940856 CTCCTGAGAAACACTGGAAGAGG - Intergenic
1098826746 12:75306337-75306359 GTCCTCAGAGACACTGTTACAGG - Intronic
1098987082 12:77024160-77024182 CTCTTGGGGGTCACTGGAACTGG + Exonic
1101158227 12:101947524-101947546 GTCCTGTGGGACACTCAAACTGG + Intronic
1104368633 12:128201515-128201537 CTCCTGAAGGATACTTTTACTGG - Intergenic
1105856059 13:24373237-24373259 CTCCTCAGGTACACTTTATCAGG - Intergenic
1109875145 13:68392655-68392677 CTCCTGAGTGTCACTGTCATTGG - Intergenic
1113393062 13:109916372-109916394 CACCTGAGGGACAATGGAACTGG + Intergenic
1113842132 13:113366224-113366246 CACCTGAGGGACACAGTCCCAGG - Intergenic
1122140041 14:99657579-99657601 TTCCTGAGGGACCCTGGGACAGG - Intronic
1123204860 14:106702469-106702491 CTCCTGGGGGTCACTCTGACTGG + Intergenic
1123209862 14:106748910-106748932 CTCCTGGGGGTCACTCTGACTGG + Intergenic
1124229859 15:27935046-27935068 CTCCTCAGGGACACTGACAAAGG + Intronic
1124250015 15:28101002-28101024 TGCCTCAGGGACACTGTTACAGG + Intergenic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1128804390 15:70519805-70519827 CTACTGAGGGACAGTGTCATGGG + Intergenic
1131694816 15:94864917-94864939 CTCCTGAGGGCCACAGTCATAGG - Intergenic
1132433982 15:101781838-101781860 CTCCTGAGGCACACTGGACTGGG - Intergenic
1136156008 16:28382634-28382656 CTCCTGTGGGCCAATGTCACAGG + Intronic
1136207078 16:28732654-28732676 CTCCTGTGGGCCAATGTCACAGG - Intronic
1136396638 16:29996126-29996148 CTCCCGGGGGACACTGGGACAGG - Exonic
1137350870 16:47712877-47712899 CTCCTGACGGACACTGGGCCAGG - Intergenic
1142012373 16:87722321-87722343 CTCCTGAGGGAGCCTGGGACGGG + Intronic
1147457034 17:40544323-40544345 CTCCTGTGGGTGACTGTAATTGG + Intergenic
1149180937 17:53935237-53935259 CTTCTGAGGTACAGTGTAAAGGG + Intergenic
1149503767 17:57175664-57175686 CCCCTGTGGGACACAGAAACGGG - Intergenic
1152196439 17:78921203-78921225 TTCCTGGGGGACACAGTGACAGG - Intronic
1153368427 18:4286087-4286109 TTCCTCAGGGACACTGTCAAAGG + Intronic
1162013312 19:7830662-7830684 GTCCTGAGGGTCACTGCAAAGGG - Intronic
1162907837 19:13833947-13833969 CACCTGAGGGGCACAGTAAAGGG - Intergenic
1167441041 19:49509048-49509070 CTCCTGAGGGACACTGTAACAGG + Intronic
1167949409 19:53014473-53014495 GCCCTGAAGGACACTGTGACAGG + Exonic
1167953977 19:53049634-53049656 GCCCTGAAGGACACTGTGACAGG + Exonic
1168325568 19:55536966-55536988 CACCTGAGGGTGACTGTACCAGG - Intronic
928876761 2:36049117-36049139 CTGCTGAGGGACACTTCTACAGG - Intergenic
930093764 2:47551233-47551255 CTCCTAAGGGACCCTGGCACTGG + Intronic
930869341 2:56154200-56154222 TCCCTGAGGGACACTGGAGCAGG - Intergenic
931292283 2:60883200-60883222 CTTCTGAGGGTCACTGGACCAGG - Intronic
932171311 2:69559106-69559128 ATACTGAGGAACATTGTAACAGG - Intronic
933805733 2:85997128-85997150 GGCCTGAGGGACACTGTGGCTGG - Intergenic
937912898 2:127084805-127084827 CTCCTAAGGAACACTGCAATGGG - Intronic
938669273 2:133571531-133571553 CGGCTGGGTGACACTGTAACAGG + Intergenic
939608118 2:144276808-144276830 ATACTGAGGTACACTGTTACAGG - Intronic
942860817 2:180609554-180609576 CCTCTGAGGGATAGTGTAACAGG + Intergenic
945434465 2:209802834-209802856 AACCTGAGAGAAACTGTAACTGG - Intronic
946300525 2:218821179-218821201 CTCCCCAGGAACACTGTCACTGG + Intergenic
946645369 2:221827518-221827540 CTGCTGATGGACAATGTACCTGG - Intergenic
947544399 2:231000857-231000879 CTCCTGAGCGACTCTGTGAAGGG - Intronic
947879455 2:233493500-233493522 GTCCTGAGGGACCCTGAAGCTGG + Exonic
1173813378 20:45969853-45969875 TTCCTGGGGGACTCTGTGACTGG - Intronic
1176236916 20:64057721-64057743 CTCCTGAGGGACCCGGGACCAGG + Intronic
1178189229 21:30261559-30261581 CTCCTTAAGGACACAGAAACTGG - Intergenic
1179874592 21:44261638-44261660 GGCCTGAGGGACACTGTAGGAGG - Intronic
1180751957 22:18130823-18130845 CACCTGAGGGACACAGAAAGAGG - Exonic
1182187787 22:28425424-28425446 CCCCTGAAGGACACAGTAATGGG - Intronic
1183293382 22:37016403-37016425 CTCCTGAGGGAAACTGAAGGAGG + Intronic
1183864883 22:40696145-40696167 CTCATGAGGCACACAGTTACTGG + Intergenic
955931710 3:64064252-64064274 TTCCTGAGGGACAGGGAAACAGG - Intergenic
956085415 3:65603826-65603848 CTTCTGGGGGATGCTGTAACAGG - Intronic
959878682 3:111417512-111417534 ACCCTGAGGGACACTGCAACAGG - Intronic
961462441 3:127060591-127060613 TTCCTGTTTGACACTGTAACAGG - Intergenic
961509370 3:127391667-127391689 CTCCTGAGAGCCCCTGTAGCTGG + Intergenic
965617387 3:170608800-170608822 CTCCTGAAGGACATGGAAACTGG - Intronic
967840236 3:193999160-193999182 CTTCTGAGGGGCACTGTACCCGG - Intergenic
969074733 4:4568934-4568956 CTTCTGATGGACACTGTGAGAGG + Intergenic
969628112 4:8318422-8318444 CTCCTGGGGCACACTGGTACGGG + Intergenic
974475251 4:62370688-62370710 CTCCTGTGGTTCACTGAAACTGG - Intergenic
978474954 4:109116141-109116163 CTCCAGAGGGACACAGTAATGGG + Intronic
979502296 4:121454550-121454572 TTCCTGAGGGAAACTGTCCCTGG - Intergenic
980553982 4:134378867-134378889 CAGCTGAGGCACACTGTACCTGG - Intergenic
981275085 4:142890006-142890028 CTCATGAGAGACAATGAAACTGG + Intergenic
983836702 4:172395868-172395890 CTCCTCAGGGAGGCTGTATCAGG - Intronic
985863658 5:2494800-2494822 CTTCTGAGGGACACCGTGAAAGG - Intergenic
994774688 5:104027088-104027110 CTCCTTTGGGACACTGTGGCTGG + Intergenic
998013614 5:138715040-138715062 TTGCTGAGGGACACTGTCAAGGG - Intronic
1001872234 5:175166890-175166912 CTCCCAAGGGACACTGCAAAGGG - Intergenic
1009451514 6:63806110-63806132 TTCCTCAGGGACACTCTAATTGG - Intronic
1011185389 6:84669988-84670010 TTTCTGAGGGGCAGTGTAACAGG - Intergenic
1011638192 6:89394947-89394969 GTCATGAGGGACACTGAAATGGG + Intronic
1016988209 6:149910529-149910551 TTCCTGAAGGACAGGGTAACAGG + Intergenic
1017007267 6:150037247-150037269 TTCCTGAGGGACAAGGTGACAGG + Intergenic
1022452285 7:30526058-30526080 CTCCTGAGGCACACTGGACTGGG - Intronic
1030480307 7:110095127-110095149 TTCCTTGGGCACACTGTAACAGG - Intergenic
1034079340 7:148261903-148261925 CTCTGGAGGGACACTGCAAGAGG - Intronic
1035172260 7:157023504-157023526 CTCCTGAATGACACGGAAACGGG - Intergenic
1036074115 8:5475684-5475706 TACCTGATGGACAGTGTAACAGG - Intergenic
1041399405 8:57425971-57425993 CTTCTGAGGGGCAATGTCACAGG + Intergenic
1047009827 8:120659919-120659941 CTGCTTATTGACACTGTAACTGG - Intronic
1049314949 8:141960617-141960639 CTGTTGAGGGACAATGTAATTGG - Intergenic
1049534057 8:143169867-143169889 CTCCTGGGGGACACTGAGCCAGG + Intergenic
1050766606 9:9142264-9142286 CTCCTGAGAGGCCCAGTAACAGG + Intronic
1056202419 9:84289325-84289347 CTCCTGAGTCACACAGTGACTGG + Intronic
1056427130 9:86488559-86488581 CTGCTGAGAGACACTTTAATCGG + Intergenic
1061676328 9:132217988-132218010 CTCCTCAGGGCCAGTGTCACTGG + Intronic
1198362680 X:135911201-135911223 CTCCTCATGGACACTGTGAGTGG - Exonic
1198966424 X:142232259-142232281 CTCCTTAGGGACTCTCTAATTGG + Intergenic
1199276439 X:145948983-145949005 AATCTGAGGGAGACTGTAACGGG + Intergenic
1201780757 Y:17719851-17719873 TTCCTGAGAGACACTGAACCTGG - Intergenic
1201820796 Y:18186139-18186161 TTCCTGAGAGACACTGAACCTGG + Intergenic